ID: 990833068

View in Genome Browser
Species Human (GRCh38)
Location 5:59982471-59982493
Sequence ATGTGCCCCTAGACAATCTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 82
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 75}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990833068_990833070 -10 Left 990833068 5:59982471-59982493 CCTTAGATTGTCTAGGGGCACAT 0: 1
1: 0
2: 0
3: 6
4: 75
Right 990833070 5:59982484-59982506 AGGGGCACATGGACCACATGTGG 0: 1
1: 0
2: 2
3: 46
4: 361
990833068_990833075 25 Left 990833068 5:59982471-59982493 CCTTAGATTGTCTAGGGGCACAT 0: 1
1: 0
2: 0
3: 6
4: 75
Right 990833075 5:59982519-59982541 GTGCCCAAGATAGGGCTGAAAGG No data
990833068_990833073 16 Left 990833068 5:59982471-59982493 CCTTAGATTGTCTAGGGGCACAT 0: 1
1: 0
2: 0
3: 6
4: 75
Right 990833073 5:59982510-59982532 TGTAAGTCAGTGCCCAAGATAGG 0: 1
1: 0
2: 1
3: 10
4: 116
990833068_990833074 17 Left 990833068 5:59982471-59982493 CCTTAGATTGTCTAGGGGCACAT 0: 1
1: 0
2: 0
3: 6
4: 75
Right 990833074 5:59982511-59982533 GTAAGTCAGTGCCCAAGATAGGG No data
990833068_990833071 -9 Left 990833068 5:59982471-59982493 CCTTAGATTGTCTAGGGGCACAT 0: 1
1: 0
2: 0
3: 6
4: 75
Right 990833071 5:59982485-59982507 GGGGCACATGGACCACATGTGGG 0: 1
1: 0
2: 0
3: 11
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990833068 Original CRISPR ATGTGCCCCTAGACAATCTA AGG (reversed) Intronic
901864525 1:12095708-12095730 TTGTGCCCCTAATCATTCTAAGG - Intronic
904265182 1:29314503-29314525 ATGTGCCCCCAGTCAAGTTAGGG + Intronic
904595581 1:31642884-31642906 ATATACCCCTGGACAAACTAAGG - Intronic
906747599 1:48232570-48232592 ATGTGGCCCTGGACAATGTTAGG + Intronic
1071755180 10:88529281-88529303 ACCTGCCCCTATACAATTTATGG - Intronic
1071882735 10:89917228-89917250 ATGTGGCCCTTGCCAATATAAGG + Intergenic
1072628656 10:97130905-97130927 ATGTTCCCTGAGAAAATCTAGGG - Intronic
1073305879 10:102503085-102503107 ACGTTCCCTTAGACAATATAAGG + Intergenic
1074911278 10:117911588-117911610 AGGCGCCCCTAGACAAACTCAGG - Intergenic
1077849639 11:6063040-6063062 GTGTTCCTCTAGTCAATCTAGGG - Intergenic
1079101863 11:17547064-17547086 ATGCTTCCCTAGACAATTTAGGG + Intergenic
1081204065 11:40254362-40254384 TTCTGCCCCTCCACAATCTATGG - Intronic
1081227446 11:40541620-40541642 ATGTGCTCCAATACAGTCTAGGG - Intronic
1089795686 11:120978795-120978817 ATGTGCCCCGGGCCAATCAAAGG + Intronic
1090258929 11:125304745-125304767 ATGTCTCCCTAGACACTCTTGGG + Intronic
1094238112 12:28191086-28191108 ATGTGGCCCAAGAAACTCTAAGG - Intronic
1096108992 12:49018152-49018174 ATGTGTCCCTGGACAATTTTAGG - Intronic
1097058666 12:56266627-56266649 ATGTCCCTCTAGAGAACCTAAGG + Intergenic
1101906195 12:108828320-108828342 ATGTGCTCCTAGGCAAGCTGGGG - Intronic
1102751788 12:115301020-115301042 ATTTGCTCCCAGACAATCCATGG - Intergenic
1109653429 13:65358269-65358291 ATGTGCCCCTAAACAACCAATGG + Intergenic
1123490668 15:20778336-20778358 ACGTGCCCCTAAACAAACAATGG - Intergenic
1123547170 15:21347427-21347449 ACGTGCCCCTAAACAAACAATGG - Intergenic
1126558145 15:50013301-50013323 ATGTCCCCCTAGAAGAGCTATGG - Intronic
1131297988 15:91168990-91169012 ATCTGCCCCTGGACTAACTAGGG - Intronic
1202955500 15_KI270727v1_random:74655-74677 ACGTGCCCCTAAACAAACAATGG - Intergenic
1150837697 17:68579358-68579380 ATGTGCTCCCAGACACCCTAAGG + Intronic
1153060725 18:992224-992246 AAGTGCCCCTAGAAAAATTAGGG - Intergenic
1156668362 18:39436400-39436422 ATGTGCCCCCAGACAATAGAAGG + Intergenic
1158036366 18:53036216-53036238 ATGTGTACCTACACAATTTATGG + Intronic
1163891753 19:20022723-20022745 GTGTGCCCCAAGACAATGAAAGG + Intronic
1165131488 19:33635171-33635193 ATGTGCCCTTGGTCAAACTAAGG + Intronic
1167817780 19:51899037-51899059 ATGGGCTCCTAGACAACCTCAGG - Intronic
1168607062 19:57768668-57768690 ATGTTCTTCTATACAATCTAAGG + Intergenic
931189056 2:59982140-59982162 GTGTGCCCCTATATACTCTATGG + Intergenic
933620477 2:84533841-84533863 CTGGACCTCTAGACAATCTATGG - Intronic
937968467 2:127532480-127532502 ATGCGCCCATGGACAACCTATGG - Intergenic
939006896 2:136799006-136799028 AGATGACCCTAGAAAATCTATGG - Intronic
941597089 2:167490981-167491003 ATGTGCCCCTGGATCCTCTAAGG - Intergenic
945374540 2:209064341-209064363 ATTTGCCCCTAAATAATATAGGG + Intergenic
948064580 2:235067619-235067641 ATGTGCCCCTGGCCAGGCTAAGG + Intergenic
1172618293 20:36304421-36304443 ATGTGTCGCTAAACAATATATGG + Intergenic
952721697 3:36540419-36540441 TGGTCCACCTAGACAATCTAGGG - Intronic
961152133 3:124647941-124647963 ATGTTCCCATAGTCAATCCAAGG - Intronic
969250341 4:5964004-5964026 ATGTGCAACTAGAAAAGCTAGGG + Intronic
971329902 4:25673796-25673818 CTGTTCCCCAAGACAATCTGGGG - Intronic
971696790 4:29915159-29915181 CTGGGCCCCTGGCCAATCTAAGG - Intergenic
975518025 4:75268197-75268219 AATTGCCCCTAGACAATTTATGG + Intergenic
975586791 4:75958089-75958111 ATGTGCCTTTAGTTAATCTAAGG + Intronic
987516187 5:18912711-18912733 ATTTGCACATAGATAATCTATGG - Intergenic
990833068 5:59982471-59982493 ATGTGCCCCTAGACAATCTAAGG - Intronic
993219505 5:85072881-85072903 ATGTGTGCCTAGAATATCTAGGG + Intergenic
997136145 5:131328603-131328625 ATGTGTCCCTAGAAAGTCAATGG - Intronic
999062064 5:148646638-148646660 ATGGGCCCCTCTAAAATCTATGG - Intronic
1004216564 6:13710415-13710437 TTGTCCCCCTAGACAATCTCTGG + Intronic
1007682041 6:43640812-43640834 ATGGGTCCATAGACACTCTATGG + Exonic
1015413611 6:132922797-132922819 TTTTGCCCCTCCACAATCTAAGG - Intergenic
1025158384 7:56630731-56630753 ATGTGCCCCTAGCCAACCCAGGG - Intergenic
1025728226 7:64087537-64087559 ATGTACCCCTAGCCAGTCTGGGG + Intronic
1026913407 7:74105964-74105986 ATGTGCCCCTGGACGAGGTACGG + Exonic
1034714069 7:153223007-153223029 AGGTGCCCATAGACAATCTTAGG + Intergenic
1037800159 8:22029098-22029120 ATGTCCTCCCAGACAATCCAAGG + Intronic
1041113380 8:54508757-54508779 ATATGCCACAAGACAAACTATGG + Intergenic
1041517160 8:58713255-58713277 TTGTGCCACTACACAACCTATGG + Intergenic
1043343770 8:79274343-79274365 ATGTGCTCCAAGACTACCTAGGG - Intergenic
1045621006 8:103978328-103978350 GTGTGTAACTAGACAATCTAGGG + Intronic
1046332942 8:112745782-112745804 AAATGCCCCTAGATAATGTAGGG + Intronic
1051966394 9:22834144-22834166 CTGAACCCCTAGACATTCTACGG - Intergenic
1055809598 9:80136948-80136970 ATATGCGCCTAGAGAATCCAGGG + Intergenic
1056037603 9:82623961-82623983 ATATGCTTCTAAACAATCTATGG + Intergenic
1187633138 X:21197086-21197108 ATGTGCATCAAGACAATGTAAGG + Intergenic
1195251108 X:103048466-103048488 ATGTGCTCCTGAACAATCAATGG - Intergenic
1200860247 Y:7983695-7983717 GTGTGCCCCTAGCCAACCCAGGG - Intergenic
1202249341 Y:22853553-22853575 AAGTGCCCCTAGCCAATCCGGGG - Intergenic
1202266759 Y:23027981-23028003 ATGTTCCCCTAGCCAATCAGTGG + Intergenic
1202269755 Y:23060436-23060458 CTGTGCCCCTAGTCAATTCATGG + Intergenic
1202402327 Y:24487301-24487323 AAGTGCCCCTAGCCAATCCGGGG - Intergenic
1202419752 Y:24661726-24661748 ATGTTCCCCTAGCCAATCAGTGG + Intergenic
1202422749 Y:24694182-24694204 CTGTGCCCCTAGTCAATTCATGG + Intergenic
1202448040 Y:24975904-24975926 CTGTGCCCCTAGTCAATTCATGG - Intergenic
1202451034 Y:25008358-25008380 ATGTTCCCCTAGCCAATCAGTGG - Intergenic
1202468453 Y:25182783-25182805 AAGTGCCCCTAGCCAATCCGGGG + Intergenic