ID: 990832892

View in Genome Browser
Species Human (GRCh38)
Location 5:59980394-59980416
Sequence TGGGTTTGCCTTAAAAAATA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 242
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 227}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990832887_990832892 12 Left 990832887 5:59980359-59980381 CCCTAGCACTTTTCACGGTAAAA 0: 1
1: 0
2: 0
3: 11
4: 134
Right 990832892 5:59980394-59980416 TGGGTTTGCCTTAAAAAATATGG 0: 1
1: 0
2: 0
3: 14
4: 227
990832888_990832892 11 Left 990832888 5:59980360-59980382 CCTAGCACTTTTCACGGTAAAAT 0: 1
1: 0
2: 0
3: 5
4: 131
Right 990832892 5:59980394-59980416 TGGGTTTGCCTTAAAAAATATGG 0: 1
1: 0
2: 0
3: 14
4: 227

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990832892 Original CRISPR TGGGTTTGCCTTAAAAAATA TGG Intronic
902645108 1:17792405-17792427 TGGTTTTGCCTTCAAATATCTGG + Intronic
903440278 1:23382916-23382938 GGTTTTTACCTTAAAAAATATGG + Intronic
903696805 1:25213751-25213773 TGGGAGAGCCTTAAAAAAAAAGG - Intergenic
903850676 1:26304061-26304083 TGGATTTGTCCTAAAAAATTTGG - Intronic
905742082 1:40380221-40380243 TGGTTTTGGCTTAAAGACTAGGG - Intronic
906429300 1:45742027-45742049 TGCTTTTGCCATAAAAAAGAAGG + Intronic
907673433 1:56496963-56496985 TTCGTTTGCCTTGAGAAATAAGG - Intronic
908750643 1:67419450-67419472 TGGGTTTTACTTAAGAAACATGG - Intronic
909201676 1:72697206-72697228 TAGAGTTGCCTAAAAAAATATGG + Intergenic
909739480 1:79010061-79010083 TGTGTTTTCCTTTACAAATACGG - Intergenic
910430184 1:87152260-87152282 TGGATTTGCCTTACAAATAAGGG - Intronic
911989019 1:104667625-104667647 TGGTTTTGTCCTAAATAATATGG + Intergenic
912241539 1:107915326-107915348 TGGGTTTGCATTAAAAGCTGGGG - Intronic
913311606 1:117501989-117502011 TTGCTTTGAATTAAAAAATAAGG + Intronic
914505243 1:148282910-148282932 TGTGTTTACCTGAAAAAAAAAGG - Intergenic
916772824 1:167929452-167929474 TGAGTTTCACTTTAAAAATAAGG - Intronic
921005814 1:211092787-211092809 TGTTTTTGCCTTAACAGATAGGG - Intronic
921777896 1:219124206-219124228 TGGGTTTCCTTTAAATAAGAAGG + Intergenic
922088925 1:222377239-222377261 TGCTATTGCCTTAAAAAATTTGG + Intergenic
923552321 1:234973711-234973733 TGGGCATGCCATTAAAAATATGG + Intergenic
924422548 1:243923262-243923284 TGATTTGGCCTTAAAAAAGAAGG - Intergenic
1063196283 10:3746919-3746941 TGAGTTTGACTTAAAATAAATGG + Intergenic
1063554843 10:7068638-7068660 TTATTTTGCCTTAAAAAAGAAGG - Intergenic
1064487869 10:15815047-15815069 TTAGTTTTCCTTAAAGAATAAGG + Intronic
1065218174 10:23470867-23470889 TGGGTTGGCCTGAAAAAATGTGG + Intergenic
1065722463 10:28640146-28640168 TTACTTTGCCTTAAAAAAGAAGG - Intergenic
1066052969 10:31652548-31652570 TAGGTCTTCATTAAAAAATATGG - Intergenic
1068816672 10:61323122-61323144 TGGGTCTGTCTTAGAAAAAATGG + Intergenic
1068829358 10:61474888-61474910 TGGGTTTGCCCTAACATACATGG + Intergenic
1070845265 10:79517394-79517416 TGGGTTTTATTTAAAAAATCAGG - Intergenic
1070928531 10:80242915-80242937 TGGGTTTTATTTAAAAAATCAGG + Intergenic
1073759307 10:106612732-106612754 GGGGTTTGGTTTAGAAAATAAGG - Intronic
1074025883 10:109634148-109634170 TGGGTTTGATGTAAAAAAAAAGG + Intergenic
1076526584 10:131116077-131116099 TTGGATTTCCTTACAAAATAAGG - Intronic
1078325842 11:10380227-10380249 TGGCTTTCCATTAAAAAAGAGGG - Intronic
1078631165 11:13005964-13005986 TGAGTGTTCCTTAAAACATACGG + Intergenic
1080113113 11:28591976-28591998 TGTTTGTGCATTAAAAAATATGG + Intergenic
1081286118 11:41272149-41272171 GGGGTTTGACTAAAAAAGTAGGG - Intronic
1082645811 11:55723346-55723368 TGTGTTTGCCTTTTTAAATATGG - Intergenic
1085079850 11:73625110-73625132 TGGGTTTTCAATAAAAACTAGGG - Intergenic
1086266275 11:85002292-85002314 TGGGATTGCCTTAAAAAGAAAGG + Intronic
1087728646 11:101753214-101753236 TGGTTTTTCCATTAAAAATATGG - Intronic
1087751820 11:102014554-102014576 TGGGTTTCAGTTTAAAAATAGGG - Intergenic
1088028547 11:105217410-105217432 TGCATTTAACTTAAAAAATATGG - Intergenic
1088994261 11:114982718-114982740 TGGGTATGCCATGAGAAATAAGG + Intergenic
1090220535 11:125019026-125019048 TAGGTGAGCCTTAAGAAATAAGG + Intronic
1092692242 12:11126958-11126980 TAGGCCTGCCTTAAAAAATGCGG - Intronic
1093906502 12:24699042-24699064 AGCATATGCCTTAAAAAATAGGG + Intergenic
1097137168 12:56867680-56867702 TGGGTTTTCTTTGAAAATTAGGG - Intergenic
1098653126 12:73000049-73000071 AGGCTTTTCCTTAAAAAAAATGG + Intergenic
1101267656 12:103106464-103106486 TGGGTTTGTTTAAAAAAATATGG + Intergenic
1101926716 12:108977727-108977749 TGTGTGTGTTTTAAAAAATATGG + Intronic
1104886989 12:132116629-132116651 TGTGTTTTCCTTGAAAACTACGG - Intronic
1107833371 13:44394034-44394056 TGAGTTTGCTTTAAAAACTGAGG - Intronic
1108701990 13:52951647-52951669 TAGGTGTGTCATAAAAAATATGG + Intergenic
1108941147 13:55954552-55954574 TGAGTTTATGTTAAAAAATAAGG - Intergenic
1109098841 13:58152530-58152552 TGAGTTGGCCTTAAAAACTCGGG + Intergenic
1109849928 13:68049274-68049296 GGGGTTAGCATTAAAAAATGTGG + Intergenic
1110191633 13:72736213-72736235 TGGGTTTCTCTTTAAAATTAAGG - Intronic
1110333817 13:74302996-74303018 TGGCTTGGCCTTTACAAATAGGG - Intergenic
1112535656 13:100252595-100252617 TGGGTTTTGCTTGAAAAGTAAGG + Intronic
1112898873 13:104335579-104335601 TGGGATTGCCTCTAAAAGTAAGG - Intergenic
1113700564 13:112383377-112383399 TTGTTTTTCTTTAAAAAATAGGG - Intronic
1116695584 14:48172317-48172339 TTTCTTTGACTTAAAAAATATGG - Intergenic
1117309946 14:54511150-54511172 TGTGATTGCCTTAAAGAACACGG + Intronic
1117548899 14:56814434-56814456 TGCGGTTGCCTCAAAAAAGAGGG + Intergenic
1119379700 14:74220627-74220649 TGATTATGCCTTTAAAAATAAGG + Intergenic
1120523494 14:85551333-85551355 TGGGGTTGCCTGGAAAAATTAGG + Intronic
1125444772 15:39742597-39742619 TGGTTTTGCCTCAGAAAATATGG + Intronic
1129552636 15:76469934-76469956 TGATTTTGTCTAAAAAAATAAGG - Intronic
1131850087 15:96531807-96531829 TCACTTTGCATTAAAAAATATGG - Intergenic
1135131441 16:19857035-19857057 TGGGTTTGCAGTAAAAGTTAAGG - Exonic
1138310962 16:56023629-56023651 AGCGTTTGACCTAAAAAATAAGG + Intergenic
1138883152 16:61041332-61041354 GGGATTTGCATTAACAAATAAGG - Intergenic
1139071012 16:63382659-63382681 TGTGATGGTCTTAAAAAATAGGG - Intergenic
1140322073 16:73962506-73962528 TTGCTTTGTTTTAAAAAATAAGG - Intergenic
1140641361 16:76977281-76977303 TTATTTTGCCTTAAAAAAGAAGG - Intergenic
1142811487 17:2397537-2397559 TGGGATTGCTTTAAAATATGGGG - Intronic
1148484323 17:47981012-47981034 TGGGTTTTCCTTAAAAGGAAAGG + Intronic
1149157747 17:53653291-53653313 TTGGTTTTCATTATAAAATAAGG - Intergenic
1149289931 17:55208179-55208201 TGGGCTTGGCTTAAAAAACAAGG + Intergenic
1149938081 17:60829859-60829881 TGAGATTGCCTTAAATAATTGGG + Intronic
1152829733 17:82489696-82489718 TGAGCTTGCCTTAAAAAGAAAGG + Exonic
1153394617 18:4604312-4604334 GGGTTTTGCCTTAGGAAATAAGG + Intergenic
1154260096 18:12823663-12823685 AGACTTTGTCTTAAAAAATAGGG + Intronic
1155764429 18:29609811-29609833 TTTGATTGCCTTAAAAACTATGG + Intergenic
1156536266 18:37867454-37867476 GGGGTTTGTCTTAACAAAAAAGG + Intergenic
1157992929 18:52519262-52519284 TGGGTTTTGCTTATAAAGTAAGG + Intronic
1164956890 19:32393995-32394017 TGGGTGTGCCCTCAAAATTAAGG + Intergenic
1167027637 19:46932741-46932763 AGAGTTTGTCTTAAAAAATAGGG + Intronic
925696945 2:6590553-6590575 TGGCTTTCCCTAAAAAAATGGGG + Intergenic
926179291 2:10626505-10626527 TGTTTTTTCCTTAAAAAAGAAGG - Intronic
927382527 2:22495603-22495625 TTGTTTTGCCTGAAAAAGTAGGG - Intergenic
928453111 2:31396625-31396647 TGGTTTTGCCATTAAAAGTATGG - Intronic
928584343 2:32743377-32743399 TGGGTTTGGGGTAAAGAATATGG - Intronic
929035277 2:37685118-37685140 TGGGTATGGCTTAACAATTATGG + Intronic
929183430 2:39068131-39068153 TGGGTTTGTATTTAAAAATGTGG + Intronic
929198401 2:39209801-39209823 TGGGAGTTCCTTTAAAAATAAGG + Intronic
931203308 2:60122395-60122417 TAGTTTTGCTTTAAAAGATAAGG + Intergenic
931762138 2:65427460-65427482 TGTGTTTGCCTTAAAAAGGGAGG - Intronic
933589591 2:84217422-84217444 TCCTTTTGCCTTAAAAAGTACGG - Intergenic
933707035 2:85299062-85299084 TGGTTTTGCCATTAAAAGTATGG + Intronic
935285101 2:101557349-101557371 TGGATTTGCCTCAAACAATGTGG - Intergenic
935795187 2:106634099-106634121 TGGGTTTTCATGAAAAAATGTGG + Intergenic
938807652 2:134821745-134821767 TGGATTTGTATTAAAAAATGAGG - Intergenic
939906306 2:147920290-147920312 TGGGTTGGCCTTAAAATTTGAGG + Exonic
940831210 2:158468367-158468389 TGGGGTTTTCCTAAAAAATAAGG - Intronic
944561701 2:200945588-200945610 TGGGCTTGCAAAAAAAAATAGGG + Intronic
945774983 2:214095136-214095158 GGGGGTTGGCTTTAAAAATATGG - Intronic
1168996099 20:2134492-2134514 AGTTTTTGCCTTAATAAATAAGG + Intronic
1169531091 20:6486082-6486104 GCTCTTTGCCTTAAAAAATAGGG - Intergenic
1169770909 20:9199264-9199286 TGGGTTTGCCTTGGGAAAGAAGG + Intronic
1169935876 20:10882703-10882725 TGGTTGGTCCTTAAAAAATAAGG - Intergenic
1173682403 20:44894002-44894024 TGGGAATGGTTTAAAAAATAAGG - Intronic
1176515053 21:7777670-7777692 GGGGTTTGCCTTAACAAACCAGG - Intergenic
1177119755 21:17124875-17124897 TGGGCTTGACTGAAATAATAGGG - Intergenic
1177624575 21:23644158-23644180 TTGGTTTGCATTAAAATAAAGGG - Intergenic
1178649081 21:34407682-34407704 GGGGTTTGCCTTAACAAACCAGG - Intronic
1179482947 21:41689698-41689720 TTAGTCTGCCTTAAAAAAGAAGG - Intergenic
1179817157 21:43913973-43913995 TGGGTTTTCCTTACAAAAGCTGG - Intronic
1181583668 22:23841636-23841658 TGGATGTGCCTTAACAAACAAGG + Intergenic
1182017081 22:27049771-27049793 TGGTTTTGCCTTAAAAGTAATGG - Intergenic
1182136487 22:27908847-27908869 CTGGTTTGACTTAAGAAATAAGG - Intronic
1182274071 22:29173637-29173659 CTGGTTTGCTTTAAAAAAAACGG + Intergenic
949424440 3:3901446-3901468 TGGAATTGACTTCAAAAATAAGG - Intronic
950962661 3:17121927-17121949 GGGGCTTTCCTTAAAAAATCTGG - Intergenic
953044911 3:39285886-39285908 AGAGTCTGCTTTAAAAAATAAGG + Intergenic
953103033 3:39848756-39848778 TGCATTTGCCTTCAAAAATAAGG - Intronic
955971565 3:64443237-64443259 TGGATTTGGTTTACAAAATAAGG + Intronic
957392653 3:79597698-79597720 TGGATTTGCTTTACAAAATGAGG + Intronic
958196925 3:90253533-90253555 TATGTGTGCATTAAAAAATACGG - Intergenic
959085967 3:101850517-101850539 TGTGTGTGCCTTAAAAAAAATGG + Intronic
959240941 3:103792761-103792783 TTGTTTTGCCTTAAAAAAAATGG + Intergenic
960654884 3:119991619-119991641 TGGGATTGCCTTAAATTATTAGG - Intronic
960706549 3:120487951-120487973 TGGTTAAGCCTTAAATAATAAGG + Intergenic
960794935 3:121475420-121475442 TAGGGTTGCCTGATAAAATATGG - Intronic
961585884 3:127923740-127923762 AGGGCTTGTCTTAAAAAAGAAGG - Exonic
962057968 3:131893094-131893116 TATGTTTGCCTTTAAAAATGAGG - Intronic
962307145 3:134299035-134299057 TGTATTTGCTTTAAAACATATGG + Intergenic
962620419 3:137172650-137172672 TTGGCTTGCATAAAAAAATATGG + Intergenic
964055277 3:152447926-152447948 GTGGTTTTCCTTAAAAACTAAGG + Intronic
964606274 3:158563616-158563638 TTTTTTTGGCTTAAAAAATAAGG - Intergenic
965102371 3:164315674-164315696 TATTATTGCCTTAAAAAATAAGG - Intergenic
965878283 3:173355013-173355035 TCGTTTTGCTTTAACAAATAGGG - Intergenic
970006449 4:11415836-11415858 TGGGTTTGTCTAAATGAATAGGG + Intronic
971330888 4:25680576-25680598 TGGCTCTGCCTCAAAATATAGGG + Intergenic
972196955 4:36665287-36665309 TCGGTTTGCATTACAACATATGG + Intergenic
972581323 4:40398040-40398062 TGGGTTTTCCTTAAAAATGATGG + Intergenic
972824886 4:42746393-42746415 TTGGAGGGCCTTAAAAAATAGGG + Intergenic
973194512 4:47424350-47424372 TGGGATGGCCTTTTAAAATAGGG + Intronic
974893583 4:67911116-67911138 TGGATCTGGCTTGAAAAATACGG - Exonic
975324955 4:73049136-73049158 TGGTTTTGTTTTATAAAATAAGG - Intergenic
975939238 4:79621701-79621723 TGTCTTTGTCTTAAAAAATTGGG - Intergenic
976214615 4:82704508-82704530 TGGGATAGTCTTAAAGAATATGG + Intronic
977139470 4:93350076-93350098 TGGGTTTTCTTTAAACAAAATGG - Intronic
977936327 4:102809941-102809963 GGAGTGTGCCTTTAAAAATAGGG - Intronic
978948959 4:114534008-114534030 TTGTTCTGCCTTAAAAAAGAAGG + Intergenic
979841599 4:125449013-125449035 TGGGTCTTCCTTAAAAATTGGGG - Exonic
980245917 4:130242927-130242949 TGTGTGGGCATTAAAAAATATGG + Intergenic
980715940 4:136630085-136630107 TGGAATTTCCTAAAAAAATATGG + Intergenic
981204662 4:142025734-142025756 GGGGTTAGTCTTATAAAATAAGG + Exonic
983898792 4:173110659-173110681 TAGGCTTGCCTTAAAACATCCGG - Intergenic
984455984 4:179969044-179969066 TTTGTTAGCCTTATAAAATAAGG + Intergenic
985053938 4:186019703-186019725 TGGTTTGGCCTAAAAAAGTAGGG - Intergenic
987070808 5:14335362-14335384 TGGGTTTCCCTTGAGAAACAAGG - Intronic
989241323 5:39205633-39205655 TGGCTTTGGTTTAGAAAATATGG + Intronic
989296516 5:39833693-39833715 TGGTTTTGCCATAACAACTATGG - Intergenic
990189647 5:53244934-53244956 TGGGCTGCCCTTAAACAATAAGG + Intergenic
990832892 5:59980394-59980416 TGGGTTTGCCTTAAAAAATATGG + Intronic
990836530 5:60027822-60027844 TGTGTTTTGCTTTAAAAATATGG - Intronic
992315481 5:75548962-75548984 TCGGTATGCATTTAAAAATAAGG - Intronic
992757817 5:79925209-79925231 TGGGCTTGCTTTAAAAGACATGG + Intergenic
992868415 5:80981317-80981339 TGGTTTTGCTTTAAAAATTGTGG + Intronic
993012646 5:82500906-82500928 TGAGTTTGGCTAAAAAAAGAAGG - Intergenic
993108628 5:83628376-83628398 TGAGTTAGCCTTAGCAAATATGG - Intergenic
993366956 5:87046014-87046036 TGGATGTCCTTTAAAAAATATGG + Intergenic
994475248 5:100260271-100260293 TGGATTTGCTTTGAGAAATATGG + Intergenic
995981102 5:118105218-118105240 TGGGTATGGCTTTTAAAATATGG - Intergenic
996168714 5:120260827-120260849 TGGGTGTGGCTGAGAAAATAGGG - Intergenic
996178909 5:120394749-120394771 TTAGTCAGCCTTAAAAAATAAGG + Intergenic
996270497 5:121598364-121598386 TGAGTTGGACTTAAATAATATGG + Intergenic
996407330 5:123118480-123118502 TGGGTTTGACTCAACAAGTAAGG + Intronic
999037734 5:148372231-148372253 TTGCTTTTCTTTAAAAAATAAGG - Intergenic
1007909036 6:45494703-45494725 TGGGCTTTCCTTTAAAAATTGGG - Intronic
1008300303 6:49829940-49829962 TGTGTTTTCCTTAACAAAGAAGG - Intergenic
1008511426 6:52279334-52279356 AGGGTCTGCCTTAAAGTATATGG - Intronic
1008684233 6:53906336-53906358 TGGCTTTTCCTTAACAAATCAGG - Intronic
1011736456 6:90315044-90315066 TGGGTTTATTTTTAAAAATAAGG + Intergenic
1012055690 6:94406535-94406557 TTAGTTGGCCTTTAAAAATAAGG - Intergenic
1012296901 6:97535187-97535209 TGAGTTTGCTTTAAAAAGTAAGG - Intergenic
1016334536 6:142990345-142990367 TGGTGGTGCCTTCAAAAATATGG - Intergenic
1020441534 7:8221993-8222015 TGAGGTTGTCTTTAAAAATAAGG - Intronic
1021172863 7:17417230-17417252 TGGGTTTGACTGAAATAATGGGG - Intergenic
1021244338 7:18243580-18243602 AGTGTTTCCCTTAAATAATATGG + Intronic
1025081227 7:55985221-55985243 TGGTTTTGCTTTTAAAAAAAAGG - Intronic
1027436943 7:78174536-78174558 TGGCTTTGCCATAAATAATTTGG + Intronic
1028086582 7:86644452-86644474 TGGGTTTGCCTGATAAGAGAAGG + Exonic
1029030451 7:97461243-97461265 GAGGTTTGCTTTAAAAAGTAAGG + Intergenic
1030030669 7:105366218-105366240 GAGGTTTGCCTTAAGAAATGAGG - Intronic
1031322960 7:120356163-120356185 TGGGGTTGGCATAAAAAATTAGG - Intronic
1031822044 7:126514349-126514371 TGGGTATGGCTTAAACAATTTGG + Intronic
1032258022 7:130312332-130312354 TGGGTTTCCCTTGAAAATGAAGG - Intronic
1032380253 7:131472278-131472300 TTGTTTTGGCTTCAAAAATAAGG - Intronic
1032853208 7:135812798-135812820 TGGGTTAGCTTTAAAAATGAAGG + Intergenic
1041785248 8:61624777-61624799 TTAGTTTCCCTAAAAAAATATGG + Intronic
1041874209 8:62669100-62669122 AGGCTTTGCCTTAAAAGATGAGG - Intronic
1042078212 8:65019223-65019245 TGGGTTTGCCATAAAGATTTGGG - Intergenic
1044520194 8:93190155-93190177 TGGGTTAGACTTAGTAAATATGG + Intergenic
1045487517 8:102643677-102643699 TGGGTCTACCTTTAAAAATGAGG - Intergenic
1046100465 8:109608377-109608399 TGTGTTTGCCATAAAATTTAGGG - Intronic
1046415003 8:113901831-113901853 TCAGTTTGCCTTGAAAAATATGG + Intergenic
1047596311 8:126381096-126381118 TGGGTTGGCCATGAACAATAAGG + Intergenic
1048220920 8:132541340-132541362 TGGGTTTGCTTTTTTAAATATGG - Intergenic
1050251587 9:3750314-3750336 TGTGTTTGCTTTAAAATATTTGG + Intergenic
1050419776 9:5451183-5451205 TGGGTTTGTCTTATAACACAAGG + Intronic
1050578963 9:7030174-7030196 TTAGTTTGTCTTAAAAATTAGGG + Intronic
1052493660 9:29198616-29198638 TATGTATGGCTTAAAAAATACGG - Intergenic
1053196002 9:36119113-36119135 TGGGTTGACCTTAAAAAACTAGG + Intronic
1058304697 9:103424307-103424329 TGTGGTTGCCTTAATATATAAGG - Intergenic
1058938693 9:109792909-109792931 TGGGCTTGCCAGATAAAATATGG - Intronic
1059070462 9:111130366-111130388 TTAATTTGCCTTAAAAGATAAGG - Intergenic
1059750124 9:117239662-117239684 TGGCTTTGCCTTCAAAGAAATGG - Intronic
1059819339 9:117954996-117955018 TGGGTGGGCCTAAATAAATAGGG + Intergenic
1059850132 9:118328922-118328944 TGAGTTGGTCTTAAAATATATGG + Intergenic
1059911084 9:119044937-119044959 TGGGTTTGTCTTCAAATACATGG + Intergenic
1186001187 X:5012794-5012816 TGGGTATGACTTCAAAAACAAGG + Intergenic
1186498736 X:10033329-10033351 TTGGTTTGCCGTAGATAATACGG + Intronic
1188020609 X:25152846-25152868 TGTGTTAGCCTGAAAGAATATGG + Intergenic
1188611440 X:32103589-32103611 ATGTTTTGCTTTAAAAAATAAGG + Intronic
1188618335 X:32187742-32187764 TGGTTTTGGTTTAAAAAATTAGG - Intronic
1189086240 X:38027757-38027779 TGGGCTTGGCTTTAAAAAAAAGG - Intronic
1189237936 X:39502863-39502885 AGGGTTTGCTTTAAGAGATATGG + Intergenic
1189650623 X:43185134-43185156 TGGTTTGGCCTTAGAAAATAAGG + Intergenic
1192355906 X:70403498-70403520 TGGATTTTGCTTAAAAATTAAGG + Intronic
1193474815 X:81950153-81950175 TGGGCTTTCCTTAAAGAATACGG + Intergenic
1195236754 X:102907044-102907066 TGAGTTTGCCCTATAAATTATGG - Intergenic
1195945543 X:110206815-110206837 TGGGTTTCCCTGTAATAATATGG + Intronic
1197950837 X:131894618-131894640 TTGAGTTGCCTAAAAAAATAGGG - Intergenic
1197966907 X:132073902-132073924 GGGGTTTTCATTAAAATATAAGG - Intergenic
1198080043 X:133231184-133231206 TTATTTGGCCTTAAAAAATAAGG - Intergenic
1201303375 Y:12529519-12529541 TGTGCTTGCCTTTAATAATATGG + Intergenic
1201926049 Y:19289099-19289121 TTGGTTTGGCTTAATGAATATGG + Intergenic