ID: 990856667

View in Genome Browser
Species Human (GRCh38)
Location 5:60274893-60274915
Sequence GTCACAGATGCTAATACTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 116}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990856667 Original CRISPR GTCACAGATGCTAATACTGC TGG (reversed) Intronic
905725118 1:40244961-40244983 GTCACAGAAGCCACTCCTGCAGG - Intergenic
908000939 1:59678273-59678295 GTCACAGAGGTCAAGACTGCAGG - Intronic
913696002 1:121326361-121326383 CTCAGAGATGCTTATACTGAAGG + Intronic
914141563 1:144953698-144953720 CTCAGAGATGCTTATACTGAAGG - Intronic
918465887 1:184821083-184821105 GTCACAGATGCTGAGACAGAAGG - Intronic
919616914 1:199819395-199819417 GTGACAGATGATAAGACTACAGG + Intergenic
919994629 1:202737384-202737406 GTTGCCGATGCTAATACTGCTGG + Intronic
920356681 1:205378479-205378501 GCCTGAGATGCTGATACTGCTGG + Intergenic
920483328 1:206344729-206344751 CTCAGAGATGCTTATACTGAAGG + Intronic
921343283 1:214155604-214155626 GGCACAGAAGTTAATACTGAAGG - Intergenic
924569481 1:245225329-245225351 GCCACAGATACTAATACTATGGG - Intronic
1064165462 10:12981668-12981690 GGCACAGGTGCTATTACTGAGGG + Intronic
1065389684 10:25169874-25169896 TCCAGTGATGCTAATACTGCTGG - Intergenic
1067420540 10:46141727-46141749 GTGACAGATGCACACACTGCAGG - Intergenic
1067425481 10:46207806-46207828 GTGACAGATGCACACACTGCAGG + Intergenic
1067505883 10:46848193-46848215 GTGACAGATGCACACACTGCAGG - Intergenic
1068249016 10:54411818-54411840 GTCAGAGAGACTAATACTGAGGG + Intronic
1071472586 10:85994296-85994318 CTCACAGATGCTGACACTGTGGG - Intronic
1071894572 10:90051559-90051581 GTAACAGATGCTCTGACTGCTGG + Intergenic
1072771487 10:98143461-98143483 GTCACAGTGACTAATACTGGAGG - Intronic
1074533669 10:114313533-114313555 GTTAAAGATGCTAATAGTCCTGG + Intronic
1080298656 11:30759136-30759158 GTCACAGAGGCTGATACTCTTGG + Intergenic
1081092621 11:38891591-38891613 TTCACAAATGGTAATATTGCTGG - Intergenic
1082724084 11:56714361-56714383 GTTACAGGTGGTAATACTGGAGG + Intergenic
1083232152 11:61329537-61329559 GTCAATGATGCCAATAATGCCGG + Exonic
1088583460 11:111336726-111336748 GTCTCAGAGGCTAACACAGCTGG + Intergenic
1097477990 12:60083298-60083320 GTCTCAGTGGCAAATACTGCTGG + Intergenic
1098326925 12:69312657-69312679 GTCACAGATCCTAGCACTGTGGG + Intergenic
1102202266 12:111065685-111065707 TTCTCACATGGTAATACTGCTGG - Intronic
1103518569 12:121523099-121523121 TTCACAGATGCTGAAACTGAGGG + Intronic
1106706658 13:32287741-32287763 GTGAGCAATGCTAATACTGCTGG + Intronic
1107245086 13:38284200-38284222 GTCAGAAATGCAAATACTGTTGG - Intergenic
1108489232 13:50963741-50963763 GTCATGTATGCTAATACTGAGGG - Intronic
1112378123 13:98862813-98862835 CTCACAGCTGCTGATGCTGCAGG - Intronic
1113446953 13:110376667-110376689 AGCACAGATGCTAGTTCTGCAGG + Intronic
1116456818 14:45129162-45129184 ATCACTGATACTAAGACTGCTGG + Intronic
1119169076 14:72519194-72519216 CTCACAGATGCTAGTGATGCTGG + Intronic
1119851825 14:77871703-77871725 GGCACAGATGCAAATCCTGGGGG + Intronic
1121024754 14:90607342-90607364 CTCACGGATGCTAACACTGCAGG + Intronic
1121771387 14:96545429-96545451 GTCACCAATGCTAACGCTGCTGG - Intronic
1126260934 15:46690423-46690445 GTCCCAGATGCTGATTCTGTAGG + Intergenic
1128548360 15:68582133-68582155 GGCACAGCTGCTAAAGCTGCCGG + Intronic
1128796210 15:70468634-70468656 TTCACAGGTGCAAGTACTGCTGG + Intergenic
1128850237 15:70947638-70947660 CCCAGTGATGCTAATACTGCTGG - Intronic
1132026723 15:98410090-98410112 GTCTCAGATGGTAACACTGAGGG - Intergenic
1133324253 16:4933908-4933930 GTCACAGATGCTATTACCTGCGG + Intronic
1133847589 16:9469724-9469746 CTGACAGAAGATAATACTGCAGG + Intergenic
1133878310 16:9756434-9756456 GTCACAGAGGCTGATACTCAAGG + Intronic
1137518802 16:49173995-49174017 GTCACATCTGGTAATGCTGCAGG + Intergenic
1138536231 16:57661832-57661854 GTCACATGTGCTGACACTGCTGG + Exonic
1140579017 16:76206662-76206684 GTCATGGATGCTAAAACTGAAGG + Intergenic
1140871530 16:79111078-79111100 GTCACAGATGCTTTCACTGAAGG + Intronic
1143425665 17:6835153-6835175 GACACAGATCCCAATACTACTGG - Intergenic
1144032035 17:11331941-11331963 TTCACAGATGCTCACACTGCCGG + Intronic
1150582321 17:66485653-66485675 GTCTCAGATGTCCATACTGCCGG + Intronic
1153416078 18:4847248-4847270 GTAACAGATGGTAGTAATGCAGG - Intergenic
1159030262 18:63223503-63223525 ATCACAACTGCTAATACTGGAGG + Intronic
1159085088 18:63781088-63781110 GTCACAGTTGCAAATACTTAAGG - Intronic
1160686951 19:441350-441372 GCCACAGATGCACACACTGCTGG + Intronic
929055649 2:37874113-37874135 GTCCCAGATACTAACACTGCTGG - Intergenic
929626499 2:43414164-43414186 GTCACAGTTGCAAATACAGTTGG - Intronic
930063711 2:47311544-47311566 GTCACAGATGCTCTAGCTGCAGG + Intergenic
933544755 2:83695771-83695793 GTCACAGATACTGATACAGAAGG - Intergenic
935101340 2:99998647-99998669 GACACAGATGCTATTCCTGAAGG + Intronic
936229753 2:110689684-110689706 CTCACAGATGTTTATACAGCTGG + Intergenic
936287310 2:111190739-111190761 GCCACAGTTACTAAAACTGCAGG - Intergenic
937264018 2:120604867-120604889 GTCAGAGATGCTAATAGTGTGGG + Intergenic
941125889 2:161582418-161582440 TTTACAGATACTAATACTGAAGG - Intronic
943980029 2:194538442-194538464 CACACAGATGCTAATACTAGTGG - Intergenic
945370452 2:209009810-209009832 TTCACAGATGGTGGTACTGCAGG + Intergenic
945885895 2:215375213-215375235 GTCACAGAGGCTACTATTACTGG - Exonic
947575013 2:231266297-231266319 TCCAGTGATGCTAATACTGCTGG + Intronic
947781560 2:232769950-232769972 ATCAAAGCTACTAATACTGCTGG + Intronic
1172449636 20:35012862-35012884 GTCACACCTGCTAACACTGAGGG + Intronic
1174038178 20:47680873-47680895 GTCACAGCTTCTAATTCTGTAGG + Intronic
1177189199 21:17831040-17831062 GTCAGCTATGCAAATACTGCAGG + Intergenic
1179100781 21:38354164-38354186 TTCACAGATGGTAATAGTGCTGG + Intergenic
951638401 3:24805821-24805843 GTCTCAGATGCTGCTACTGAGGG + Intergenic
952352179 3:32550794-32550816 TCCAGAGATGCTGATACTGCTGG + Intronic
960710573 3:120523685-120523707 GTCAAAGAAGGTAATACAGCCGG + Intergenic
961338130 3:126197456-126197478 GTCATAAATGGTAATATTGCAGG - Intronic
961434108 3:126904749-126904771 CTCACAAATGCCAATACTTCTGG + Intronic
961667170 3:128499711-128499733 TCCACAGGTGGTAATACTGCAGG - Intergenic
965757810 3:172042112-172042134 TTAAAAGATGCTAAAACTGCAGG + Intronic
966072604 3:175896776-175896798 GTGGCAGAGGCTCATACTGCTGG - Intergenic
976986016 4:91298948-91298970 TTCACAGATGCTGCTGCTGCTGG - Intronic
978530664 4:109709184-109709206 TTCTCAGATGATGATACTGCTGG - Intergenic
979341506 4:119529912-119529934 TTCCCAGATGCTGATGCTGCTGG - Intronic
981791663 4:148544554-148544576 GTCAAAGATGCAAATGATGCAGG - Intergenic
981995049 4:150964977-150964999 ACCACAGCTGCTAATACTGTTGG + Intronic
990856667 5:60274893-60274915 GTCACAGATGCTAATACTGCTGG - Intronic
991013212 5:61905267-61905289 GGCACAGCTGCTGCTACTGCTGG - Intergenic
992457482 5:76929065-76929087 GGCTCAGATTCTAATACTGAAGG - Intergenic
997201504 5:132012501-132012523 GCCACAGATGCCCACACTGCTGG + Intergenic
1003411160 6:5864016-5864038 GTCACACATGCTCATGCTGTGGG + Intergenic
1010991615 6:82485750-82485772 TTCACCCATGCTAACACTGCAGG - Intergenic
1014184148 6:118416244-118416266 GTCCCAGATTCTAATGCTGGTGG - Intergenic
1014612608 6:123562515-123562537 CTCACAGATACCAAAACTGCTGG + Intronic
1021873955 7:25031278-25031300 GTTACAAATGCAAATACTGAAGG + Intergenic
1022488563 7:30799422-30799444 GTGACAGATGCTCATACTCAGGG - Intronic
1022557749 7:31316807-31316829 ATCACATATGCTGATGCTGCAGG + Intergenic
1023210473 7:37798658-37798680 GTCATAGGTGCTACTGCTGCTGG - Intronic
1031014180 7:116554978-116555000 TTTACAGATGAGAATACTGCCGG - Intronic
1031388356 7:121181136-121181158 GTGAGAGATGATCATACTGCAGG + Intronic
1033353960 7:140584528-140584550 GTTACAAATGCTAGTCCTGCAGG + Intronic
1033593303 7:142833250-142833272 GTAACAGATTCTAACACCGCAGG - Intergenic
1034973970 7:155437205-155437227 GACACAGTTCCTAATAATGCGGG + Intergenic
1035238465 7:157515452-157515474 GTGACAGACGCTGATACTGCTGG + Intergenic
1039380513 8:37080598-37080620 GCCACATATGCTAAAGCTGCCGG + Intergenic
1046137461 8:110048028-110048050 GTGACAGATGACAATGCTGCAGG + Intergenic
1046166549 8:110443781-110443803 GTCTCCTTTGCTAATACTGCAGG - Intergenic
1047028529 8:120850935-120850957 CTCAAAGATGCTTACACTGCTGG - Intergenic
1048577025 8:135701006-135701028 CTCACAGATCCTAGTGCTGCAGG - Intergenic
1050128082 9:2380225-2380247 GTCAGAGATGATATTACTCCAGG - Intergenic
1051680921 9:19607242-19607264 GTCACAGATGCAATTACTTGGGG - Intronic
1059573948 9:115470067-115470089 ATCACAGATGTTAACAGTGCTGG + Intergenic
1060726156 9:126007220-126007242 GGGACAGATTCTAATGCTGCTGG - Intergenic
1192266224 X:69539748-69539770 TTCACAGATACTAAGACTGTAGG + Intergenic
1193085370 X:77444168-77444190 GACAGTGATGCTAATAATGCTGG - Intergenic
1193847460 X:86492084-86492106 GTCACAGAGACAAATACTGCAGG - Intronic
1194128206 X:90046104-90046126 GTCAAAGATACTAAAAATGCAGG + Intergenic
1194349099 X:92803497-92803519 GAGAAAGATGCTAATATTGCTGG - Intergenic
1194647631 X:96477303-96477325 GCAACAGAGGCTAAAACTGCTGG - Intergenic
1198546971 X:137702426-137702448 GTCACAGAGGCTAATGCTGCTGG - Intergenic
1200383660 X:155866322-155866344 ATCACAGATGAGAATACTTCAGG + Intergenic
1200657425 Y:5920101-5920123 GAGAAAGATGCTAATATTGCTGG - Intergenic