ID: 990849144

View in Genome Browser
Species Human (GRCh38)
Location 5:60181995-60182017
Sequence AGGCATTAGCAGAGGGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 461
Summary {0: 1, 1: 0, 2: 3, 3: 40, 4: 417}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990849139_990849144 6 Left 990849139 5:60181966-60181988 CCTGATTAGCTAAAAGCCAGTAA 0: 1
1: 0
2: 0
3: 3
4: 101
Right 990849144 5:60181995-60182017 AGGCATTAGCAGAGGGAAGAAGG 0: 1
1: 0
2: 3
3: 40
4: 417
990849136_990849144 11 Left 990849136 5:60181961-60181983 CCTCCCCTGATTAGCTAAAAGCC 0: 1
1: 0
2: 0
3: 5
4: 64
Right 990849144 5:60181995-60182017 AGGCATTAGCAGAGGGAAGAAGG 0: 1
1: 0
2: 3
3: 40
4: 417
990849135_990849144 12 Left 990849135 5:60181960-60181982 CCCTCCCCTGATTAGCTAAAAGC 0: 1
1: 0
2: 0
3: 7
4: 89
Right 990849144 5:60181995-60182017 AGGCATTAGCAGAGGGAAGAAGG 0: 1
1: 0
2: 3
3: 40
4: 417
990849133_990849144 21 Left 990849133 5:60181951-60181973 CCTTTCCTTCCCTCCCCTGATTA 0: 1
1: 0
2: 3
3: 80
4: 703
Right 990849144 5:60181995-60182017 AGGCATTAGCAGAGGGAAGAAGG 0: 1
1: 0
2: 3
3: 40
4: 417
990849134_990849144 16 Left 990849134 5:60181956-60181978 CCTTCCCTCCCCTGATTAGCTAA No data
Right 990849144 5:60181995-60182017 AGGCATTAGCAGAGGGAAGAAGG 0: 1
1: 0
2: 3
3: 40
4: 417
990849137_990849144 8 Left 990849137 5:60181964-60181986 CCCCTGATTAGCTAAAAGCCAGT 0: 1
1: 0
2: 0
3: 2
4: 107
Right 990849144 5:60181995-60182017 AGGCATTAGCAGAGGGAAGAAGG 0: 1
1: 0
2: 3
3: 40
4: 417
990849141_990849144 -10 Left 990849141 5:60181982-60182004 CCAGTAAGAAAGCAGGCATTAGC 0: 1
1: 0
2: 1
3: 13
4: 122
Right 990849144 5:60181995-60182017 AGGCATTAGCAGAGGGAAGAAGG 0: 1
1: 0
2: 3
3: 40
4: 417
990849138_990849144 7 Left 990849138 5:60181965-60181987 CCCTGATTAGCTAAAAGCCAGTA 0: 1
1: 0
2: 0
3: 4
4: 83
Right 990849144 5:60181995-60182017 AGGCATTAGCAGAGGGAAGAAGG 0: 1
1: 0
2: 3
3: 40
4: 417

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990849144 Original CRISPR AGGCATTAGCAGAGGGAAGA AGG Intronic
901449337 1:9326450-9326472 AGGCATGACCAGAGGGAACAGGG + Intronic
901473559 1:9473886-9473908 AGGCATTCACAGAGGGGAGACGG - Intergenic
901761661 1:11475852-11475874 ATGCCTTAGCAGATTGAAGAGGG + Intergenic
902133394 1:14283031-14283053 AAGCATTCGCAGAGCAAAGAAGG + Intergenic
902780499 1:18701829-18701851 AGGGATAGGCAGAGGGAAGAAGG + Intronic
902855914 1:19204683-19204705 AGACATTGGCAGAGGAAAAATGG + Intronic
903925054 1:26826305-26826327 AGGCATTTGCAGAGGCAGGCAGG - Intergenic
904044049 1:27599791-27599813 AGGCATTTGGGGAGGGCAGAAGG + Intronic
905256678 1:36689222-36689244 AGCCAATAGCAGACGGAAGTTGG - Intergenic
905291266 1:36923299-36923321 AGGCAGCAGCAGGGGGTAGAGGG + Intronic
905456446 1:38091465-38091487 AGGAATTAGCCAGGGGAAGAGGG + Intergenic
905818118 1:40967724-40967746 AGGCATCAATATAGGGAAGAAGG - Intergenic
906145336 1:43557239-43557261 GGGCAGTGGCAGAGGTAAGAGGG - Intronic
906518447 1:46453208-46453230 AGTCATTTGCAGAGCGGAGATGG - Intergenic
906667575 1:47632365-47632387 TGGCACTAGCAGAGAGGAGAGGG + Intergenic
906811162 1:48828251-48828273 AGACAGTAGAAGAGAGAAGACGG + Intronic
906901637 1:49842741-49842763 AGACTTTAGCAGAGAGATGAGGG + Intronic
907371942 1:54009491-54009513 AGGCCTGAGCAGAGGAGAGAAGG - Intronic
907486879 1:54784177-54784199 AGGCATGAGCAGAGGGAGGTGGG + Intronic
908046420 1:60174588-60174610 AGGCATTAGAAGGTGGGAGAAGG + Intergenic
908328971 1:63051686-63051708 AGGCAATATCTGGGGGAAGAAGG + Intergenic
908472930 1:64461654-64461676 TGGCATTGGCAGAGGGGGGAGGG + Intergenic
909952157 1:81733705-81733727 AGCTATTAGCAGGGGGTAGAAGG - Intronic
910335065 1:86118928-86118950 AGGCAGTTGCAGAGGTAAGCAGG + Intronic
910922000 1:92358348-92358370 AGGAATTAACCAAGGGAAGAGGG - Intronic
911154361 1:94624051-94624073 AGGAGAGAGCAGAGGGAAGAAGG + Intergenic
911220816 1:95243367-95243389 AGGCACGTGCAGAGGGAAGTAGG + Intronic
912322547 1:108727781-108727803 AAGCAGGAGCAGAGGGAAAATGG - Intronic
913393794 1:118343828-118343850 AGAGATTAGCAGAGGGAGAAGGG + Intergenic
915300857 1:154950901-154950923 GGGCCTGGGCAGAGGGAAGATGG - Intronic
915831283 1:159133083-159133105 AGGCATTAGCAGTGGGTAGCTGG - Intronic
917017003 1:170543424-170543446 GGGCAGGAGAAGAGGGAAGAAGG + Intronic
917745798 1:178005730-178005752 AGAAATTAGCAGAAGGAAGAGGG - Intergenic
919301145 1:195767990-195768012 AGGCAGTAGGAGAGAGAAAAAGG - Intergenic
920288135 1:204896489-204896511 AGGAATTGGTAGAAGGAAGAAGG + Intronic
920720472 1:208382131-208382153 AGGCATATGCATAGGGTAGAGGG + Intergenic
921167663 1:212518565-212518587 AACCATTAGCTGAGGGAGGAGGG + Intergenic
921322955 1:213960989-213961011 AGGCATTGGCAGAAGGCACATGG + Intergenic
921569929 1:216765588-216765610 AGGCATTCTCTGAGGGAAGGTGG + Intronic
922562471 1:226579257-226579279 AGGCATTAGCTGAGTGATGGGGG + Intronic
923971318 1:239206142-239206164 AGACATTAGCACAGGTAAAAGGG + Intergenic
1062987069 10:1778981-1779003 AGGGATAACCAGAGGGAAGCTGG + Intergenic
1063922276 10:10944950-10944972 AGGCATCAGGAGAGGGGAGAAGG + Intergenic
1064906081 10:20347544-20347566 AGGCAGAAGCAGAGAGGAGAGGG - Intergenic
1065232585 10:23613517-23613539 AGGATTTAGAAGAGGGAAAAAGG + Intergenic
1066055060 10:31673216-31673238 AGGGAGTAGCAGATGGGAGAAGG + Intergenic
1067169603 10:43895816-43895838 AAGCATGAGCAGAGGGATAAGGG + Intergenic
1067303662 10:45037701-45037723 GGGGCTTACCAGAGGGAAGAGGG + Intergenic
1067346070 10:45440041-45440063 AGGCAGTAGAAGAGGGAGCAGGG + Intronic
1067582172 10:47452717-47452739 AGGCTTTAGCGCAGGGAAGTTGG - Intergenic
1068730088 10:60348173-60348195 ATGAAATAGCAGAGGCAAGATGG - Intronic
1069065019 10:63933319-63933341 AGGCATTAGAAGAGACAGGAAGG - Intergenic
1069109320 10:64425754-64425776 ATGCATGGGCAGTGGGAAGATGG + Intergenic
1069413682 10:68178873-68178895 AGACATTAGCTGGGGGTAGAGGG - Intronic
1070159372 10:73856596-73856618 AGGCAGGAGCAGAGGGACTATGG + Intronic
1070323404 10:75371850-75371872 AGACAGTGGCAGAGGTAAGATGG - Intergenic
1070917460 10:80164005-80164027 AGGGATCTGCAGAGGGCAGAGGG + Intronic
1071242593 10:83724491-83724513 AGGAATTAGAAAAGGGAGGAAGG + Intergenic
1071536802 10:86440129-86440151 AGGAATTAGCATGGGAAAGATGG + Intronic
1071555692 10:86599801-86599823 AGGCCTTCACAGAGGGAAGTGGG - Intergenic
1073055497 10:100698073-100698095 AGGCCCTGGCAGAGGGTAGAGGG - Intergenic
1073563860 10:104519085-104519107 TGGAAGGAGCAGAGGGAAGAGGG - Intergenic
1075515423 10:123104400-123104422 AGGCATGAGAAGAAGGCAGAAGG + Intergenic
1075808814 10:125209524-125209546 AGACAATAGAAGAGGGAATATGG - Intergenic
1075848113 10:125563288-125563310 AGGAGTTAGGAGTGGGAAGAAGG - Intergenic
1076120941 10:127935938-127935960 AGGTGAGAGCAGAGGGAAGAAGG - Intronic
1077675611 11:4191174-4191196 AGGAACTGGCAGAGGGAAGCAGG - Intergenic
1077803328 11:5563953-5563975 AGGAATTAGCATAGGGACAATGG - Intronic
1079150230 11:17892364-17892386 TGGCAGTGGCAGAGGGCAGAAGG - Intronic
1079427384 11:20356563-20356585 AGCCATCAGAAGTGGGAAGAGGG + Intergenic
1079530117 11:21442149-21442171 AGGCATTAACTGAGTAAAGAAGG - Intronic
1080127527 11:28754454-28754476 AGGGAGGAACAGAGGGAAGAAGG + Intergenic
1080839400 11:35970336-35970358 AGACACTCACAGAGGGAAGATGG + Intronic
1081151476 11:39638398-39638420 AAGGAGTAGCAAAGGGAAGATGG + Intergenic
1081550064 11:44102644-44102666 TGGCCTCAGCAGAAGGAAGAGGG - Intronic
1081621158 11:44619907-44619929 AGGCAGTGGGAGAGGGGAGAGGG + Exonic
1081668908 11:44932594-44932616 AGGCAGTGGCAGAGGGGTGAGGG - Exonic
1083208599 11:61168470-61168492 AGGCATGAGCACATGGATGAAGG + Intergenic
1083404560 11:62447648-62447670 AGGCAGTAACCGAGGGAGGAGGG - Intronic
1084128141 11:67114572-67114594 AGGAGTTAGGATAGGGAAGAGGG + Intergenic
1084664578 11:70569532-70569554 CGGCACCAGCAGAGGTAAGATGG - Intronic
1085036460 11:73303151-73303173 AGGCATTAGCTCAGTGCAGAAGG + Intergenic
1087272397 11:96124756-96124778 GGGCATGAGAGGAGGGAAGAAGG + Intronic
1088122439 11:106385998-106386020 AGGCATGGACAGAGGGAGGAAGG - Intergenic
1089067416 11:115672430-115672452 AGGATTTAGCCGAGGGAAGCTGG + Intergenic
1089114123 11:116080374-116080396 AAGGAACAGCAGAGGGAAGAGGG - Intergenic
1089607062 11:119647577-119647599 AGGAGCTAGGAGAGGGAAGAGGG - Intronic
1090236832 11:125154567-125154589 AGACATGAGCAGAGGGGTGATGG - Intergenic
1091179924 11:133595350-133595372 AGGCATCATCAGAAGGATGATGG + Intergenic
1091798002 12:3308288-3308310 AGGCATTAGCCAAGCGAAGAAGG + Intergenic
1093604627 12:21074669-21074691 AGGGAATAGGAGAGAGAAGATGG + Intronic
1093688689 12:22085125-22085147 AGGCATGAGCAGAGAGACTATGG - Intronic
1093743720 12:22716067-22716089 AGGAAGGAGCAGAGGGATGAAGG + Intergenic
1096739713 12:53684000-53684022 AGGCATAATCTGGGGGAAGAAGG - Intergenic
1097532445 12:60821433-60821455 AGGCATTTGCAGAGGTGACATGG + Intergenic
1097751579 12:63360253-63360275 GGAGATTAGCAGAGGGAAGATGG - Intergenic
1098102013 12:67027938-67027960 AGGAATTGGAAGAGGGCAGATGG + Intergenic
1098633813 12:72756905-72756927 AGGCATTTGCAGTGGGAATATGG - Intergenic
1098831548 12:75370979-75371001 ATGCAATAGCTGAGGGAAGCTGG - Intronic
1099020468 12:77397251-77397273 AGGCAATATAAGAGGGGAGAAGG + Intergenic
1099732619 12:86525262-86525284 AGGCAGTAGGAGAGAGAGGATGG - Intronic
1100201062 12:92298293-92298315 CTGCATTCTCAGAGGGAAGAGGG + Intergenic
1101873728 12:108585062-108585084 GGTCATTAGCGGAGGGAGGAAGG + Intergenic
1103187641 12:118974428-118974450 AGGCATTTGCCAAGTGAAGAAGG - Intergenic
1106171761 13:27294739-27294761 AGAGATATGCAGAGGGAAGATGG + Intergenic
1106594845 13:31127258-31127280 AGGCCTGAGCAGCAGGAAGATGG + Intergenic
1106713550 13:32364514-32364536 CTGTATTAGTAGAGGGAAGATGG - Intronic
1106900575 13:34351215-34351237 AGGAATGAGTAGAGGGATGATGG + Intergenic
1106900607 13:34351396-34351418 ATGGATTAGCGGAGGGATGATGG + Intergenic
1107015476 13:35705310-35705332 GGGCATGAGTAGAGGGAGGAAGG + Intergenic
1107024672 13:35787624-35787646 AGGGATTTCCAGGGGGAAGAGGG + Intronic
1107788619 13:43978573-43978595 AGGCTTTAGCAGGGGCCAGAGGG + Intergenic
1108094226 13:46883607-46883629 TGGCATTGGCAGATGGAAAAAGG + Intronic
1108426482 13:50306927-50306949 GGGGATTAGCAGAGGGAGGAAGG - Intronic
1110036399 13:70690797-70690819 ACTCAGTAGCAGAAGGAAGAGGG - Intergenic
1110504229 13:76266484-76266506 AGGTATTAGCAGAGGCAAGAAGG - Intergenic
1113794259 13:113047835-113047857 AGGCGTGAGCAGAGGGGACAGGG - Intronic
1114412929 14:22517637-22517659 GGGCAATGACAGAGGGAAGATGG + Intergenic
1115308070 14:31952250-31952272 AGTCATTACCAGAGGAAAGAAGG + Intergenic
1115565501 14:34621790-34621812 AGGCAGTGGAAGAGGGATGAAGG - Intronic
1115652737 14:35414761-35414783 AGGATTTAGAAGAGGGCAGAGGG - Intergenic
1117045866 14:51812859-51812881 AGGCATCAGGAGAGGTAAGGAGG - Intergenic
1117288526 14:54310305-54310327 GGGCATGAGCACAGAGAAGAGGG - Intergenic
1118261260 14:64248972-64248994 AGGAAAGAGCAGAGGGAAGTAGG - Intronic
1118438440 14:65791844-65791866 AGGCATCAGCAGAGAGAAACAGG - Intergenic
1118710394 14:68514082-68514104 AGTCAGTAGCAGAGCGAGGATGG - Intronic
1119829263 14:77686494-77686516 AGGCACTAGCAGAAGGATGATGG + Intronic
1120583973 14:86287671-86287693 AGTCATTAGGAGAGGGAGGGTGG + Intergenic
1120929865 14:89837372-89837394 AGCCATTACCAGAAGGAAGCAGG - Intronic
1121017448 14:90557124-90557146 AGGTAGAAGCAGAGGGCAGATGG - Intronic
1121799208 14:96759427-96759449 AGGCATTATCACATGGATGAGGG - Intergenic
1121940726 14:98068123-98068145 AGGAATGAGCAGAGGAAAGGAGG + Intergenic
1122006185 14:98705848-98705870 AGGGATTAGCCCAGGGAAGGTGG - Intergenic
1122017863 14:98811674-98811696 AGAAATTAGAAAAGGGAAGAAGG + Intergenic
1122023425 14:98858142-98858164 AGGGATTAGCCATGGGAAGAGGG + Intergenic
1122524419 14:102370640-102370662 GGGCTTTAGCAGGAGGAAGATGG + Intronic
1122772110 14:104102128-104102150 AGGCATCAGCACAGGAAAGGAGG - Intronic
1123696391 15:22881971-22881993 AGGCGTTAGCAGAGCGGAGTGGG - Intronic
1124811089 15:32938986-32939008 AGTCATTTTCAAAGGGAAGAGGG + Intronic
1125261717 15:37833338-37833360 AGGCATCAGGAGAGTGAAGCAGG - Intergenic
1126644030 15:50857005-50857027 AAGAAAGAGCAGAGGGAAGATGG + Intergenic
1127514906 15:59683808-59683830 AACCAGTAGCAGAGGAAAGAGGG + Intronic
1128102569 15:65015201-65015223 AGGAAGTAGCAGAGTCAAGATGG + Intronic
1128650693 15:69410668-69410690 AGGCATTGTCAGAGGAAAGGAGG + Intergenic
1129028485 15:72601552-72601574 AGGCATTAGCTTAGGGAAAGGGG - Exonic
1129692419 15:77721337-77721359 AGGCAGTGGCTGGGGGAAGAGGG - Intronic
1130379721 15:83360986-83361008 GGGCAGCAGGAGAGGGAAGAAGG - Intergenic
1131151195 15:90048421-90048443 TGGCATCAGCACAGGGAGGAGGG + Intronic
1131352438 15:91713464-91713486 AGACATGAACAGAGAGAAGATGG - Intergenic
1132126374 15:99229466-99229488 AGGAAACAGCACAGGGAAGAGGG + Intronic
1133062758 16:3185474-3185496 AGGCATACACAAAGGGAAGATGG + Intergenic
1133978840 16:10619038-10619060 AGGCCTTGGCAGAGGGAGGAGGG + Intergenic
1134355752 16:13480556-13480578 AGGGAATAGCAGAGGAAAAATGG - Intergenic
1135241691 16:20812652-20812674 AGGTATGAGGAGAGGGAAGCAGG - Intronic
1135935862 16:26779442-26779464 AGGCAGAAGTAGAGGAAAGAAGG - Intergenic
1136054498 16:27678412-27678434 AGGGAAAAGGAGAGGGAAGAGGG - Intronic
1136607913 16:31348889-31348911 GGTCATGAGCAAAGGGAAGAGGG - Intergenic
1137903239 16:52291811-52291833 TGGCATTAGCAGACTCAAGAAGG + Intergenic
1137997430 16:53233645-53233667 AGGCATGATTAGAGGGGAGAAGG - Intronic
1138308074 16:55996775-55996797 AGGCATTTGCTGAGAGAACAGGG - Intergenic
1139766670 16:69236339-69236361 AGGCATGAGAGAAGGGAAGAGGG + Intronic
1142564017 17:827825-827847 GGGCAGCAGCAGAGGGAAGAGGG + Intronic
1143206188 17:5140717-5140739 AGGCATGAGCTGAAGGCAGAGGG - Intronic
1144335184 17:14262283-14262305 ACGGAGTAGCCGAGGGAAGACGG - Intergenic
1144773074 17:17770366-17770388 AGGCATTAGCTGCAGGGAGACGG + Intronic
1145857316 17:28173429-28173451 AGACATTTGCAAAGGGAAGGTGG + Intronic
1145898418 17:28474196-28474218 AAGCAGCAGCAGAGTGAAGAGGG + Intronic
1147136734 17:38438408-38438430 AAGCATTAGCACAGGCAAGGAGG + Intronic
1147995201 17:44356344-44356366 AGCCATTGCCTGAGGGAAGAGGG + Exonic
1148056996 17:44805110-44805132 ATACATTATCAGAAGGAAGATGG + Exonic
1148972547 17:51497028-51497050 GGGCCTTAACAGAGAGAAGAGGG - Intergenic
1149081847 17:52667288-52667310 AAGCATTAGCAATGTGAAGACGG - Intergenic
1149633702 17:58148888-58148910 AGGCAGGAGAAGGGGGAAGATGG - Intergenic
1150083921 17:62264136-62264158 AGACATGAGCAGAAGGCAGAGGG + Intergenic
1150119442 17:62587634-62587656 AGGGCTTAGCAGAGGGAGAAGGG + Intronic
1150341724 17:64373946-64373968 AGGCAACAGCAGAGGGAAGCTGG - Intronic
1150589127 17:66546570-66546592 AGGCACACACAGAGGGAAGATGG - Intronic
1151174201 17:72273795-72273817 AGCCAGGAGCAGAGGGAAGAGGG + Intergenic
1151548016 17:74805313-74805335 AGGCACTGCCAGAGAGAAGAGGG + Intronic
1152120342 17:78414572-78414594 AGGCTTTCCCAGAGGGAACATGG - Intronic
1152314299 17:79571389-79571411 AGGCATAGGCAGAAGGGAGAGGG - Intergenic
1152333631 17:79687279-79687301 ACGCATTTGCAGAGGGAAAAGGG + Intergenic
1153733786 18:8043662-8043684 AGGAAGCAGGAGAGGGAAGAGGG - Intronic
1154032223 18:10763817-10763839 CGGCAATAGCCCAGGGAAGATGG + Intronic
1154260558 18:12828589-12828611 AGGAAATAGCAGATGTAAGATGG + Intronic
1155670932 18:28370271-28370293 AGGCCTGAGCAGAAGGAAGAAGG + Intergenic
1156111726 18:33735668-33735690 AGGCAAAAGCAGAGGGAAGAAGG - Intronic
1157007465 18:43601628-43601650 AGAGAGTGGCAGAGGGAAGAAGG + Intergenic
1157089042 18:44613670-44613692 AGGCAACTCCAGAGGGAAGACGG - Intergenic
1157130126 18:44999040-44999062 AGGCATTAGTTGAGGCCAGAAGG - Intronic
1157371362 18:47115283-47115305 AGGTATTACAAGAGGAAAGATGG - Exonic
1157620871 18:49016901-49016923 AGGAATGGGCAGAGGTAAGAAGG - Intergenic
1157722616 18:49937043-49937065 AGGAACTAACAGAGGGAGGAGGG - Intronic
1159002639 18:62987646-62987668 AGGCAGAAGAAGAGGGCAGAGGG - Intergenic
1159951654 18:74488488-74488510 AGACATACACAGAGGGAAGATGG + Intergenic
1161237347 19:3204537-3204559 CGCCATTAGCAGAGGGCAGGCGG - Intronic
1161322306 19:3646932-3646954 AGGCACTCACAGAGGGAGGAGGG + Intronic
1161322398 19:3647240-3647262 AGGCACTCACAGAGGGAGGAGGG + Intronic
1161826209 19:6567694-6567716 TGTCAGTAGCAGTGGGAAGAGGG - Intergenic
1162463849 19:10829494-10829516 AGGCACCAGCAGAGGGCAGGCGG - Intronic
1163350755 19:16775371-16775393 AAGCAAAAGCAGAGGCAAGAGGG + Intronic
1164279958 19:23760362-23760384 AGGCTTTATTAGAAGGAAGAGGG + Intergenic
1166065476 19:40356011-40356033 AGGCATAGGCAGAGGGATCAGGG + Intronic
1167144731 19:47674985-47675007 AGGCATGAGCAATGGGATGATGG + Intronic
1167194772 19:48020724-48020746 AGGCACTGGAATAGGGAAGAAGG - Intronic
1167275222 19:48534031-48534053 AGGGATGAGAAGAGGGGAGATGG - Intergenic
1168646727 19:58063860-58063882 AGACTTTAGCAGAGAGATGAGGG + Intronic
925409195 2:3629068-3629090 AGGCCTTGGGAGAGGGAAAAAGG + Intronic
925894284 2:8459410-8459432 CAGGATAAGCAGAGGGAAGAGGG - Intergenic
925935520 2:8755202-8755224 AGGAATTAACAGGGTGAAGATGG - Intronic
925994627 2:9281993-9282015 GAGCATGAGCAGAGGGAAGAAGG - Intronic
926552721 2:14319445-14319467 AGGCATTTGTATATGGAAGATGG - Intergenic
926846803 2:17150019-17150041 AGGGAGAAGCAGAGGGAAGCGGG + Intergenic
927120678 2:19958252-19958274 CGGCATTTGCAGAGGAATGAAGG - Intronic
928110108 2:28500535-28500557 TGACAATAGCAGAAGGAAGAAGG - Intronic
928230238 2:29492455-29492477 AGTCATTAGGAGTGGGAAGAGGG + Intronic
929683067 2:44010837-44010859 ATGCATTATAAGAGGAAAGAAGG - Intergenic
929868314 2:45736958-45736980 GGGAATGAGCAGATGGAAGAGGG + Intronic
929919835 2:46164117-46164139 GGGCTTTGACAGAGGGAAGAGGG + Intronic
929924917 2:46200078-46200100 AGACATTACCAGAGGGACGGGGG + Intergenic
930463026 2:51708078-51708100 AAGTATAAGAAGAGGGAAGAAGG - Intergenic
930774323 2:55157630-55157652 AGCCATCAGCAGAGGGATCAGGG + Intergenic
931471144 2:62538827-62538849 AAGCAGTAGCAGTGGGAATAAGG + Intergenic
931483678 2:62669056-62669078 AGGCAGAAGCAGAAGAAAGACGG - Intergenic
932090537 2:68802069-68802091 AGGCAGCAGCAGTGGGAATAGGG + Intronic
932381282 2:71285932-71285954 AGGCATTTGCAGATGGCAAAAGG - Intronic
932774624 2:74520408-74520430 AGGAATTAGCCGAGTGGAGACGG + Intronic
932923793 2:75946639-75946661 TGTCATTGGCAGAGGGAAAAGGG + Intergenic
932925987 2:75975133-75975155 AATCATCAGCAGAGGGAAGAGGG + Intergenic
933044746 2:77521580-77521602 TGGCATTAGCAGATAAAAGACGG - Intronic
933157488 2:78992141-78992163 AGGAACTAGCAGAGGGAAGCTGG - Intergenic
933841051 2:86285901-86285923 GGGCTCAAGCAGAGGGAAGATGG + Intronic
933842560 2:86299138-86299160 AGGAATTAGCAGAGGGCCCAAGG - Intronic
934534083 2:95118467-95118489 TGGCATGGCCAGAGGGAAGATGG - Intronic
934774016 2:96925841-96925863 TGACATTCTCAGAGGGAAGATGG + Intronic
935418021 2:102838829-102838851 AGCCATTGGCAGAGGAAGGATGG + Intronic
935599250 2:104905743-104905765 AGGCACTCACAGAGGGAAGATGG - Intergenic
935740191 2:106140548-106140570 GGGCACCAGGAGAGGGAAGATGG - Intronic
936057987 2:109275754-109275776 TGTCATTAGCACAGGGAAGCAGG - Intronic
936624574 2:114134971-114134993 AACCATAAGCAGAGGTAAGACGG + Intergenic
937039154 2:118807685-118807707 TGGCTTTAGCAGGGGGCAGAGGG - Intergenic
937149422 2:119675430-119675452 TGGCCCTACCAGAGGGAAGAGGG + Intergenic
938215644 2:129510933-129510955 AGGCACTTGTAGAGGGAAAATGG + Intergenic
939159261 2:138566924-138566946 AGGAGTTAGCAGAAGTAAGAAGG + Intronic
941133218 2:161680417-161680439 AGGGAATAGGAGAGGGAAGTGGG + Intronic
941750135 2:169126683-169126705 AGAGATTAACAGTGGGAAGATGG + Intergenic
941995997 2:171602528-171602550 AGGAAGTAGGAGAAGGAAGAGGG - Intergenic
943330907 2:186557998-186558020 AGGCCCTAGCAGAGGGAAAGAGG + Intergenic
943494995 2:188609379-188609401 AGGCATTCTCAGAGGGTGGAAGG + Intergenic
943657181 2:190522068-190522090 AGGAATTAATAGAGGGAGGAGGG + Intronic
944226608 2:197354923-197354945 AAGCATGATCAGAGGGTAGAGGG + Intergenic
944547152 2:200810436-200810458 AGGCAACAGCAGTGGGAAGGAGG - Intergenic
945984759 2:216344692-216344714 AGGCATAAGGAGATGAAAGAGGG + Intronic
947564978 2:231187968-231187990 AGCCATCAGGAGAGGGAGGAGGG + Intergenic
947981564 2:234414751-234414773 GGGCATTAGCATAGATAAGATGG - Intergenic
948761704 2:240196434-240196456 AGGCATAAGCAGAGAGCACAGGG + Intergenic
948850643 2:240703775-240703797 AGGCAACAGCTGAGGGAGGAGGG + Intergenic
1168791052 20:576073-576095 TGGCATTGGTTGAGGGAAGAAGG + Intergenic
1169071161 20:2731480-2731502 TGGCATGAGCAGAGGTAAGGTGG - Intronic
1169461201 20:5797185-5797207 AGGAATTAGGAAAGGAAAGAGGG + Intronic
1169777315 20:9269885-9269907 GGGCAGTAGCAGCAGGAAGATGG + Intronic
1169794721 20:9449374-9449396 AGGAAGTAGCTGAGGGAAGTTGG + Intronic
1171265640 20:23769855-23769877 TGTGATTAGCAGAGGAAAGAAGG + Intergenic
1171398440 20:24855909-24855931 GGGCATCAGCACTGGGAAGAGGG - Intergenic
1172890823 20:38262615-38262637 AGGAATTAGAAGAGTGGAGATGG + Intronic
1173278529 20:41606054-41606076 AGGCATTAGCAGCTGGGACAAGG - Intronic
1173486198 20:43442937-43442959 AGGCATTAGCAAGGGCCAGAGGG + Intergenic
1174336073 20:49861654-49861676 GGGCAGTAGGGGAGGGAAGAAGG + Intronic
1175610633 20:60348189-60348211 AGACATTAGAAGTGGGCAGAGGG - Intergenic
1175872544 20:62215272-62215294 AAGCCTTAGCGGAGGGAGGAGGG + Exonic
1178417409 21:32415036-32415058 AGGAATTTGCAGAGGGAGGGCGG - Intronic
1179049250 21:37874721-37874743 AGGCCTGAGCAAATGGAAGAAGG - Intronic
1179521131 21:41945767-41945789 AGGCGGCAGGAGAGGGAAGAAGG - Intronic
1179766794 21:43580047-43580069 AGGCCTGAGCAGAGGGATGTAGG - Intronic
1181769000 22:25112149-25112171 AGCCAGGAGGAGAGGGAAGAAGG - Intronic
1182158992 22:28103165-28103187 AGGCAGAAGCAGAGAGAAGCTGG - Intronic
1183105011 22:35609387-35609409 AGGGATTTGCAGAGAGAAGATGG + Intronic
1183196978 22:36360299-36360321 AGCAATTTGCAGAGGGAAGAGGG + Intronic
1184306448 22:43606042-43606064 AGGCAATTCCAGAGGGAAAAAGG + Intronic
1184378984 22:44133208-44133230 AGGCAGAAGCAGAGGCATGAGGG + Intronic
1184537183 22:45095062-45095084 AGGAGTTAGCAAAGCGAAGAAGG - Intergenic
1185074977 22:48678175-48678197 AGCCCTCAGCAGAGGGAACATGG - Intronic
1185168270 22:49275695-49275717 AGGCCTGAGCACAGGGAACATGG - Intergenic
949367899 3:3302786-3302808 AGGCAGCAGGAGAGAGAAGAAGG - Intergenic
950644334 3:14368169-14368191 AGGCCTCAGCAGAGTGAGGAGGG - Intergenic
950917375 3:16659620-16659642 AGGAATTAGAGGAGGGAGGAAGG - Intronic
951717708 3:25665832-25665854 AGTCTTTGGCAGATGGAAGATGG + Intergenic
952561950 3:34604977-34604999 AGGCATCAGAAGAAGGCAGAAGG - Intergenic
952647717 3:35681777-35681799 AGGCAATAGCAGAGGAAGGAGGG + Exonic
953551634 3:43907973-43907995 AGGGAATGGTAGAGGGAAGAGGG - Intergenic
954588234 3:51755923-51755945 AGGAGTTAGCAAAGGGAATAGGG + Intergenic
956874432 3:73447896-73447918 AGGCATTACCAGAGGGATCTGGG - Intronic
956907602 3:73782677-73782699 AGGCATTAGAAGAGATAGGAGGG + Intergenic
956936113 3:74103640-74103662 AGACATTAGCAGAGGGAGCCAGG - Intergenic
959054626 3:101554932-101554954 AGGCTTTAGAACAGGAAAGAAGG - Intergenic
959385525 3:105701028-105701050 CTCCATCAGCAGAGGGAAGATGG + Intronic
959899972 3:111649959-111649981 AGGCGTTTGGAGATGGAAGAGGG - Exonic
960744562 3:120872855-120872877 AGGCAGTAGGAGAAAGAAGAAGG + Intergenic
960885052 3:122384691-122384713 AGGAAGGAGCAGGGGGAAGAGGG - Intronic
961131645 3:124473437-124473459 AGACATTACCACAGGGAAGCAGG - Intronic
962202821 3:133414868-133414890 AGGGATGAGTAGAGGGGAGAGGG - Intronic
962203070 3:133415826-133415848 AGGGGTGAGTAGAGGGAAGAGGG - Intronic
962203128 3:133416072-133416094 AGGGGTGAGTAGAGGGAAGATGG - Intronic
962203241 3:133416557-133416579 AGGGGTTAGTAGAGGGGAGATGG - Intronic
962203486 3:133417492-133417514 AGGGATGAGTAGAGGGGAGAGGG - Intronic
962203496 3:133417525-133417547 AGGGATGAGTAGAGGGGAGATGG - Intronic
966344915 3:178968522-178968544 AGGCAGGGGCAGAGGGATGATGG + Intergenic
966874053 3:184311635-184311657 AGGGAGTAGCAAAGGCAAGAAGG + Intronic
967422907 3:189293435-189293457 AGGGATTGCCAGAGGGAAGATGG + Intronic
967464981 3:189794521-189794543 AAGCATCAGCAAAGGGAAGGGGG + Intronic
968914350 4:3490741-3490763 AGGAATGAGCAGGAGGAAGAAGG - Intronic
970765824 4:19547757-19547779 AGGCATAAGTAGAAAGAAGATGG + Intergenic
973048888 4:45570421-45570443 AGGAATAAGGACAGGGAAGAAGG + Intergenic
973962683 4:56127522-56127544 AGGCAGAAGAAGAGAGAAGAAGG - Intergenic
974705034 4:65503102-65503124 AGGCACTACTAGAGGGAAGAAGG + Intronic
975177188 4:71301412-71301434 CGGAGTTAGGAGAGGGAAGAAGG + Intronic
976099989 4:81551097-81551119 AGGAAGGAGCAGAGGGAAAATGG + Intronic
976119695 4:81766164-81766186 AGGAATTAGCACATAGAAGATGG - Intronic
976206359 4:82626649-82626671 GGGAAGTAGCAGAGGGAACAAGG + Intergenic
976436109 4:85019998-85020020 AGGCAGTAGCAGATGGAACCAGG + Intergenic
976794154 4:88913415-88913437 AAGTAGTAGTAGAGGGAAGAGGG + Intronic
978615446 4:110589174-110589196 TGACATTAGCAGAGTAAAGAGGG - Intergenic
978907567 4:114025916-114025938 AGGCATTTGCAGGAGGGAGATGG - Intergenic
979154126 4:117360821-117360843 AGACATAAGCAGAGTGGAGAGGG - Intergenic
979582320 4:122375300-122375322 AGGAGTTAGGAGAGAGAAGAAGG + Intergenic
981010869 4:139923297-139923319 AGTCAGTAACAGAGGGAAGGGGG - Intronic
981931404 4:150192756-150192778 AGTTGTTAGGAGAGGGAAGAAGG + Intronic
982183617 4:152774039-152774061 AGGGATTGGGAGAGGGAGGAAGG - Intronic
983028904 4:162773413-162773435 AGCCATTAGCATAGAGAAGTGGG + Intergenic
983033332 4:162830737-162830759 AAGCATTAGCAGAATGAAAATGG + Intergenic
984883197 4:184428353-184428375 AGGAATTTGGAGAAGGAAGAGGG + Intronic
985878555 5:2619570-2619592 AGGCCTTAGCAGCTGGAAGTTGG - Intergenic
987071251 5:14338805-14338827 AGGAAGGGGCAGAGGGAAGAGGG + Intronic
988806062 5:34741807-34741829 TGGCATGGGAAGAGGGAAGAGGG + Intronic
989187471 5:38638985-38639007 AGGCATGAGCAGGCAGAAGAGGG - Intergenic
989559862 5:42837742-42837764 AGGAAATGGAAGAGGGAAGAAGG - Intronic
990117007 5:52401742-52401764 AGCCATCAGAAAAGGGAAGAGGG + Intergenic
990849144 5:60181995-60182017 AGGCATTAGCAGAGGGAAGAAGG + Intronic
991052384 5:62287221-62287243 GGTCCTTAGCAGAGGGAAGTAGG + Intergenic
991266933 5:64730680-64730702 AGTCATTAGCCGAAGGAGGAAGG + Intronic
992210057 5:74469930-74469952 AGCGCTTAGCAGAGGGGAGATGG - Intergenic
992260749 5:74967787-74967809 AGGCATTAGGAGTAGGATGAAGG - Intergenic
993225101 5:85159604-85159626 AGGCAGTCACAAAGGGAAGATGG - Intergenic
993268394 5:85760644-85760666 AGAAATTAGCAGAGGAAAGAAGG + Intergenic
995126455 5:108581609-108581631 ATGCCATAGCAAAGGGAAGAAGG + Intergenic
996833290 5:127763794-127763816 AGGCAGAAGCAGAGGGAAAGGGG - Intergenic
996949421 5:129108242-129108264 GGGCCTTATCAGAGGAAAGAAGG + Intronic
997353961 5:133250453-133250475 TGGCATGAGCTGAGGGAAGCAGG + Intronic
997676333 5:135715703-135715725 AGGCATTAGCATAGAGCTGACGG - Intergenic
998367154 5:141638941-141638963 CAGCATTGGCTGAGGGAAGAAGG - Exonic
1001313641 5:170628022-170628044 AAGCAGGAGCAGAAGGAAGAGGG - Intronic
1001946902 5:175786754-175786776 AGGCAAGAACAGAGGGAAGGAGG - Intergenic
1002985069 6:2181773-2181795 AGGCCTGAGGAGAGGGAAGAGGG - Intronic
1003429003 6:6022000-6022022 AGGCATGCACAGAGGGAAGATGG + Intergenic
1004407932 6:15351870-15351892 TGTCATCAGCAGAGGGAAGCGGG - Intronic
1004743448 6:18486508-18486530 ATGTGTTAGAAGAGGGAAGATGG + Intergenic
1004856825 6:19759392-19759414 AGGCATTTGCAGAGGAAAATTGG - Intergenic
1006331972 6:33398128-33398150 AGGCCTGACCAGATGGAAGATGG + Exonic
1007637445 6:43307899-43307921 GGGCACAAGCAGAGGGAAGTGGG + Intronic
1008441054 6:51532192-51532214 AGTCTCTAGCAGAGGGAAGTGGG + Intergenic
1009297446 6:61970857-61970879 GGGGAGTAGCAGTGGGAAGAGGG - Intronic
1011268904 6:85555555-85555577 AGGGATTCCCAGAGGAAAGAAGG + Intronic
1011531826 6:88331407-88331429 AGGCATTAAGAGATGGATGATGG - Intergenic
1012442226 6:99271228-99271250 AGGACTCATCAGAGGGAAGAGGG - Exonic
1012734274 6:102919168-102919190 AGGGTTTATCAGATGGAAGATGG + Intergenic
1013650125 6:112186414-112186436 AATCATTAGCTGAGGGAAAATGG - Intronic
1013658060 6:112265936-112265958 AGGAATTAGATGTGGGAAGATGG + Intergenic
1014572711 6:123030389-123030411 AGGCTCTAGCAGGGAGAAGAAGG + Intronic
1015638297 6:135302761-135302783 AGGCAGAAGCAGGGGGAAGAAGG + Intronic
1015955103 6:138590467-138590489 AGGAAGAACCAGAGGGAAGAGGG - Intronic
1020011459 7:4807889-4807911 AGGGAGAAGAAGAGGGAAGAGGG - Intronic
1020530521 7:9328448-9328470 AGACATTAGCAGCTGGAAGGGGG + Intergenic
1021190021 7:17609534-17609556 TGGGACTACCAGAGGGAAGAAGG + Intergenic
1021924804 7:25523943-25523965 AGGCCTGAGCAAAGGGAAGGGGG + Intergenic
1021943044 7:25698526-25698548 AACCAGTAGTAGAGGGAAGAAGG + Intergenic
1022664251 7:32395404-32395426 AGGCATCAGCAGAGGCACAAAGG + Intergenic
1022845893 7:34209495-34209517 TCGCATTGGCAGAAGGAAGAAGG - Intergenic
1022927728 7:35073099-35073121 TGGCATTAGCAGAGCACAGAGGG + Intergenic
1023088075 7:36592326-36592348 AGGCTGTAGCAGAGGGAAGATGG + Intronic
1023498575 7:40824377-40824399 AGGCAAGAACAGAGGGAGGAGGG + Intronic
1023654027 7:42402090-42402112 AGGGATTAGAAAAGCGAAGATGG + Intergenic
1023878820 7:44307236-44307258 GGGTGTGAGCAGAGGGAAGAGGG + Intronic
1023878830 7:44307276-44307298 GGGTGTGAGCAGAGGGAAGAGGG + Intronic
1024010996 7:45266611-45266633 AGGCATACGTAGAGGAAAGATGG - Intergenic
1024259944 7:47566666-47566688 AGGCAGTATCAAAGGTAAGAAGG + Intronic
1025986115 7:66453734-66453756 AGGCTGTAAGAGAGGGAAGAAGG + Intergenic
1026628880 7:72020486-72020508 AGGCAGTCGCAGGGGGAAGAAGG + Intronic
1028671609 7:93407287-93407309 AGCCATTAGGATGGGGAAGATGG + Intergenic
1029034893 7:97509112-97509134 AGGAACTTGCAGTGGGAAGAAGG + Intergenic
1029900279 7:104032011-104032033 AGGCATAAGCAGGGGAAAAATGG + Intergenic
1030463301 7:109868053-109868075 AAGGACTACCAGAGGGAAGATGG + Intergenic
1031868051 7:127061610-127061632 AAGCATCAGCAGGGGGAGGAAGG - Intronic
1031920270 7:127595280-127595302 AGGCATCAGGAGGGAGAAGAGGG - Intronic
1032728137 7:134611288-134611310 TGGATTTAACAGAGGGAAGAAGG - Intergenic
1033200443 7:139363658-139363680 AGTTGTTAGCAGAGGGGAGAGGG + Intronic
1033275339 7:139967397-139967419 AGTCATTGGCCTAGGGAAGAGGG - Intronic
1035242152 7:157539319-157539341 AGGCCCTACCAGAGGGAACACGG - Exonic
1035909404 8:3549062-3549084 AGGCTTCAGCAGAGGGAAGTGGG - Intronic
1035998492 8:4575509-4575531 AGGCATCACCAGAGTGCAGAAGG + Intronic
1036796231 8:11758480-11758502 AGGAATTTGAGGAGGGAAGAGGG - Exonic
1038269862 8:26066342-26066364 AGGCATCAGGAGAGAGAGGAAGG - Intergenic
1038303259 8:26375627-26375649 AAGGATGAGAAGAGGGAAGAAGG - Intergenic
1041048832 8:53913616-53913638 AGGCAGTCATAGAGGGAAGAAGG + Intronic
1041077241 8:54179895-54179917 AGGAAATATCAGAGGTAAGAGGG - Intergenic
1041330480 8:56719109-56719131 GGGCAGGAGGAGAGGGAAGAGGG - Intergenic
1041858865 8:62488323-62488345 CAGAATTAGCAGAGGAAAGAAGG - Intronic
1043781027 8:84335284-84335306 AAACATCAGCAGAGAGAAGATGG - Intronic
1044666634 8:94639959-94639981 AAGCATGAGCAGAGGGAATGGGG + Intergenic
1044983328 8:97736906-97736928 AGTCACTAGGAGAGGAAAGAGGG - Intergenic
1045233291 8:100326700-100326722 AGGTCTTGGAAGAGGGAAGAAGG - Intronic
1045269198 8:100647811-100647833 AGGCATTGGCAGGGGGAGGCAGG - Intronic
1046358083 8:113114360-113114382 AGGAATTTGAAAAGGGAAGAGGG + Intronic
1047325743 8:123834389-123834411 AGGGATTACAAGGGGGAAGAAGG + Intergenic
1047663326 8:127062375-127062397 AGACATGTACAGAGGGAAGATGG - Intergenic
1047998521 8:130358405-130358427 CGGCATGAGCAGAGGGAGGCGGG - Intronic
1048686032 8:136906477-136906499 TGGCACTGGCAGAGGGCAGAGGG + Intergenic
1049224530 8:141443515-141443537 AGGTAATGGGAGAGGGAAGAGGG - Intergenic
1049307438 8:141912273-141912295 AGGCTGTAGCACAGGGAATAGGG + Intergenic
1049314536 8:141956095-141956117 AGGCATTTGGAGGGGTAAGAAGG + Intergenic
1050119074 9:2289377-2289399 GGGCATCAGCAGAGGGAAGCAGG + Intergenic
1050274870 9:3986201-3986223 AGGTATTAGCAGAAGACAGAGGG - Intronic
1050577434 9:7011848-7011870 CGGCATGAGCAGAGTGCAGATGG - Exonic
1050690427 9:8221405-8221427 AGGAAGTAGAAGAGGGAAGGTGG - Intergenic
1050871446 9:10575861-10575883 AGGAATTAGCAGAAAGAAAATGG - Intronic
1051000608 9:12277863-12277885 AGGTATTAGCAGAAGAAATAAGG + Intergenic
1051096058 9:13466447-13466469 AGGCAGTTGCAGAGTAAAGATGG + Intergenic
1052316631 9:27122498-27122520 AGGGATTAAAAGTGGGAAGATGG + Intronic
1052703764 9:31969534-31969556 AGGGATTAGCAGGTGGCAGAGGG - Intergenic
1053151110 9:35743747-35743769 AAGCTTCAGAAGAGGGAAGAAGG + Intronic
1053448988 9:38177630-38177652 GGGCATCTGCACAGGGAAGAAGG - Intergenic
1055124438 9:72702885-72702907 AGGCATTAGCATTGGAAAGAAGG + Intronic
1056285093 9:85079547-85079569 AGGCAGTAGGGGAGGGAGGATGG - Intergenic
1057935999 9:99239459-99239481 AGGGATTTGCACAGTGAAGAGGG + Intergenic
1058257421 9:102785498-102785520 AGGCAATAGCAGAGGTAAAAAGG - Intergenic
1058504961 9:105657493-105657515 ACACATTAGCAGAGAAAAGAAGG - Intergenic
1058718233 9:107740785-107740807 AGGAATTGGCAGAGTGGAGATGG - Intergenic
1059743039 9:117171681-117171703 AGGCAGTAGGAGAGAGAAGAAGG - Intronic
1060701135 9:125748908-125748930 AGGCGAAAGGAGAGGGAAGAGGG - Intronic
1060911662 9:127356016-127356038 AGTCAAGAGCAGAGGGAACAAGG + Intronic
1061077362 9:128349833-128349855 AGGCATTAGCTGCAGGAAGTGGG - Intronic
1061298952 9:129693749-129693771 AGGCCTTGGAAGAGGGACGAGGG + Intronic
1061350998 9:130064784-130064806 AGGCACACACAGAGGGAAGAAGG + Intronic
1185918118 X:4058788-4058810 AGGGAGTGACAGAGGGAAGAAGG + Intergenic
1187402807 X:18976790-18976812 AGGGATCAGGAGAGGGAGGAGGG - Intronic
1188261975 X:28033558-28033580 AGGATTTAGTAGAGGGCAGAAGG + Intergenic
1188800951 X:34528840-34528862 TGGCATTGGCATAGGGGAGAAGG - Intergenic
1189422249 X:40866540-40866562 AGGCATTAACACAGCAAAGAAGG - Intergenic
1192199895 X:69060226-69060248 GGGGCTTAGCAGAGGGAAGGGGG + Intergenic
1192314231 X:70039561-70039583 AGGCAGCAACAGAAGGAAGATGG + Intergenic
1193344606 X:80390239-80390261 AAGCATTAGGAGAGAGGAGAAGG + Intronic
1193955194 X:87851197-87851219 AGGCATTGGCAGTGGGAATCAGG - Intergenic
1195504751 X:105644279-105644301 AGGCATTAGCAAGGGGAAAAAGG + Intronic
1195658874 X:107359349-107359371 AGGCAATGGCAGAGGTTAGATGG + Intergenic
1195683736 X:107567532-107567554 ATGAATTAGCAGAGAGAAGTGGG + Intronic
1195924592 X:110012891-110012913 AGGAAATGGCAGAGGGAGGAAGG + Intronic
1196980864 X:121212146-121212168 GGGCAAGAGCAAAGGGAAGAAGG - Intergenic
1197472022 X:126876090-126876112 AGGCAAAAGCAAAGGGAAAAGGG - Intergenic
1199594787 X:149498023-149498045 AGGGATTTGCACAGGGAAGGTGG - Intronic
1199874549 X:151920241-151920263 TGGGATTGGCAGAGGGAAGCCGG + Intronic
1199903228 X:152198580-152198602 AGTGATTACAAGAGGGAAGAAGG - Intronic
1201281604 Y:12347449-12347471 AGGCACTAGCAGAGGGGGAATGG - Intergenic