ID: 990846793

View in Genome Browser
Species Human (GRCh38)
Location 5:60149736-60149758
Sequence TGCTATGAGAATGCATAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 319
Summary {0: 1, 1: 0, 2: 6, 3: 38, 4: 274}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990846793 Original CRISPR TGCTATGAGAATGCATAGGA AGG (reversed) Intronic
902829992 1:19006195-19006217 TGCTATGGAAATGCAGAGGAAGG - Intergenic
903764493 1:25725397-25725419 TGCTACGGGAATACAGAGGAAGG + Intronic
904756835 1:32772543-32772565 TGGTCTGAGAATGCCTGGGAAGG + Intronic
904989087 1:34576807-34576829 TGCAATGAGAAAGCATCGGTGGG - Intergenic
905112447 1:35605735-35605757 TGGGAAGAGAATTCATAGGATGG + Intronic
905540617 1:38757527-38757549 TGCTATGGGAAAGCAGAGGAGGG - Intergenic
905544467 1:38786675-38786697 TGCTAGGAGAGTGCATAGCTGGG - Intergenic
905924712 1:41741342-41741364 TGCTAGGAGAATGCAAAGGTGGG - Intronic
906923556 1:50090301-50090323 TAGTGTGAGAATGCAGAGGAAGG - Intronic
907639075 1:56167443-56167465 TGCTATGAAAGTGCAGAGGTAGG + Intergenic
908591083 1:65634571-65634593 TTCTATCTGAATGCATTGGAAGG + Intronic
908778960 1:67670783-67670805 TGCTATGAGAGTTTATAGCAGGG - Intergenic
909074704 1:71039308-71039330 GGCTGAGAGAATGCAGAGGAGGG + Intronic
909938822 1:81587290-81587312 TGCTATGAGAAGACAAAGAAGGG + Intronic
910064216 1:83134084-83134106 TGAAATCAGAATGGATAGGAAGG + Intergenic
910292796 1:85615720-85615742 TGCTATGGAAATGCATATGGTGG - Intergenic
910813973 1:91269634-91269656 TGCAATGGGAATGCAGAGGAAGG + Intronic
912466461 1:109878029-109878051 TGCCATGAGAATGTATAATAGGG - Intergenic
913328951 1:117651470-117651492 AGCTATGAGATCCCATAGGAAGG + Intergenic
913334646 1:117698101-117698123 TGCTAAGTGAGTGCAGAGGAAGG + Intergenic
913426846 1:118740999-118741021 TTCTATGAGAATGCATAAAATGG + Intergenic
913484314 1:119319899-119319921 TGCTATGAAAATACAGAGGAAGG - Intergenic
913567855 1:120091034-120091056 TGCTATGGGAATGCAACAGAAGG - Intergenic
914288604 1:146251743-146251765 TGCTATGGGAATGCAACAGAAGG - Intergenic
914549639 1:148702487-148702509 TGCTATGGGAATGCAACAGAAGG - Intergenic
914617043 1:149369229-149369251 TGCTATGGGAATGCAACAGAAGG + Intergenic
914936883 1:151989412-151989434 TGCAATAAGGATGCAGAGGAGGG + Intronic
916795532 1:168163622-168163644 TGCTATGAGAATACAGAGAAAGG - Intergenic
917069561 1:171135298-171135320 AGCTATGAGAATGCAGGGGGAGG + Intergenic
917230152 1:172827742-172827764 TGCTGTGAGAATGAGAAGGATGG - Intergenic
919909844 1:202104185-202104207 TCCTATGGGAGTGTATAGGAGGG + Intergenic
921324126 1:213973726-213973748 TGAAATGAGAATGCATGGAAAGG - Intergenic
922126530 1:222731138-222731160 TGCCATGAGAATGCAGACAAGGG - Intronic
922228867 1:223668348-223668370 TGCTATGAGAGCGTATAAGAGGG - Intergenic
922547650 1:226470764-226470786 GGCAATGACAATGAATAGGATGG + Intergenic
924719591 1:246609607-246609629 TGCCATGAAAATGGAAAGGAGGG - Intronic
1063478532 10:6349958-6349980 TGCTCTGAGACAGCATATGATGG + Intergenic
1064504565 10:16014747-16014769 TGTTGTGAGTATGCAAAGGAGGG + Intergenic
1065386385 10:25137772-25137794 TGCTAGGAGAATTCAGAGGAGGG - Intergenic
1067246897 10:44554953-44554975 TGCTTTGAGAATGCATAGTTCGG + Intergenic
1068165788 10:53330866-53330888 TGCTGTGAGAATTCACAGAAAGG + Intergenic
1069395703 10:67985145-67985167 TGCTATGAGAACACTTGGGAGGG - Intronic
1069938653 10:71937883-71937905 TGCAATGAGGAGGCATAGGTGGG - Intergenic
1072063968 10:91847158-91847180 TGCAATGGGAATGCATAGACTGG + Intronic
1072705798 10:97679912-97679934 TGCTCTGAGGATGCAAAGCATGG + Exonic
1075440412 10:122475695-122475717 TGCAAAGAAAATGCACAGGAAGG - Intronic
1076566884 10:131405012-131405034 TTCTGTGAGGATGCAGAGGACGG + Intergenic
1077862364 11:6194455-6194477 TGCTATGTGAATTCAGAGGGAGG + Intergenic
1078756849 11:14219210-14219232 TGCAATGAGAAGAAATAGGAAGG - Intronic
1079414377 11:20219704-20219726 TGCTATGACATGACATAGGATGG - Intergenic
1079614512 11:22474803-22474825 TTCTCTGAGAACACATAGGAAGG + Intergenic
1079677392 11:23247253-23247275 TGCCATGAGAATGGATACAAGGG + Intergenic
1080825289 11:35843486-35843508 AGCTATAAAAATGAATAGGACGG + Intergenic
1081563809 11:44243732-44243754 AGCTAAGAGAAGGCAAAGGATGG - Intronic
1082779349 11:57274407-57274429 TGCTATGAGAATAAATAACAAGG - Intergenic
1083798824 11:65034715-65034737 TGCTGGGAGAATGGGTAGGAGGG + Intronic
1086416106 11:86590403-86590425 TGCTATGGGACTGCAGAGAAAGG + Intronic
1087413378 11:97821414-97821436 TACTAGGAAAATGCATAGAAGGG + Intergenic
1088069146 11:105759808-105759830 TGCTATGGGAATGCACAGAAGGG - Intronic
1089317074 11:117599388-117599410 TGCTATGAGAATGAGTAATAAGG - Intronic
1089534582 11:119152869-119152891 TGCTGTGAGAACGCAAAGAATGG - Intronic
1089721577 11:120428714-120428736 TTCTATGAGGATTCAAAGGAGGG + Intronic
1090023428 11:123147597-123147619 TGCTATGGGAATCCAGAGTAGGG - Intronic
1090270809 11:125384827-125384849 TGCTATGAGCATGCATGCCAAGG + Intronic
1090469720 11:126969402-126969424 TGCTATGGGAACTCAGAGGAGGG + Intronic
1091202825 11:133795352-133795374 TGTTATGAGAACTCATAAGATGG + Intergenic
1091641836 12:2243085-2243107 TGCTATGTGGGTGCATAAGAAGG + Intronic
1091819404 12:3463918-3463940 TGCTATGAGAATCCTCAAGACGG - Intronic
1091911193 12:4231947-4231969 GGCTATGGAAATGCAGAGGATGG - Intergenic
1092953909 12:13531942-13531964 TGGCATGAGAATCCCTAGGAAGG - Intergenic
1093092689 12:14938896-14938918 TGCTATGACAATACATATTAAGG + Exonic
1093679900 12:21990213-21990235 TGCTGAGAGAATACATAGGACGG + Intergenic
1096314823 12:50555310-50555332 CACTATGAAAATACATAGGAAGG - Intronic
1096739807 12:53684766-53684788 TGCTATGGAAATACATAGGACGG + Intergenic
1096753633 12:53780690-53780712 TGCTATGAGAGGATATAGGAAGG + Intergenic
1097736312 12:63185261-63185283 TTCTATGATAATGGAGAGGAAGG - Intergenic
1097806588 12:63971198-63971220 TACTATGAGAACACATAGGCAGG - Intronic
1098086357 12:66848512-66848534 TACTCTGAAAATACATAGGAGGG + Intergenic
1098669063 12:73201612-73201634 TGCAGTGAGAATGGAAAGGAAGG - Intergenic
1098900136 12:76103697-76103719 TTTTTTGAGAATGCATAAGAAGG - Intergenic
1100459804 12:94788106-94788128 TGCTAGGACAGTGCAGAGGAGGG + Intergenic
1100851313 12:98714918-98714940 TGCAATGAGAATACTTAAGAGGG - Intronic
1100978428 12:100145496-100145518 TGCTATAAGAACACAGAGGAAGG + Intergenic
1101655847 12:106719556-106719578 TGCTATGTGAGTGCAGAGGAGGG + Intronic
1101727210 12:107398023-107398045 TGCTATGAGAACACACAGCAGGG + Intronic
1101997506 12:109535485-109535507 GCCAATGTGAATGCATAGGACGG - Exonic
1102534729 12:113572783-113572805 TGCTATAAAAATGCATCTGAAGG - Intergenic
1102593061 12:113971932-113971954 TGCTAAGAGGAAGCATAGGGAGG - Intergenic
1102874572 12:116439726-116439748 TGCTATGAGAATTCATGAAATGG - Intergenic
1103315244 12:120049132-120049154 TGCTCTGAGAACGCAAAGGAGGG + Intronic
1106592449 13:31109518-31109540 TGCCATGGGCATGCACAGGAGGG - Intergenic
1106933528 13:34693173-34693195 TGCAATTTGAATGCAAAGGAAGG - Intergenic
1107089814 13:36466191-36466213 TGCTATGAGAATGCAGAGCAAGG - Intergenic
1107896480 13:44969743-44969765 TGCTAAGATAATGGTTAGGACGG - Intronic
1108263281 13:48679273-48679295 TGCTATGAGAATGCAGGGGAGGG - Intronic
1112463866 13:99626138-99626160 TGCTGTGAGAATACAGAGGCAGG + Intronic
1114371516 14:22094294-22094316 TGCTATGATAATCCCTAGGCTGG - Intergenic
1114391085 14:22309281-22309303 TGGAATGAGAAGCCATAGGAAGG + Intergenic
1118210304 14:63760229-63760251 TGCTATGAGGAAGCATAGGAGGG - Intergenic
1118280070 14:64420288-64420310 TGCTATGAGAGTCCAGAAGAGGG + Intronic
1118438979 14:65795894-65795916 TGCCATGAGAATGAATGGGGAGG + Intergenic
1118456704 14:65951481-65951503 TGCTATGGAAATACAAAGGAAGG - Intergenic
1119162004 14:72460420-72460442 AGATATGAGAATGCATAAGCTGG - Intronic
1119416348 14:74472637-74472659 TGCTATGAAAATGTATAGCAAGG + Intergenic
1119460183 14:74795601-74795623 TGATATGAGAATGTAGAGGAGGG - Intronic
1119590614 14:75884179-75884201 TGGTTTTAGAATGCATATGATGG - Intronic
1120236177 14:81893821-81893843 TGCTATAAACATGCAAAGGATGG - Intergenic
1121755797 14:96401063-96401085 GGCTATGAGAATGGAAAGGAGGG - Intronic
1126242171 15:46457742-46457764 TGTTATCAGATTGCATAAGATGG - Intergenic
1126834455 15:52645503-52645525 TGCTATGGGAATATTTAGGAGGG + Intronic
1128928281 15:71679202-71679224 TGCTATGGGAGTGCAAAGGATGG + Intronic
1130429485 15:83832099-83832121 TGGTATGGGAATGGACAGGAAGG + Intronic
1131248377 15:90815259-90815281 TGTTATGAGAATGCATATGAAGG - Exonic
1134478825 16:14599669-14599691 TGCTTGAAAAATGCATAGGAGGG - Intronic
1135161472 16:20100491-20100513 TGCAATGGGAAGGCATCGGAAGG + Intergenic
1135382521 16:22007166-22007188 TGCAATGAGAAGGCAATGGAGGG - Intergenic
1135922440 16:26663364-26663386 TGCTTTGAGAATGTATTGGGTGG + Intergenic
1136098930 16:27979042-27979064 GGCTATGAGGAGGCAGAGGATGG - Intronic
1138055068 16:53824229-53824251 TGCTACGAGGAGGCAGAGGAAGG - Intronic
1139607930 16:68033135-68033157 TGCTGGCAGAATGGATAGGAAGG + Intronic
1140182147 16:72730605-72730627 AGCTATGGGAATGAAAAGGAGGG + Intergenic
1142933329 17:3307137-3307159 TGCTATGGGAAGACAGAGGAAGG + Intergenic
1144086600 17:11814816-11814838 TCCTATGAGAATGCAGAGCCCGG + Intronic
1147316360 17:39622416-39622438 TTAAATGAGAGTGCATAGGAAGG + Intergenic
1150951849 17:69811693-69811715 TATTATGAGAGTACATAGGAAGG + Intergenic
1151381793 17:73730786-73730808 TTCTATGGGAATGCACAGGATGG - Intergenic
1153709813 18:7786624-7786646 TGTCATGAGAAGGCATATGATGG - Intronic
1153809402 18:8738722-8738744 TGCTTTGAGAGTGGATAGGGAGG + Intronic
1154031483 18:10757249-10757271 TGCTATGGGGATGAATATGAGGG + Intronic
1154031565 18:10757637-10757659 AGCTATGGGGATGCAGAGGAGGG + Intronic
1155157833 18:23172305-23172327 CACTGTGAGAATGCAAAGGATGG - Intronic
1156090426 18:33461338-33461360 TGCTATGAGAAGCAATTGGAAGG + Intergenic
1156702197 18:39839432-39839454 TGCTATGAGAGTGTATAGGGTGG + Intergenic
1158147324 18:54330030-54330052 TTCTATGTGAATGCAGAGGGGGG + Intronic
1159353896 18:67310984-67311006 TGCTTTGAGATGGCATGGGAAGG + Intergenic
1161885118 19:6988601-6988623 TGCTATGTAAATGCAGATGATGG + Intergenic
1164493545 19:28736501-28736523 TGAAAAGAGAATGCAAAGGAAGG - Intergenic
1168232842 19:55044376-55044398 TACCATGAGAATTGATAGGAAGG + Exonic
926001091 2:9333408-9333430 TGCTCTGAGAAAGTATAAGAAGG + Intronic
927038823 2:19207349-19207371 TTCAATGAGAATGCATATGTAGG - Intergenic
929177982 2:39001382-39001404 TGATAGGAGAATGGATAGGTGGG - Intronic
930341148 2:50116542-50116564 TACTTTGAGAATGCCTTGGAAGG - Intronic
934960942 2:98672220-98672242 TGCTTTGAGAATGTGTAAGAGGG - Intronic
936653204 2:114454069-114454091 TGCTCTGAGACAGCATAGAAGGG + Intronic
937750063 2:125466137-125466159 TGCAATGTGTATGAATAGGAAGG + Intergenic
940189373 2:151023540-151023562 TGCTATGAGGATGCAGAGAAAGG + Intronic
941953986 2:171185689-171185711 TGCTATGGGAGTACAAAGGAAGG - Intronic
943199593 2:184803376-184803398 TGCTATGTGAATATAAAGGAAGG - Intronic
944148403 2:196531050-196531072 TGCTATTAGAATACATATCAAGG - Intronic
944878775 2:203989918-203989940 CCCTGTGAGAATGGATAGGAAGG + Intergenic
944911745 2:204317406-204317428 TGCTATGGGAACACAGAGGAGGG + Intergenic
944953400 2:204778810-204778832 TCATAGGAGAATGCATGGGAAGG - Intronic
947725897 2:232400319-232400341 TGCTATGAGCATTCATGGGTAGG - Intergenic
948158611 2:235805361-235805383 TGCTCTGAGAATGGATTGGCTGG + Intronic
1169953320 20:11072844-11072866 TGCTAGGAGGAAGCATGGGAAGG - Intergenic
1172437990 20:34943665-34943687 TTCTATGAGAACACATAGTAGGG - Intronic
1172505826 20:35461729-35461751 TGTAATGAGAAGGCATTGGAAGG + Intronic
1173305512 20:41844313-41844335 TGCTATGAGAATACAAGGAAAGG - Intergenic
1173376961 20:42494322-42494344 TGTTATAAGAATGCATGGGGAGG + Intronic
1173692619 20:44975389-44975411 TGCTATCAGGATGCATAGGGAGG + Intronic
1174313915 20:49682119-49682141 TGAGATGAGAATTCATTGGAGGG - Intronic
1175572393 20:60033952-60033974 TTCTATGAGAATTTATAGAAGGG - Intronic
1176054620 20:63137628-63137650 TGCTATGAACATTCATGGGAAGG + Intergenic
1176334615 21:5584326-5584348 TTCTTTGAGAATGCAAAGAATGG - Intergenic
1176393142 21:6236622-6236644 TTCTTTGAGAATGCAAAGAATGG + Intergenic
1176468277 21:7079552-7079574 TTCTTTGAGAATGCAAAGAATGG - Intronic
1176491838 21:7461330-7461352 TTCTTTGAGAATGCAAAGAATGG - Intergenic
1176508804 21:7677053-7677075 TTCTTTGAGAATGCAAAGAATGG + Intergenic
1177464265 21:21454929-21454951 GGCTATGAGAATGCAAATAATGG - Intronic
1177885965 21:26746456-26746478 TCCTATGAGAAAGAATACGAGGG + Intergenic
1178698584 21:34815338-34815360 TGCTAGGAGAATGCTGGGGAGGG + Intronic
1183971745 22:41482583-41482605 TGCTATAACGATGCTTAGGATGG + Intronic
949944059 3:9176310-9176332 TGGCATGAAAATGCATATGAAGG + Intronic
950314794 3:11991801-11991823 TGCTCTGGGAATGCAGAGAAGGG + Intergenic
950382025 3:12624152-12624174 TGCCATGAAAATGGTTAGGAAGG - Intronic
950813490 3:15673212-15673234 TGCTATGAGAGTACTTAAGAGGG - Intronic
951811264 3:26702794-26702816 GGCCATGAGAATGCAAAGCAAGG + Intronic
952753728 3:36847484-36847506 TGATCTTAGAATGGATAGGAGGG + Intronic
953124071 3:40074366-40074388 TGACATAAGAATGCATAGGTAGG - Intronic
953437852 3:42893836-42893858 TCCTATGTTAATGAATAGGAAGG + Intronic
954460672 3:50625205-50625227 TGCTATGAGACAACATAGGCCGG + Intronic
956128776 3:66036095-66036117 TACTGTGTGAAGGCATAGGATGG - Intronic
956381849 3:68672646-68672668 TGCTTATAGAATGCAGAGGATGG - Intergenic
956992474 3:74783254-74783276 TGCTATGGGAATGCAAAGAAAGG + Intergenic
958510399 3:95039600-95039622 AGCTCTGAGAATTCATAGCAAGG + Intergenic
958980464 3:100713007-100713029 TGGGATGAGAATGCATTGGAAGG + Intronic
962464383 3:135643097-135643119 TGCTGTGGGAATGCAGAGGTAGG + Intergenic
965178764 3:165372639-165372661 TGCAATGAGAAGCCATTGGAGGG - Intergenic
965879781 3:173374690-173374712 TGTTATTAGTATGCATTGGAAGG + Intergenic
966096935 3:176214672-176214694 TGCAATGAGAATCAAAAGGAGGG + Intergenic
967666310 3:192176300-192176322 TGCTATGAGAAGCAAAAGGAAGG - Intronic
968017238 3:195348595-195348617 TGACATAAGAATACATAGGAAGG + Intronic
969147697 4:5138730-5138752 TGCCATGAGAATGTATCGTAGGG + Intronic
972026530 4:34385532-34385554 TGCTATTAAAATGCATAGTGGGG - Intergenic
972095223 4:35340400-35340422 TGGCATGAGAATGGATATGAAGG + Intergenic
973934399 4:55828409-55828431 TGCTATGGGAATCAAGAGGATGG - Intergenic
975858541 4:78650989-78651011 TGCTATGAAAAGGCATAGATAGG + Intergenic
977079993 4:92513558-92513580 TGCTATGATATTGTATAAGAGGG - Intronic
977314705 4:95431199-95431221 TGCTAGGAAACTGCACAGGAAGG - Intronic
977495018 4:97764271-97764293 TGCTGTGAGAGTGTATAAGATGG - Intronic
978673559 4:111281205-111281227 TACTACGAGAGTGCAGAGGAGGG - Intergenic
979300908 4:119086150-119086172 TGTTATGGAAATGCAGAGGAGGG - Intergenic
983126946 4:163964994-163965016 TGCTATGACATTGCATGGCAAGG + Intronic
984079249 4:175223408-175223430 AGATATGATAATGGATAGGAAGG + Intergenic
984268184 4:177519166-177519188 TGCAGTGTGAATGCAGAGGAGGG + Intergenic
984498793 4:180532541-180532563 TGCTATGGGAATGGAAAGCAGGG - Intergenic
986469823 5:8062520-8062542 TGCCTTGAGAATGCTGAGGAAGG + Intergenic
987181332 5:15371740-15371762 TGCTATGGGAATTTAAAGGAGGG - Intergenic
987783602 5:22469849-22469871 TGCTATGAGATTGCACAGTAAGG - Intronic
987824061 5:23005515-23005537 TGCTACGAGAATGTACAGGGGGG - Intergenic
989196717 5:38723550-38723572 AGCTATGAAATTGCAAAGGAGGG - Intergenic
989748832 5:44866301-44866323 TGCTATGGGAGAGCAGAGGAAGG - Intergenic
990846793 5:60149736-60149758 TGCTATGAGAATGCATAGGAAGG - Intronic
991240719 5:64457064-64457086 TGCAATGAGAATGCCTAATATGG - Intergenic
991583188 5:68177713-68177735 AGCTGTGAGAATGCAGAGAAGGG + Intergenic
992634946 5:78718337-78718359 TGAATTGAGACTGCATAGGAAGG - Intronic
993027498 5:82663586-82663608 GACTATGAGAAGGCAGAGGAGGG + Intergenic
993680302 5:90869596-90869618 GGCAATGAGAATTCAAAGGAAGG + Intronic
993823164 5:92646217-92646239 TGCTATGACAATGGAGAGAAAGG + Intergenic
993961983 5:94309322-94309344 TGCTGTGAGAGTTCAGAGGAGGG + Intronic
994041676 5:95265969-95265991 TCATATAAGAATGCATAAGAAGG + Intronic
994810538 5:104512777-104512799 TGCTATGAGAGAGCATAAGAAGG - Intergenic
995092017 5:108189271-108189293 TGCTGGAAGAATTCATAGGATGG + Intronic
995822882 5:116257468-116257490 TGAAAGGAAAATGCATAGGAGGG + Intronic
1000406313 5:160892152-160892174 TGCGATGAAAAGCCATAGGAAGG - Intergenic
1000530380 5:162411858-162411880 TCCTATTAGAGTTCATAGGAAGG - Intergenic
1001593030 5:172879398-172879420 TTCCATGAGAATGTACAGGAAGG - Intronic
1001741326 5:174055279-174055301 TTCTATGGCAATGCATAGCATGG - Intronic
1001773145 5:174310864-174310886 TGCTATGAGCAGGAATAGGGTGG + Intergenic
1003078578 6:3003053-3003075 GGCTATCACAATGCATAGGGAGG - Intronic
1004886995 6:20060711-20060733 TGCCATGAGAACACTTAGGAGGG + Intergenic
1005369429 6:25115394-25115416 CGCTATGGGAATGCACAGGGAGG + Intergenic
1006421876 6:33939708-33939730 TGCTATGGCATTGCGTAGGAGGG + Intergenic
1006885917 6:37382226-37382248 TGCTATGAAACTTCAAAGGAAGG + Intronic
1010168100 6:72941219-72941241 TTCTATCTGCATGCATAGGATGG + Intronic
1010189446 6:73179800-73179822 TGATATGGGAATGCAGAAGAGGG - Intronic
1010761130 6:79724559-79724581 AGCCATGGGTATGCATAGGATGG - Intergenic
1010786991 6:80015078-80015100 TGCTATGAGAATTCAGAAGAGGG + Intronic
1011125933 6:84007843-84007865 TGGCATGGGAAGGCATAGGAGGG + Intergenic
1013536803 6:111070048-111070070 TGCTATTAGTTTTCATAGGATGG - Intergenic
1013996927 6:116319980-116320002 TGCTATGAGAACACATAAAAGGG - Intronic
1015300537 6:131648779-131648801 TTCAATGGGAATGCATAGCAAGG + Intronic
1015626854 6:135188380-135188402 AGCCATGAGAATGAAAAGGACGG - Intronic
1016097785 6:140059480-140059502 TGCCATGAGAATACATATTATGG - Intergenic
1016607246 6:145944403-145944425 TGCTATGGGAATACCTAAGAGGG + Intronic
1017296374 6:152800057-152800079 TGCTAGGGGGGTGCATAGGAAGG + Intergenic
1017315606 6:153027822-153027844 TACTATGTGAATGCAAAGAAGGG + Intronic
1020438124 7:8188329-8188351 TGCTACAAGAATGGAGAGGAGGG - Intronic
1020462487 7:8441251-8441273 GGCTAAGAGAATGCAGAGGGAGG - Intronic
1021177757 7:17469636-17469658 TACTATGAGAATCCATAGATGGG - Intergenic
1022019718 7:26386606-26386628 TGCTATGAGAATACAAAGCAGGG - Intergenic
1022033537 7:26513718-26513740 TGCTATGAAAGTCCAGAGGAAGG - Intergenic
1022278884 7:28885168-28885190 TGCTATGGGAATACAAAAGAAGG + Intergenic
1023420751 7:39977041-39977063 TGCTATGGGAGTTCATAGAATGG + Intronic
1024062216 7:45707608-45707630 TGCATTTAGAATGCATAGAATGG + Intronic
1024500840 7:50103749-50103771 TGCTGTGGGGGTGCATAGGAAGG - Intronic
1024706716 7:51969529-51969551 TGCTGGGAGAATACTTAGGAAGG + Intergenic
1027939955 7:84665180-84665202 TGCTATGAGAAGACAAAAGAAGG + Intergenic
1028837669 7:95393347-95393369 TGCTGTGAGAGTTCAGAGGAAGG + Intronic
1029625623 7:101718650-101718672 TGGTATGGGGATTCATAGGAGGG + Intergenic
1029856768 7:103525247-103525269 TGCTATGAGAGAGAATAGCATGG - Intronic
1030190333 7:106804247-106804269 TGCATTGAGAATGGATAGCAGGG + Intergenic
1031027510 7:116696236-116696258 AGTTATCAGAATGCAGAGGAAGG - Intronic
1032287566 7:130552971-130552993 TGCTATGTGAATACACAGAAAGG + Intronic
1036662825 8:10718912-10718934 CTGTATGTGAATGCATAGGAGGG - Intergenic
1036991058 8:13594487-13594509 TTCTCTCAGAATGCAGAGGAAGG - Intergenic
1037734594 8:21556116-21556138 AGCTGTGAGAATGCAGTGGAAGG + Intergenic
1039906872 8:41792705-41792727 TGCAATGAGAGTTCAGAGGAAGG + Intronic
1040866020 8:52049805-52049827 AGCTCTGAGAATTCATAGAAGGG + Intergenic
1041746695 8:61214890-61214912 TCTTATGAGCATGTATAGGATGG + Intronic
1041764284 8:61401897-61401919 TGTTATGAGAATACATAAGAGGG - Intronic
1042102157 8:65285097-65285119 TGCTAGGAGTGTGCAGAGGAGGG - Intergenic
1042228110 8:66530688-66530710 CGCTATTAGAATTCATAGGAGGG - Intergenic
1044826656 8:96204751-96204773 TGCTTTGGAAATGCAGAGGAGGG - Intergenic
1045973057 8:108101544-108101566 TGCTATGAAAATTCAGAAGAAGG - Intergenic
1045993915 8:108341056-108341078 TGCTGTGAAACTGCATAGGAGGG - Intronic
1046018250 8:108632101-108632123 TGCTATAAGAATGCACAGGAAGG + Intronic
1047819139 8:128499429-128499451 TGTTATGAGAATACAGAGGAGGG - Intergenic
1048512377 8:135074669-135074691 TGCTATGAAAATACAGAGGGAGG + Intergenic
1049040233 8:140107221-140107243 TGCTCTGAGACTTCAGAGGAGGG - Intronic
1049896654 9:116000-116022 TTCTAAAAGAATGAATAGGAGGG - Intergenic
1051560429 9:18435489-18435511 TACTATGAGAATATATAGGAGGG + Intergenic
1051872726 9:21757361-21757383 TGCAATGGGAATCCATAGCAAGG - Intergenic
1052044543 9:23778997-23779019 TGCTATGAGAAAGAAGAGGAGGG + Intronic
1052392559 9:27897825-27897847 TTGTTTGAGAATGCATGGGATGG + Intergenic
1055416959 9:76093907-76093929 TGCTATGACAATCTCTAGGAGGG - Intronic
1055619742 9:78111937-78111959 TGCCATGAGAATACATAAAAAGG + Intergenic
1055834556 9:80422876-80422898 TGCTATGAGAAAACAAAGTAAGG - Intergenic
1057380089 9:94559700-94559722 TGCTATGGGAGTGCAAACGATGG - Intronic
1058177388 9:101752675-101752697 TGCTAAGAGAATACACAGCATGG - Intergenic
1058961421 9:109995890-109995912 TGCCATGAGGATGGAGAGGAAGG + Intronic
1060070634 9:120543883-120543905 AGCTATGAGAATTTATAGGTAGG - Intronic
1060360387 9:122950535-122950557 TGTTATGAGAATACACAGCAGGG - Intronic
1061053412 9:128209114-128209136 TGCTCTGAGCATGCAGAGGCTGG - Intronic
1203768043 EBV:36602-36624 TGCTATGCGAATGCTTTGGATGG + Intergenic
1203427016 Un_GL000195v1:50595-50617 TTCTTTGAGAATGCAAAGAATGG + Intergenic
1185933280 X:4227427-4227449 AGCTATGAGGATGCAAAGGCAGG + Intergenic
1186172414 X:6891447-6891469 TGCTTTGAGAATGGAAAGAAAGG - Intergenic
1186909554 X:14147633-14147655 TGTTATGAGAATATAGAGGATGG - Intergenic
1187142665 X:16608700-16608722 TGCTATGAAAATGAAAAGGATGG + Intronic
1187203096 X:17154860-17154882 TGCTCTGAGAACACACAGGAGGG + Intergenic
1187713517 X:22077941-22077963 TGCTCTGAGTAGGCATATGAGGG - Intronic
1188611234 X:32100569-32100591 TGCAATGAGAAAACATAGCATGG + Intronic
1189691978 X:43626032-43626054 AGCTATGAGAATACATAAGAAGG + Intergenic
1190552723 X:51601407-51601429 TGCTTTGAGACAGCACAGGATGG - Intergenic
1190842889 X:54162400-54162422 TGCTATAAGAGTGAAGAGGAGGG - Intronic
1192058125 X:67793977-67793999 TGCTGTGGGAAGGCATAGAAGGG + Intergenic
1194649176 X:96495411-96495433 TGCTATGAGAAGTCATAAAAGGG + Intergenic
1195981529 X:110583283-110583305 TGCTATGAGAAAGCAAATCAGGG - Intergenic
1196409995 X:115408278-115408300 TGCTATGGGAGTGCAGATGAAGG - Intergenic
1196516433 X:116617913-116617935 TGCTATGAAAGGACATAGGAGGG + Intergenic
1196654905 X:118207788-118207810 TGCTATGAATGTGCAGAGGAAGG - Intergenic
1196757017 X:119166877-119166899 TGCTATGAGAACACATAATAGGG - Intergenic
1197398312 X:125955968-125955990 GGAGATGAGAATGCAAAGGAGGG - Intergenic
1197961895 X:132016171-132016193 GGCTGTGAGAATGAAGAGGAAGG - Intergenic
1198030461 X:132749147-132749169 TGCTGTGAGAATCCGAAGGAAGG - Intronic
1198077046 X:133203840-133203862 TGCAAGGAGAATGCATAGGAAGG + Intergenic
1198981588 X:142403645-142403667 TGCTATGGGAACCCAAAGGATGG - Intergenic
1202575661 Y:26321972-26321994 TGCTATGAGAGTGTAGAGGAGGG - Intergenic