ID: 990863428

View in Genome Browser
Species Human (GRCh38)
Location 5:60353506-60353528
Sequence TATGAGATTTAGTAGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 240
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 220}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990863428_990863434 24 Left 990863428 5:60353506-60353528 CCTTCCACCTACTAAATCTCATA 0: 1
1: 0
2: 1
3: 18
4: 220
Right 990863434 5:60353553-60353575 AACTAAAGGATGCTTCACAAGGG No data
990863428_990863433 23 Left 990863428 5:60353506-60353528 CCTTCCACCTACTAAATCTCATA 0: 1
1: 0
2: 1
3: 18
4: 220
Right 990863433 5:60353552-60353574 CAACTAAAGGATGCTTCACAAGG No data
990863428_990863432 10 Left 990863428 5:60353506-60353528 CCTTCCACCTACTAAATCTCATA 0: 1
1: 0
2: 1
3: 18
4: 220
Right 990863432 5:60353539-60353561 TCTGAACTCATGTCAACTAAAGG 0: 1
1: 0
2: 1
3: 12
4: 117
990863428_990863435 30 Left 990863428 5:60353506-60353528 CCTTCCACCTACTAAATCTCATA 0: 1
1: 0
2: 1
3: 18
4: 220
Right 990863435 5:60353559-60353581 AGGATGCTTCACAAGGGTTCTGG 0: 1
1: 0
2: 1
3: 10
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990863428 Original CRISPR TATGAGATTTAGTAGGTGGA AGG (reversed) Intronic
900747782 1:4373015-4373037 TGTGGGATTGAGTAGGTGGAAGG - Intergenic
902689567 1:18101778-18101800 TATGAGAATTACTGGGTGGGTGG - Intergenic
905692080 1:39950882-39950904 TATCAGATCTCATAGGTGGAGGG + Intergenic
906353620 1:45084388-45084410 TATGAGATTTAGAAGGGGCCAGG - Intronic
906376027 1:45297369-45297391 TATGATATTTAGGTGGTGGGAGG + Intronic
906862554 1:49377337-49377359 TATCAGCTTCAGTAGGTTGATGG - Intronic
907315538 1:53568516-53568538 CATGAGATTTGGGAGGTGCAGGG + Intronic
907729101 1:57048651-57048673 TTTCAGAGTTAGTAGGTGGGGGG + Intronic
908054564 1:60269532-60269554 TCTGATATTTAGTAGCTGGGGGG - Intergenic
908870571 1:68606364-68606386 AATGATATTTAGTAGGTGGATGG + Intergenic
909521454 1:76573339-76573361 AATGAGATTTGTTACGTGGAAGG - Intronic
909801912 1:79820583-79820605 TGTGATATTTAGAAGATGGAGGG + Intergenic
909959708 1:81824763-81824785 TCTGAAGTTTATTAGGTGGAGGG + Intronic
910357456 1:86376893-86376915 CATGAGATTTAGGAGGGGCAAGG - Intronic
910512784 1:88025150-88025172 TATGAGATTTGGGAGGTGCTGGG - Intergenic
911902293 1:103522076-103522098 TATTAGATTTAGTAACTGGGAGG + Intergenic
912180393 1:107212113-107212135 TATGAGAACTAGAAGGTGTAGGG + Intronic
912610243 1:111035046-111035068 TATGAGATTTGGGAGGTGCCAGG + Intergenic
913137168 1:115903039-115903061 TATTAGATTTAGTAGGATTAGGG + Intergenic
915314633 1:155021431-155021453 TATGAAATCAAGTAGGGGGATGG - Intronic
915398432 1:155604243-155604265 TTTGGGATTTGATAGGTGGAAGG - Intergenic
915415867 1:155742365-155742387 TTTGGGATTTGATAGGTGGAAGG - Intergenic
916462128 1:165036225-165036247 TTTGAGATTTGGGAGCTGGAAGG + Intergenic
920349309 1:205327448-205327470 TCTGAGAGTTGGGAGGTGGAGGG + Intergenic
920490660 1:206412075-206412097 TAGGAGAGTTAGTAAGTGGTAGG + Intronic
920698477 1:208199913-208199935 TCATAGATTTAGTAGCTGGAGGG - Intronic
920749074 1:208657189-208657211 TCTCAGATTTAGTTGGTGGGAGG + Intergenic
921014897 1:211180312-211180334 TATGTCCTTTAGTAGGTGAATGG - Intergenic
921245799 1:213238449-213238471 TATATGATTCAGTAGATGGAGGG + Intronic
923139713 1:231151050-231151072 CATGAGATTTGGGAGGTGGCAGG - Intergenic
923461325 1:234211848-234211870 TATGAGATTTGGGAGGTGCCAGG + Intronic
924050940 1:240078939-240078961 TATGAGATTTGGGAGGGGCAAGG + Intronic
924177845 1:241410999-241411021 TGTGAGGTTTAGAAGGTAGAGGG - Intergenic
1063818248 10:9802511-9802533 TATGATATTGAGTATGGGGAAGG - Intergenic
1064125257 10:12654068-12654090 TATGAGGATAAGTAAGTGGAAGG - Intronic
1065229241 10:23580027-23580049 TTTGAGATTTAGAAGGCAGAAGG - Intergenic
1065534334 10:26702291-26702313 TATGAGATTTGGGAGGAGCAAGG + Intronic
1066471880 10:35706564-35706586 TATGAGGTTTAATACCTGGATGG - Intergenic
1067796270 10:49324385-49324407 TATGAGAACAAGGAGGTGGAAGG + Exonic
1068314617 10:55323847-55323869 CATGAGATTTAGGAGGTGTTGGG + Intronic
1071952062 10:90714665-90714687 TATTAGATTTTGGAGGTGGGTGG - Intergenic
1072617523 10:97059598-97059620 TGTGACATCTAGGAGGTGGAGGG - Intronic
1074295894 10:112188905-112188927 TATGAGGTTTAGTATGAGAAAGG - Intronic
1074947097 10:118290837-118290859 CAAGAGATTGAGTAGGTGGAAGG + Intergenic
1081276273 11:41153019-41153041 TATGAGATGGAGTTGGTGGTAGG - Intronic
1081813154 11:45924373-45924395 TTTGCGCTTCAGTAGGTGGAGGG - Intronic
1087096373 11:94322825-94322847 CATGAGGTTTGCTAGGTGGAGGG + Intergenic
1087118339 11:94546091-94546113 TATGAGATTTGGAAGCTGCACGG - Exonic
1087551492 11:99656297-99656319 TTTGAAATTAAGAAGGTGGAGGG - Intronic
1087813084 11:102629942-102629964 TATAAGAATTGGTAGGTGTAAGG - Intergenic
1090224035 11:125057934-125057956 TATGAGGTTTAGTTGGAGCAGGG + Intergenic
1090698500 11:129272898-129272920 TAATTGATTTAGTAGATGGAAGG - Intronic
1090987383 11:131780832-131780854 TATGAAATTTAATGGGTGGGTGG - Intronic
1091111517 11:132973282-132973304 TAAGTGATTTTGGAGGTGGAAGG - Intronic
1091758048 12:3068261-3068283 CATCAGATTTAGTAAGTTGAAGG - Intergenic
1093057006 12:14566046-14566068 TAAGTGTTTTTGTAGGTGGAGGG - Intronic
1093676721 12:21949600-21949622 TATGACATTTATTATGTTGAGGG - Intergenic
1094654121 12:32404536-32404558 TCTGAAATTTACTAGGTGCAGGG - Intronic
1095746342 12:45663299-45663321 TAAAAGATTTAATAGGTAGAAGG + Intergenic
1097571161 12:61334458-61334480 TATGAGATTTAGGAGGATCAAGG - Intergenic
1098664327 12:73141595-73141617 TTTGAGATTTAGTTGATGGCAGG - Intergenic
1098792196 12:74837667-74837689 TATGAGATTTGGGAGGGGCAAGG + Intergenic
1099800676 12:87452467-87452489 CATGAGATTTAGGAGGTGCCAGG + Intergenic
1102003739 12:109575195-109575217 TAAGACATTTAGAAGTTGGAAGG + Intronic
1103966094 12:124640664-124640686 CATGAGACGTAGGAGGTGGATGG - Intergenic
1106034041 13:26027777-26027799 TTGTAGCTTTAGTAGGTGGAAGG - Intergenic
1106807113 13:33321164-33321186 AATCAGGTTTACTAGGTGGAGGG - Intronic
1107264673 13:38538952-38538974 TATGATACTTAGAAGGTGCACGG + Intergenic
1108215659 13:48181768-48181790 GATGAGATTTAGTAGGTCTCGGG - Intergenic
1108971301 13:56380522-56380544 CATGAGATTTAGAAGGAGGCAGG - Intergenic
1110011887 13:70346324-70346346 TGTGTGTTTTAGTTGGTGGAGGG - Intergenic
1111319993 13:86614678-86614700 CATGGGAGTTAGAAGGTGGAAGG - Intergenic
1112493319 13:99885909-99885931 TGAGAGATTTAGCAAGTGGAAGG + Intronic
1112742501 13:102490994-102491016 TATAAGAATTAGAAGGTGGTAGG - Intergenic
1115725775 14:36214876-36214898 TATCAGATTTAAAGGGTGGAGGG - Intergenic
1116148719 14:41109468-41109490 TATAAAATTCAGTAGATGGATGG - Intergenic
1116343676 14:43759715-43759737 TGTGAAATTTACTAGGTGCAAGG - Intergenic
1116793396 14:49363888-49363910 TGTGAGATTTAGGGGGAGGATGG - Intergenic
1117402201 14:55368669-55368691 TATGGGATTGAGTAGGTGGCAGG - Exonic
1118182758 14:63509624-63509646 GATGAGAATGAGTAGGAGGAGGG - Intronic
1121165488 14:91792309-91792331 TTTTAGAATTAGTTGGTGGATGG - Intronic
1123714656 15:23018511-23018533 TATGAGATTGAGTTGAAGGAAGG + Intronic
1127475798 15:59331679-59331701 AATGAAATTTAGATGGTGGAAGG - Intronic
1131801134 15:96070545-96070567 AATGAGATTTAGTATGGGGCTGG + Intergenic
1134171917 16:11976109-11976131 AAGGAGATTGAGGAGGTGGAGGG - Intronic
1134285772 16:12860894-12860916 TATCAGACTTAGTAGGTTTAGGG - Intergenic
1134897527 16:17902318-17902340 TATGAAACTAAGTAGCTGGATGG - Intergenic
1137924288 16:52525185-52525207 GATGATATTTTGTGGGTGGAGGG + Intronic
1138754913 16:59472004-59472026 TTTGAGTTGTTGTAGGTGGAAGG + Intergenic
1144587115 17:16493516-16493538 TATGAGATTTTGCAGTTGCAGGG + Intergenic
1148019842 17:44546460-44546482 TTTGAGATTTGGAAGGTGGAAGG - Intergenic
1149462701 17:56844519-56844541 TATTTGATTTAGTAGGTATAGGG + Intronic
1151118895 17:71770296-71770318 TCTGAGTTTTAGTAGGAGAAAGG + Intergenic
1154303332 18:13213514-13213536 TGTGAGATTTGGAAGGAGGAAGG - Intergenic
1155752884 18:29451631-29451653 GATGTCCTTTAGTAGGTGGATGG + Intergenic
1155764180 18:29606362-29606384 TATGAGATTTAGGAGGGGCCAGG + Intergenic
1155776061 18:29763167-29763189 TATGAGATTTTTTAGTTGGGGGG + Intergenic
1157145352 18:45157065-45157087 AATGAGATTTCGTAGGAGGGCGG - Intergenic
1159861842 18:73659018-73659040 TCTCAGATGTAGTAGGCGGAGGG + Intergenic
1163230192 19:15996533-15996555 CATGAGATTTAGGAGGGGGCAGG + Intergenic
925436240 2:3840298-3840320 TATGAGATTTAGGAGGTGACAGG - Intronic
926315187 2:11704532-11704554 AACTAGATTTAGTATGTGGAAGG - Intronic
928021742 2:27710691-27710713 TTTGAGATTTAGTAAGTGCTGGG - Intronic
930440845 2:51403515-51403537 TATGAGATTTGGTAGGGGCCAGG - Intergenic
930942026 2:57025121-57025143 CATGAGATTTAGGAGGGGCAAGG - Intergenic
931886087 2:66618841-66618863 TATGAGATTTTTTTGGGGGAGGG + Intergenic
932058748 2:68473392-68473414 GATGACCTTTAGTAGGTGAATGG - Intronic
932265049 2:70360746-70360768 AATGAGATTTATTTGGGGGAAGG + Intergenic
934625578 2:95847609-95847631 GATGTGATTTATTTGGTGGATGG - Intronic
935281057 2:101518276-101518298 GATGAGATTTGGTCAGTGGAGGG - Intergenic
939663257 2:144917357-144917379 TAAGAGATTTAGAAGGTGGCTGG + Intergenic
941057534 2:160806153-160806175 TATGAGATTTGGGAGGAGGCAGG - Intergenic
941468813 2:165860118-165860140 CATGAGATTTAGGAGGGGCAAGG - Intronic
943122965 2:183760472-183760494 TATGAGATTTGGAAGGTGAAAGG + Intergenic
943590247 2:189787136-189787158 GATGATATTTAGAAGGTAGATGG + Intronic
944475547 2:200101166-200101188 TATGAGAGTTTGTAGGTTGTAGG - Intergenic
944982295 2:205135154-205135176 GATAAGATATAGTAGGTGGTTGG - Intronic
945660378 2:212678382-212678404 TATGGGATTTGGAAGGCGGAAGG + Intergenic
1168820411 20:769085-769107 TCTGACATTTTGAAGGTGGAAGG + Intergenic
1170663673 20:18366416-18366438 TATTAGATTTAGTGGGTGGGGGG - Intergenic
1172509001 20:35486649-35486671 TTTGCGATTTCGTAGCTGGAGGG + Intronic
1172832640 20:37849047-37849069 TATGAGATGTGGGAGGTGGAGGG - Intronic
1173101250 20:40090976-40090998 CATGAGATTTGGTAGGTGCCAGG - Intergenic
1174217353 20:48926935-48926957 TACGAGATTTAGGATGTGGATGG + Intronic
1177238329 21:18422850-18422872 TGTGAGGGTTAGCAGGTGGATGG + Intronic
1177479515 21:21668897-21668919 CATGAGATTTGGGAGGGGGAGGG - Intergenic
1177552500 21:22643869-22643891 TCTCAGATTTAGTATGTGGATGG - Intergenic
1178689617 21:34740330-34740352 TATGTGGTTTGGTGGGTGGATGG - Intergenic
1179255494 21:39712072-39712094 TATGGGATTCAGTGGCTGGAAGG - Intergenic
1179678078 21:42998400-42998422 TATGAGATTTGGGAGGGGGCAGG - Intronic
1181877685 22:25952801-25952823 TAAGTGGTTGAGTAGGTGGACGG - Intronic
1182385035 22:29931214-29931236 AATGAGATATAGTCAGTGGAAGG + Intronic
949604223 3:5635876-5635898 CATGAGTTATAGTAGATGGAGGG + Intergenic
952352234 3:32551391-32551413 CATGAGATTTAGGATGTGAAGGG + Intronic
952434031 3:33254590-33254612 TATGTCATTCAGTAGGTGAATGG + Intergenic
952685194 3:36139543-36139565 TATGAGATTCAGCAAGAGGAAGG + Intergenic
954040254 3:47880887-47880909 TATGAGATTTTGTTGTTTGATGG + Intronic
955136304 3:56222209-56222231 TATGAGATATACTGGTTGGAAGG + Intronic
956833966 3:73080551-73080573 AATGAGAAGTAGAAGGTGGAGGG - Intergenic
957870767 3:86088690-86088712 TATGAGATTTAGGAGGGGGCAGG - Intergenic
959448456 3:106468800-106468822 TATTAGATTAAGTTGATGGAAGG - Intergenic
959693225 3:109221619-109221641 GTTTAGATTTATTAGGTGGAAGG - Intergenic
959809110 3:110594418-110594440 CATGAGATTTAGCAGGGGGTAGG + Intergenic
963724345 3:148903075-148903097 TATGAGACTAAGTTGGGGGAAGG + Intergenic
964378371 3:156072106-156072128 TTTGAGATTTAATATTTGGAAGG + Intronic
965679100 3:171231903-171231925 TTTGTGATTTAGGAGCTGGATGG - Intronic
966545977 3:181148882-181148904 TATGTCCTTTAGTAGGTGAATGG + Intergenic
968924909 4:3542025-3542047 TATAAGAATTGGTAGGTGAATGG + Intergenic
969501647 4:7556935-7556957 TATGTGAGTGAGTGGGTGGATGG - Intronic
970230150 4:13901430-13901452 TGTGAGTTTGAGTGGGTGGAAGG + Intergenic
971815184 4:31477609-31477631 TATGAGATTTAGGAGGGGTCAGG + Intergenic
972775416 4:42235323-42235345 TATGAGAGGTAGTAAGAGGAAGG + Intergenic
973932482 4:55806994-55807016 TATGAGATAAAGAAGGTAGAGGG + Intergenic
974742145 4:66021164-66021186 CATGAGATTTGGGAGGTGGCAGG - Intergenic
975243477 4:72090705-72090727 TATGAGATTTAGAAGCTTTATGG + Intronic
975931394 4:79527922-79527944 TCTGAGATTTAGACTGTGGAAGG - Intergenic
975989313 4:80240689-80240711 TATGGCATTTAGTAGGTAGAGGG + Intergenic
977621152 4:99138944-99138966 GATTAGAATTAGTGGGTGGAAGG + Intronic
977766323 4:100802451-100802473 TATGAGTTTTAGCAAGTGTATGG - Intronic
977988664 4:103415747-103415769 TATGAGATCTTGCTGGTGGAAGG + Intergenic
978002450 4:103573009-103573031 TTTGAGTCTTAGAAGGTGGATGG + Intergenic
983561775 4:169108838-169108860 TCTAAGCTTTAGTAGGTGTAGGG - Intronic
985230905 4:187815363-187815385 TAGAACATTTAGTAGGAGGAAGG - Intergenic
986379421 5:7168438-7168460 AATAAGATGTAGTTGGTGGAAGG - Intergenic
986482809 5:8205626-8205648 TTGGAGATTTAGTGGTTGGAAGG + Intergenic
986627242 5:9733670-9733692 TGTGAGATTTATTAGGAGGTCGG - Intergenic
987287346 5:16469826-16469848 TATGAGATTTAATTGGTTCAGGG - Intergenic
989786967 5:45344348-45344370 CATGAGATTTGGTAGGGGGCAGG - Intronic
990193125 5:53284063-53284085 TATTAGATGTAGTTGGTTGATGG + Intergenic
990863428 5:60353506-60353528 TATGAGATTTAGTAGGTGGAAGG - Intronic
991247541 5:64524075-64524097 TATATGATTTAGTAGCTGGTAGG + Intronic
991940705 5:71849672-71849694 TATGAGATTTGAGAGGGGGAGGG - Intergenic
992738889 5:79753011-79753033 TTGGAGATTGAGGAGGTGGAAGG + Intronic
994796886 5:104314733-104314755 AATGAGATTTTGCAGGTGAAAGG + Intergenic
996222501 5:120950579-120950601 TATGAGATTTAGGAGGGGCCAGG + Intergenic
997778479 5:136632954-136632976 TTTGAGATCTAATAGGTGGTTGG + Intergenic
998754203 5:145358256-145358278 TATGAGAGGGAGGAGGTGGATGG + Intergenic
1000340192 5:160271035-160271057 ATTAAGATTTAGGAGGTGGAGGG + Intronic
1000768222 5:165318450-165318472 TATGAGATTTAGGAGGTGCCGGG - Intergenic
1001193751 5:169653527-169653549 TAGGAGATTTACCAGGAGGAAGG - Intronic
1001411661 5:171516572-171516594 TATGAGAGTGAATAGGTGCATGG + Intergenic
1003723558 6:8733494-8733516 CATCAGATTTAGAAGGGGGAGGG + Intergenic
1005203756 6:23377439-23377461 TTTGAGATTCAGTGGATGGATGG + Intergenic
1005217937 6:23553948-23553970 TATGAGATTTGGGAGGTGCTGGG - Intergenic
1007028039 6:38598139-38598161 AATGAGAGTTAGTTGGGGGAGGG + Intronic
1007856541 6:44864050-44864072 TATGAGATTTGGCAGGGGGCAGG - Intronic
1009699844 6:67161660-67161682 TATGAGATATGGGAGGTGGCAGG + Intergenic
1010674146 6:78721415-78721437 TATGAGATTTAGGAGGGGCCAGG + Intergenic
1011166463 6:84452954-84452976 TATGAGAGGTAGCTGGTGGAGGG - Intergenic
1011477679 6:87763931-87763953 TACCAGATTTAGTGGGTGGTTGG + Intergenic
1012019818 6:93904736-93904758 CATGAGATTTTGGAGGGGGAAGG - Intergenic
1015074777 6:129142518-129142540 TATGAATTTTAGTAGGGGGGAGG + Intronic
1015477531 6:133670483-133670505 CATGAGATTTAAGAGGTGGAAGG + Intergenic
1015662204 6:135588548-135588570 CATGAGATTTGGGAGGTGCAGGG - Intergenic
1017342153 6:153336372-153336394 TATGAGATTTGGGAGGTGCCAGG + Intergenic
1017367928 6:153667134-153667156 TAAGTGCATTAGTAGGTGGACGG - Intergenic
1018009233 6:159654780-159654802 TCTGAGATTTACTTGGTTGATGG + Intergenic
1019489554 7:1305844-1305866 GATGAGATTGGGTAGATGGATGG - Intergenic
1021036738 7:15809258-15809280 TATGAGATTTGGGAGGAGGCAGG - Intergenic
1022416924 7:30186715-30186737 GATGAGATTTGGTAGGGGCAAGG - Intergenic
1024168531 7:46759730-46759752 TCTGGGTTTTGGTAGGTGGATGG - Intronic
1030253138 7:107472196-107472218 TATGAGATTTAGTTGGCTGATGG - Exonic
1030301057 7:107975487-107975509 TGTGAGATTTAGAGGGAGGAAGG - Intronic
1030600999 7:111592040-111592062 TATGAAATTTTGGAGGTGAAAGG + Intergenic
1030690165 7:112524195-112524217 AATCAGATTTAGTAGGTCTAGGG + Intergenic
1031516370 7:122703833-122703855 TAACAGATTTAGTAACTGGAAGG + Intronic
1033705881 7:143884695-143884717 CATGAGATTTGGTGGGGGGAAGG + Intronic
1038449801 8:27632945-27632967 TCTGTGATTTTGTTGGTGGAGGG - Intergenic
1038593886 8:28867571-28867593 TGTGAGATTAAGTAGTTGGCTGG - Intronic
1039137597 8:34343089-34343111 AATGCCATTAAGTAGGTGGATGG + Intergenic
1039377641 8:37052226-37052248 CATGAGATTTGGGAGGCGGAAGG - Intergenic
1042772836 8:72398195-72398217 TATGAGATTTGGGAGGGGCAAGG - Intergenic
1043749783 8:83921279-83921301 CATGAGATTTGGGAGGTGCAAGG - Intergenic
1044759696 8:95505148-95505170 TATGAGATTTTAGAGCTGGAAGG + Intergenic
1045820896 8:106336627-106336649 TAAAAGATTTAGTGGGTAGAGGG - Intronic
1046764070 8:118050866-118050888 TCTAAGAATTAGAAGGTGGAGGG + Intronic
1047334523 8:123922905-123922927 AATGAGATTTAGTGGGAGGGAGG - Intronic
1048327387 8:133450113-133450135 TGTGAGAGTTAGTGGGGGGACGG - Intergenic
1051410972 9:16789015-16789037 TGTGAGATTTGGTTGGAGGATGG - Intronic
1054145230 9:61556933-61556955 TATAAGAATTGGTAGGTGAATGG - Intergenic
1054989102 9:71300837-71300859 TATGGGATTTAGCATTTGGAGGG + Intronic
1055192209 9:73539130-73539152 TATGAAATATGGAAGGTGGAGGG + Intergenic
1056091011 9:83206054-83206076 TATAAGATTTATGAGGTGGAGGG - Intergenic
1057300156 9:93873571-93873593 TATGAGATTTAGGAGGGGCCAGG + Intergenic
1058155821 9:101513707-101513729 TAAGAGATTTATTAGGGGAATGG + Intronic
1059089719 9:111342869-111342891 GATGACCTTTAGTAGGTGAATGG + Intergenic
1060413450 9:123414787-123414809 GATGAGATTGCGGAGGTGGATGG - Intronic
1187247247 X:17563784-17563806 TATGTGATGGAGTGGGTGGACGG + Intronic
1187555300 X:20345344-20345366 TATGAGATTTGGGAGGTGCCGGG + Intergenic
1187836656 X:23438000-23438022 TATGAGATTTGGCAGGGGCAGGG + Intergenic
1188397804 X:29706268-29706290 TATGAGATTTAGGAGGGGCCAGG - Intronic
1188753719 X:33935418-33935440 TATGAGATTTGGGAGGTGCCAGG - Intergenic
1188833305 X:34927750-34927772 TATGAGATTTGGGAGGTGCCAGG - Intergenic
1192270432 X:69574623-69574645 TATGAGATTTGGGAGGGGCAGGG - Intergenic
1193066496 X:77265578-77265600 CATGAGATTTGGTAGGTGCCAGG + Intergenic
1194841623 X:98751482-98751504 TATGAGATTTAGGAGGGGCAGGG - Intergenic
1195406986 X:104525267-104525289 CATCAGATTTAGAAGGTAGAAGG - Intergenic
1195532058 X:105968775-105968797 AATGAAATTTAGAGGGTGGAGGG + Intergenic
1198078850 X:133219615-133219637 TATGAGTTTTAGTGGGTAGGGGG + Intergenic
1200805143 Y:7425760-7425782 TAATAGATTCAGTAGATGGATGG + Intergenic