ID: 990856356

View in Genome Browser
Species Human (GRCh38)
Location 5:60271572-60271594
Sequence ACTATATAGGGCCTTTTCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 115}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990856356_990856361 11 Left 990856356 5:60271572-60271594 CCAAAGAAAAGGCCCTATATAGT 0: 1
1: 0
2: 2
3: 9
4: 115
Right 990856361 5:60271606-60271628 CCAGAGAAAATATGAGGAGAAGG 0: 1
1: 0
2: 4
3: 40
4: 430
990856356_990856359 5 Left 990856356 5:60271572-60271594 CCAAAGAAAAGGCCCTATATAGT 0: 1
1: 0
2: 2
3: 9
4: 115
Right 990856359 5:60271600-60271622 TGAAAGCCAGAGAAAATATGAGG 0: 1
1: 0
2: 3
3: 51
4: 474

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990856356 Original CRISPR ACTATATAGGGCCTTTTCTT TGG (reversed) Intronic
901907169 1:12423416-12423438 ACTAGGTAGGGCTTTTTGTTTGG - Intronic
903618230 1:24678213-24678235 ACAATATTGGGCCTTTTGTCTGG + Intergenic
906088705 1:43158685-43158707 GCTAAAAAGAGCCTTTTCTTTGG + Intergenic
906833192 1:49056638-49056660 AGATTATAGGGCCTTGTCTTTGG + Intronic
908170289 1:61497571-61497593 ACTTTAGAGGGCCCTTTCTTTGG - Intergenic
909131718 1:71745458-71745480 ACTATATAGAGCCCTGACTTTGG + Intronic
910378896 1:86604049-86604071 ACTATAGAGGTCTTTTACTTTGG + Intergenic
913248289 1:116889732-116889754 ACCATTTAGGGCCTCCTCTTGGG + Intergenic
916090338 1:161303804-161303826 AGTATATATAGCCTTTTGTTGGG - Intergenic
916202031 1:162281291-162281313 TATATACAGTGCCTTTTCTTGGG + Intronic
919188472 1:194184929-194184951 ACTTTGTAGGTCCTTTTCTCTGG + Intergenic
920776941 1:208947985-208948007 AGTTTATAGGGTCTTTTTTTCGG - Intergenic
921405180 1:214771282-214771304 ACTATCCATGGCATTTTCTTTGG + Intergenic
1063887893 10:10598293-10598315 TCTATCAAGGGCCTTTTCTGAGG - Intergenic
1065770924 10:29077790-29077812 ACTTTTTAGGGCCTCTTCTGAGG + Intergenic
1066609797 10:37230716-37230738 ACTATACAGGGTGTTTTCTCAGG - Intronic
1067728744 10:48793701-48793723 ACTATCTATGGCATGTTCTTAGG - Intronic
1071969585 10:90889606-90889628 ACGATGTGGGCCCTTTTCTTTGG + Intronic
1073349867 10:102812104-102812126 ACTATGTAGGGTCTTTTGCTAGG - Intronic
1073559183 10:104482209-104482231 AATATATAGGGCTGTTTCTCTGG + Intergenic
1075297519 10:121291407-121291429 ACTATATAGGGCCTAGTGTCTGG - Intergenic
1075536992 10:123279517-123279539 ACTATGTGGGGACATTTCTTGGG - Intergenic
1083978503 11:66144166-66144188 ACTATATTTAGCCTTTTCTTGGG + Intronic
1087148130 11:94832553-94832575 ACTATCTAGGGCTTTTGCCTGGG + Intronic
1088528427 11:110782224-110782246 ACTATTAAGGGTCTTTTGTTTGG + Intergenic
1091202142 11:133789497-133789519 ACTTTATAGGGCTTTTTCTTTGG + Intergenic
1092709978 12:11325788-11325810 ATTATATAGAGACATTTCTTTGG + Intergenic
1092890877 12:12968140-12968162 ACTTTTTAGAGCCCTTTCTTAGG - Intergenic
1095934998 12:47669473-47669495 ACTATATAGGCAGTTTTTTTTGG - Intronic
1098069763 12:66659878-66659900 ACTATATAAGACCATTTCTGTGG - Intronic
1098594066 12:72250723-72250745 ACTATCTCTGGCCTTTTCTCTGG - Intronic
1099219023 12:79890132-79890154 AAAATGTAGGGCATTTTCTTTGG - Intronic
1101018713 12:100529775-100529797 TCTATACAATGCCTTTTCTTCGG + Intronic
1102327286 12:111997865-111997887 ACCACATATGGCCTTTTCTCTGG + Intronic
1108443709 13:50484489-50484511 ACTATATATGGCTTTTCCTGGGG + Intronic
1109452670 13:62538591-62538613 TCTACTTAGGGCTTTTTCTTAGG + Intergenic
1110053181 13:70931084-70931106 ACTTTATAAGGCCTTTGGTTTGG + Intergenic
1111856635 13:93645955-93645977 ACTGTCGAGCGCCTTTTCTTTGG - Intronic
1114708161 14:24748696-24748718 ACTATCTAGTACCTTTTCATTGG - Intergenic
1115739749 14:36375889-36375911 ACTATCTAAGGCAGTTTCTTTGG + Intergenic
1116143085 14:41025697-41025719 ACTAAAAAGAGTCTTTTCTTTGG + Intergenic
1123937382 15:25200520-25200542 GCTATCTAGGGTCTTGTCTTTGG + Intergenic
1124880170 15:33634770-33634792 ACTAAACAGGTCCTCTTCTTGGG + Intronic
1125057769 15:35382652-35382674 GCAATATAAGGCCTTTCCTTAGG + Intronic
1125227848 15:37415161-37415183 ACTTCATAGAGGCTTTTCTTGGG + Intergenic
1139833819 16:69822241-69822263 TCTCTGTAGGGCATTTTCTTAGG + Intronic
1143869150 17:9945475-9945497 AGTATAAAGGGGCTTATCTTTGG - Intronic
1145036769 17:19546400-19546422 ACTCTATAGGGCCTTATCTTTGG + Intronic
1157316483 18:46594141-46594163 ACTCTATATGGCCTGTACTTTGG + Intronic
1158848024 18:61465147-61465169 AATATCTAGGGCATATTCTTGGG - Intronic
1159266587 18:66088166-66088188 ACTATTTAGGGCCTTTTTTCAGG + Intergenic
1164019862 19:21291383-21291405 ATTATTTATGACCTTTTCTTTGG - Exonic
925454131 2:3999779-3999801 ACTCTAAAGTGCCTTTACTTAGG - Intergenic
926485782 2:13455686-13455708 AATATCTAGCACCTTTTCTTTGG - Intergenic
929309700 2:40408091-40408113 AATATATAGGGCTGTTTCTGTGG - Intronic
935740986 2:106147670-106147692 AATATATAGGGCTTTTACATTGG - Intronic
939660747 2:144886843-144886865 CCTTTATAGGACCTTTGCTTTGG - Intergenic
942236698 2:173916163-173916185 ACAATATAGTTTCTTTTCTTAGG + Intronic
942869473 2:180717476-180717498 AATATATAGGGCTATATCTTAGG + Intergenic
943440688 2:187924121-187924143 AGTATATAGGGCCATTTCTGTGG - Intergenic
945566609 2:211408684-211408706 ACTAGATAGGTCATTCTCTTTGG + Intronic
1175054373 20:56184957-56184979 ACTCTATAGGACCTTTGTTTTGG - Intergenic
1175451506 20:59072591-59072613 CCAATCTAGGGCCTTCTCTTTGG + Intergenic
950865021 3:16181973-16181995 ACTATATAGCGCCCTTTTTTGGG + Intronic
956291607 3:67666634-67666656 AATGTATATGGCCTTTTCTGAGG - Intergenic
956361493 3:68452593-68452615 ACAATATAGGGCATTTTCCATGG - Intronic
956761456 3:72447805-72447827 TCTAAATAGGGCGTTTCCTTAGG + Intergenic
960201941 3:114847555-114847577 ATTATCAAGGGCCTTTTCGTGGG + Intronic
963823811 3:149929720-149929742 ACTATATAGGTTCATTTTTTTGG + Intronic
966678372 3:182613754-182613776 AGTATGTAGGGGCATTTCTTTGG - Intergenic
966702318 3:182868344-182868366 ACTAGATAGGGCCCATTCTTTGG + Intronic
967407174 3:189129884-189129906 TCTATACAGGGCCTTGTGTTAGG + Intronic
967721913 3:192825053-192825075 AATATATTGGGGCTATTCTTGGG - Intronic
968258892 3:197302847-197302869 ACAATCTAGGGCCATTTCATTGG + Intergenic
974685034 4:65216326-65216348 TTTATATAGTGCCATTTCTTTGG - Intergenic
975855392 4:78619032-78619054 ACTTTAGAGGCCCGTTTCTTGGG + Intergenic
976165227 4:82247557-82247579 ACTTTATAGGATCTATTCTTTGG + Intergenic
977828182 4:101558078-101558100 GCTATATGGGCCCTTTTTTTTGG + Intronic
978539810 4:109804584-109804606 GTTATTTAGTGCCTTTTCTTTGG + Intergenic
978895415 4:113880995-113881017 AATATATAGGTACTTTTCATAGG + Intergenic
980451220 4:132974747-132974769 ACTCTGTAGGGTCTTTTCTAGGG - Intergenic
980470921 4:133250521-133250543 ACTATATATGGCCTTTCTTCAGG - Intergenic
983294796 4:165853025-165853047 ACTAAATTGGGCCTAATCTTTGG - Intergenic
985125301 4:186688022-186688044 ACTATATACTGCCTTTTTATTGG + Intronic
990856356 5:60271572-60271594 ACTATATAGGGCCTTTTCTTTGG - Intronic
990885557 5:60587974-60587996 AGTATCTAGAGCCTTTTCTAGGG - Intergenic
991557093 5:67907827-67907849 GCTATATAGGGGCTTTTGTGAGG + Intergenic
993055855 5:82978713-82978735 AATATACAGGGCCTTTCTTTGGG - Intergenic
993088529 5:83394922-83394944 CCTATATAGGGCATTTACCTAGG + Intergenic
993249465 5:85499734-85499756 ACTATATAGGTCCATTTTTGCGG + Intergenic
1004270788 6:14193370-14193392 ACTATAAAGCGCCTTTCCCTAGG + Intergenic
1005141687 6:22639142-22639164 AATATATCTGGACTTTTCTTTGG + Intergenic
1008757391 6:54813072-54813094 ATTATATATGGCCTTTTATGTGG - Intergenic
1009929341 6:70157990-70158012 ACTTTAGCGGGCTTTTTCTTCGG + Intronic
1009996731 6:70904131-70904153 ACTATATGAGGCCTTTTCTCTGG - Intronic
1010734647 6:79429976-79429998 CCTAAATACAGCCTTTTCTTTGG - Intergenic
1012645216 6:101670632-101670654 ACTATATAACGCCTTTCCTTTGG + Intronic
1016773715 6:147880915-147880937 ATTCTCAAGGGCCTTTTCTTGGG + Intergenic
1017538726 6:155377343-155377365 ACTATTTAGGTATTTTTCTTTGG + Intergenic
1024351594 7:48371253-48371275 ACTATACAGGCTCTTTTTTTTGG + Intronic
1027635884 7:80673378-80673400 ACTATATTGTGCCTATTCTTTGG + Exonic
1027762512 7:82297723-82297745 TCTATATAGCACATTTTCTTGGG + Intronic
1028062271 7:86337375-86337397 ACTTTGTAAGACCTTTTCTTTGG + Intergenic
1029332106 7:99866963-99866985 AATATATAGCCCCATTTCTTTGG - Intergenic
1030589686 7:111465392-111465414 ACTATTAAGGACCATTTCTTTGG - Intronic
1031100448 7:117473342-117473364 ACTTTATAGGGTCTTTCCTGAGG + Intronic
1042209703 8:66367652-66367674 ACTAATTAGGGACTTTTTTTTGG - Intergenic
1042683662 8:71414085-71414107 ACTATGTAGGGCCTTCCCTCTGG - Intronic
1042711739 8:71725115-71725137 ACTAGAAAGGCCCTTTTCATAGG + Intergenic
1043776918 8:84281099-84281121 ACTATACAGAGGTTTTTCTTTGG + Intronic
1044542200 8:93420537-93420559 ACTAGTTAGTGCCTTTTCTGAGG - Intergenic
1048055957 8:130865686-130865708 ACTCTATAGAGCTTTCTCTTTGG + Intronic
1050132616 9:2428373-2428395 CCTATGTATGACCTTTTCTTTGG + Intergenic
1052078168 9:24170816-24170838 ACTATATAGGTGCTATTCTGTGG - Intergenic
1053383850 9:37671402-37671424 TCTTTATAGGGCCTTGGCTTTGG + Intronic
1060514269 9:124256152-124256174 ACAAAATATGGCCCTTTCTTGGG - Intergenic
1060684380 9:125594958-125594980 ACTATGTCGGGCCCTTTGTTAGG - Intronic
1061625129 9:131837033-131837055 ACTAACGAGGGCCTTTTTTTTGG - Intergenic
1186999577 X:15161670-15161692 AATATGTAGTGGCTTTTCTTAGG + Intergenic
1187190023 X:17025633-17025655 AATATATAGGTCCTGTGCTTTGG + Intronic
1187268344 X:17757492-17757514 AATATAAAGGGCCCTTTCTATGG - Intergenic
1188294748 X:28433539-28433561 ACTATATATGGGCTTATGTTTGG - Intergenic
1188318437 X:28705772-28705794 TCCATGTTGGGCCTTTTCTTTGG - Intronic
1188696205 X:33194532-33194554 ACTATATCGCATCTTTTCTTTGG + Intronic
1189403810 X:40699260-40699282 ACTATAAATGGACATTTCTTTGG + Intronic
1198668477 X:139051436-139051458 TATATATAGGGGCTATTCTTGGG - Intronic
1199323794 X:146473036-146473058 ACAATATACGGCCTTTGTTTTGG + Intergenic