ID: 990867478

View in Genome Browser
Species Human (GRCh38)
Location 5:60396106-60396128
Sequence GAAAAGAGCAGTGCCCCCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 200}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990867478 Original CRISPR GAAAAGAGCAGTGCCCCCTT TGG (reversed) Intronic
901864347 1:12094382-12094404 GAAGGGAGCATTGCCCCTTTGGG + Intronic
903507530 1:23848599-23848621 GAACAGAACAGTGCCCCATCCGG - Intronic
906854852 1:49292995-49293017 GAAAAGAGCTGCGGCCCTTTGGG + Intronic
908674827 1:66591864-66591886 GAAAAGTGCTGTGCCTCCATGGG + Intronic
909071041 1:70994049-70994071 GCAAAGAGCAGAGCAGCCTTTGG - Intronic
909282382 1:73771385-73771407 GAGAAGAGCTGTGGCCCTTTGGG + Intergenic
910602057 1:89042917-89042939 GAGAAGAGCTGTGGCCCTTTGGG - Intergenic
911229529 1:95346362-95346384 GAAGAGAGCAGTTCCCCTTTAGG + Intergenic
911267019 1:95754345-95754367 GAGAAGAGCTGTGGCCCTTTGGG + Intergenic
916290771 1:163164051-163164073 GAAATGTGCAGAGCCCGCTTGGG + Intronic
916655203 1:166868955-166868977 GAAAAGAGTAGTGCCACATCTGG + Intronic
917855380 1:179095144-179095166 GAAAAGAGTTGTTCCTCCTTGGG - Exonic
921625463 1:217373705-217373727 GAGAAGAGCTGTGGCCCTTTGGG + Intergenic
922707692 1:227798126-227798148 GAGAAGAGAAATGCCCCTTTTGG + Intergenic
923755356 1:236786388-236786410 GAGAAGAGCTGTGGCCCCTCAGG + Intergenic
923786110 1:237070941-237070963 GAGAAGAGCAGTGGCCCTTGGGG - Intronic
1066358141 10:34704670-34704692 AAAAAGAGCAGAGCCTTCTTTGG - Intronic
1067282396 10:44882210-44882232 GAAGAGAGCAGTGATGCCTTAGG - Intergenic
1068083662 10:52348189-52348211 GAGAAGAGCTGTGGCCCTTTGGG + Intergenic
1068108726 10:52653098-52653120 GAAAAGACCAGTTCCTCCTGAGG - Intergenic
1068443962 10:57096057-57096079 GAGAAGAGCTGTGGCCCTTTGGG + Intergenic
1070322348 10:75363621-75363643 GAAATGAATAGTGCCCCCTAGGG - Intergenic
1070356035 10:75641196-75641218 GAAAGGGCCAGTGCACCCTTGGG + Intronic
1070401317 10:76055893-76055915 GAGAAGAGCTGTGGCCCTTTGGG - Intronic
1070765971 10:79056648-79056670 GGGAACAGCAGAGCCCCCTTTGG + Intergenic
1071500370 10:86199484-86199506 GAACAGAGCTGTGGACCCTTTGG + Intronic
1071957161 10:90771431-90771453 GAGAAGAGCTGTGGCCCTTTGGG + Intronic
1072753398 10:98000250-98000272 GAGAAGAGCTGTGACCCCTCAGG + Intronic
1074467265 10:113694520-113694542 GAACTGAGCTGTGCCACCTTAGG + Intronic
1076655093 10:132018740-132018762 GAAAAGAGCTGTGGCCCTTCAGG - Intergenic
1077615258 11:3669503-3669525 GAAAAGAGAAGAGCCCACTAAGG - Intronic
1079997072 11:27305729-27305751 GAGAAGAGCAGCGGCCCTTTGGG + Intergenic
1080851922 11:36077776-36077798 GAGAAGAGCTGTGGCCCTTTGGG - Intronic
1081044050 11:38250152-38250174 GAGAAGAGCTGTGGCCCTTTGGG - Intergenic
1085273000 11:75281360-75281382 CCAAAGAGCAGAGCCCCGTTTGG - Intronic
1087088760 11:94246324-94246346 GACAAGTGCAGGGCACCCTTGGG - Intergenic
1087442763 11:98207534-98207556 GAAAAGAGTTGTGGCCCCTCTGG - Intergenic
1088795366 11:113262973-113262995 AAAAAGATCAGTGCCCCCTTTGG + Intronic
1088927022 11:114312821-114312843 GGAGCCAGCAGTGCCCCCTTAGG - Exonic
1089091966 11:115885761-115885783 GAGAAGAGCAGTGGCCTCTGTGG - Intergenic
1089641682 11:119851801-119851823 GAACAGGGCAGGGCCCACTTTGG - Intergenic
1090263960 11:125342514-125342536 GAAAAGCGCAGAGCCACCTCCGG - Intronic
1091299962 11:134501557-134501579 GAGAAGAGCAGTGCTCCCCCAGG - Intergenic
1092069373 12:5620413-5620435 GCAAAGAGCATTGCCCGCTAGGG + Intronic
1092743566 12:11652745-11652767 GAAAAGAGTAGTGTCCGATTTGG + Intronic
1093811017 12:23492218-23492240 GAAATGACCATTGCCTCCTTGGG + Intergenic
1094580433 12:31729167-31729189 GGAAAGAAGAGAGCCCCCTTTGG + Exonic
1095603288 12:44038230-44038252 GAGAAAAGCTGTGGCCCCTTGGG + Intronic
1095826167 12:46531897-46531919 GAGAAGAGCTGTGGCCCTTTGGG + Intergenic
1097360723 12:58655739-58655761 GAGAAGAGCTGTGGCCCCTTGGG - Intronic
1100368321 12:93942176-93942198 GGAAAGAGCAGTCTCCCATTTGG + Intergenic
1102137409 12:110586855-110586877 GAGAAGAGCAATGCAACCTTAGG + Intergenic
1102772617 12:115491694-115491716 GAAAAGGGAATTGCTCCCTTGGG + Intergenic
1105575367 13:21646301-21646323 GTAAAGAGCAGTGTCCCCAAAGG + Intergenic
1106558617 13:30830692-30830714 GAGAAGAGCAGTGACCTCTCAGG + Intergenic
1108542349 13:51455913-51455935 GAGAAGAGCTGTGGCCCTTTAGG - Intergenic
1109837517 13:67878307-67878329 GAGAAGAGCTGTGACCCTTTGGG + Intergenic
1109861006 13:68199226-68199248 GAAAGTAGCATTGCCCACTTTGG + Intergenic
1109988182 13:70017240-70017262 GAAAAGAGCTGAGGCCCTTTGGG + Intronic
1110778053 13:79432902-79432924 GAAAAGAGCTGTGGCCCTTTGGG + Intergenic
1111202757 13:84961518-84961540 GAGAAGAGCTGTGGCCCTTTGGG - Intergenic
1112803087 13:103133561-103133583 GCAGAGAGCAATGCCCCCTGGGG - Intergenic
1113733433 13:112658159-112658181 GAAATTAGCAGTGCCGCCATTGG - Intronic
1114140204 14:19901182-19901204 GAGCAGAGCAGTGCCATCTTGGG - Intergenic
1116448443 14:45038667-45038689 GAAAAGAGCTGTGGCCCTATGGG - Intronic
1116541440 14:46107119-46107141 GAGAAGAGCTGTGGCCCTTTGGG - Intergenic
1116789923 14:49329467-49329489 GAAAAGAGCTGTGGCCCTTTGGG - Intergenic
1117690443 14:58299481-58299503 GAAAAGGCCAGAGCTCCCTTCGG - Intronic
1119169882 14:72526677-72526699 AAAATGGGAAGTGCCCCCTTTGG - Intronic
1119207985 14:72809074-72809096 TAAAACACCAGGGCCCCCTTGGG + Intronic
1119634669 14:76264234-76264256 GAAAATAGCAGTGCAGCCTGGGG - Intergenic
1119975041 14:79015924-79015946 GAAAAGAGCAGAGGGCCTTTAGG - Intronic
1120208386 14:81610541-81610563 CAAAAGAGCTGTGCACCCTTAGG - Intergenic
1121824575 14:97000014-97000036 GAGAAGAGCTGTGGCCCTTTGGG - Intergenic
1122491325 14:102117790-102117812 GAGAAGAGCTGTGGCCCTTTGGG + Intronic
1124243354 15:28050297-28050319 GAAAAGATCAATACCCTCTTGGG + Intronic
1124717968 15:32084480-32084502 GCAAAGAGCAGAGCCCCTTTAGG + Intronic
1125113988 15:36067276-36067298 GAAAAGAGCTGTGGCCCTTCAGG - Intergenic
1125381512 15:39091901-39091923 GAGAAGAGCTGTGGCCCTTTGGG - Intergenic
1127588002 15:60396836-60396858 TAAAAGAGCAGTGGCCTCATGGG - Intronic
1127916721 15:63461007-63461029 GAAACATGCGGTGCCCCCTTCGG + Intergenic
1128381365 15:67115535-67115557 GAAAAAGGCATGGCCCCCTTTGG + Intronic
1129888512 15:79055637-79055659 GCAAAGGGCAGAGCCCCCTGTGG - Intronic
1132615531 16:839590-839612 GAGAAGAGCAAAGCCCCCGTGGG - Intergenic
1132812435 16:1807805-1807827 GAACAGACCAGTGACCCCTCCGG + Exonic
1134059636 16:11191336-11191358 GAAAAGGGCTGTTCCCGCTTGGG - Intergenic
1135644328 16:24148150-24148172 GAAAAGAACAGTGCTTCCTTAGG - Intronic
1138249331 16:55490104-55490126 GACAAGAGCAGTGACCCCTCAGG - Intronic
1141520325 16:84574449-84574471 GAAAAGAGAAGTCCCCCGTCTGG - Intronic
1143861674 17:9895918-9895940 GGAAAGAGCATTGAGCCCTTTGG + Intergenic
1145216987 17:21060217-21060239 GAGAAGAGCTGTGGCCCTTTGGG - Intergenic
1146031466 17:29369847-29369869 TAAAAGAATAGTGCCCCCTTTGG - Intergenic
1146087006 17:29838966-29838988 GAGAAGAGCTGTGGCCCTTTGGG + Intronic
1147717669 17:42519233-42519255 GAAAAGGGCGGTGCCCCCACAGG + Intronic
1152170658 17:78745231-78745253 CAAAAGAACAGTGCCCCTTCAGG + Intronic
1153139283 18:1953996-1954018 GAAAAGAGCTGTGGTCCTTTGGG - Intergenic
1153608250 18:6855670-6855692 GAGAAGAGCTGTGTCCCTTTGGG + Intronic
1153851976 18:9103141-9103163 GAAACGAGAGGTGCCTCCTTCGG - Intronic
1155819244 18:30353359-30353381 GAGAAGAGCTGTGGCCCCTCTGG + Intergenic
1157317954 18:46609034-46609056 GAAAAAAGCAGAGCCCTCCTTGG - Intronic
1157468493 18:47969089-47969111 TAAAAGAGAAGTTCCCGCTTGGG + Intergenic
1158023314 18:52869067-52869089 GAGAAGAGCTGTGACCCTTTGGG - Intronic
1158397947 18:57094550-57094572 GCAAAGAGCAGGGCTCCCTAGGG - Intergenic
1159849863 18:73514864-73514886 GAGAAGAGCTGTGGCCCTTTGGG - Intergenic
1160656500 19:274563-274585 GAAATCAGCAGTGTCCCCTCTGG - Intergenic
1160858781 19:1228961-1228983 GGAAAGAGCAGTGCACACTTCGG + Exonic
1161438627 19:4278715-4278737 GCACAGAGCAGAGCCCTCTTGGG + Exonic
1161491010 19:4561586-4561608 AAAAAGAGCACTCACCCCTTGGG - Intergenic
1161491705 19:4565905-4565927 AAAAAGAGCACTCACCCCTTGGG - Intergenic
1162547290 19:11338585-11338607 GAAAATAGCAGTACCCATTTAGG - Intronic
1165038499 19:33052207-33052229 GAATGGAGCAGGGCCCCCATAGG - Intronic
1165999877 19:39871585-39871607 GGAAAAAGCAATGGCCCCTTCGG - Intronic
1166289737 19:41854889-41854911 GTAGAGACCAGTGGCCCCTTGGG - Intergenic
926625524 2:15086523-15086545 GAGAAGAGCTGTGGCCCCTTGGG + Intergenic
927743105 2:25590186-25590208 GAAAAGAGCTGTACCCCTCTGGG - Intronic
928304658 2:30157742-30157764 GAACAGAGGAGTGCCCACTGGGG - Intronic
930880325 2:56263178-56263200 GAAAAGAGCCCAGCACCCTTAGG + Intronic
930946568 2:57083766-57083788 GAGAAGAGCTGTGGCCCTTTGGG - Intergenic
930957344 2:57218150-57218172 AAAAAGAGCTGTGGCCCTTTGGG + Intergenic
932492646 2:72131828-72131850 GGGAAGAGCCGTGCCCCCTTGGG - Exonic
933346145 2:81088150-81088172 GAAAAGTTCACTGCCCCCTCGGG + Intergenic
937543800 2:122990032-122990054 GAGAAGAGCTGTGGCCCTTTGGG + Intergenic
938590846 2:132734861-132734883 GAACTGAGCAGAGCCCACTTTGG - Intronic
938722029 2:134075758-134075780 GAGAAGAGCTGTGGCCCTTTGGG - Intergenic
939808694 2:146806178-146806200 GAAAAGAGGAGAGTCCTCTTGGG + Intergenic
939981924 2:148792696-148792718 GAAATAAGCAGTTTCCCCTTTGG - Intergenic
940396214 2:153195641-153195663 GAGAAGAGCTGTGGCCCTTTGGG - Intergenic
940694189 2:156958818-156958840 GAGAAGAGCTGTGCCCTTTTAGG - Intergenic
943426927 2:187749425-187749447 GAAAAGAGCTGTGGCCCTTCGGG - Intergenic
943928429 2:193819178-193819200 GAGAAGAGCTGTGCCCCTCTGGG - Intergenic
944679599 2:202065051-202065073 GACATGAGCAGTGCCCTCTGCGG - Intergenic
945048648 2:205802893-205802915 GAAAAGAGCAGTTCTGCCTCTGG - Intergenic
945791533 2:214311110-214311132 GGGCAGAACAGTGCCCCCTTTGG + Intronic
947327180 2:228991877-228991899 GAGAAGAGCTGTGTCCCTTTGGG - Intronic
1169725697 20:8726987-8727009 CAAAAGAGCAGGGACCCCGTGGG - Intronic
1170590089 20:17765183-17765205 GACAAGAACAGTGCCCCCATCGG - Intergenic
1171042390 20:21777564-21777586 GAAAAGTGCAGTGCTCAATTTGG + Intergenic
1171266665 20:23776626-23776648 GAAAAGTGCAGGGCCCTCCTGGG + Intergenic
1172169556 20:32920795-32920817 GAAGTGAGCAGTGTCCCCTCTGG + Intronic
1173428046 20:42959717-42959739 GAAGGGAGCAGAGCTCCCTTGGG - Intronic
1175138639 20:56843322-56843344 GAAAAGAGCTGTGGCTCTTTGGG + Intergenic
1175244701 20:57574849-57574871 GAAAAGGACAGGGCCCCCTGTGG - Intergenic
1176087548 20:63304892-63304914 GAATATGGCAGTGTCCCCTTTGG + Intronic
1176141478 20:63546911-63546933 GAAAACAGCAGTGTCCGCTGTGG - Intronic
1176993051 21:15521669-15521691 GAGAAGAGCTGTGGCCCCTAGGG - Intergenic
1179407430 21:41137280-41137302 GAAAAGAGCTGTGGCCCTTCGGG + Intergenic
1184128675 22:42504462-42504484 GACAAGTGCAGTGCCCCCAGGGG + Intergenic
1184137470 22:42557777-42557799 GACAAGTGCAGTGCCCCCAGGGG + Intronic
1184574854 22:45355288-45355310 GAAAAGAGCACTGCCGACTCAGG - Intronic
950207679 3:11093122-11093144 GAGAAGAGCTGTGACCCTTTGGG + Intergenic
952793413 3:37218141-37218163 GAGAAGAGCTGTGGCCCATTGGG + Intergenic
956512048 3:70004954-70004976 GGATAAAGCAGTTCCCCCTTTGG - Intergenic
956989917 3:74751362-74751384 GAGAAGAGCTGTGGCCCTTTGGG - Intergenic
957357841 3:79114994-79115016 TAAAAAAGCAGTGACCTCTTTGG + Intronic
958161147 3:89818190-89818212 GAGAAGAGCTGTGGCCCTTTTGG - Intergenic
958688423 3:97428822-97428844 CAAAAGAGCAGTCTCCTCTTGGG + Intronic
959389655 3:105758899-105758921 GAGAAGAGCTGTGGCCCTTTGGG - Intronic
962211934 3:133486696-133486718 GAGAAGAGCTGTGGCCCTTTGGG - Intergenic
965115107 3:164478253-164478275 GAGAAGAGCTGTGGCCCTTTGGG + Intergenic
966840221 3:184082015-184082037 GAGAAGAGCTGTGGCCCTTTGGG + Intergenic
968838257 4:2981185-2981207 GATAAGAGCTGTGGCCCCTTGGG - Intronic
969682151 4:8649395-8649417 AGAAAGAGCAGTGGCCCCATCGG + Intergenic
971876771 4:32318423-32318445 GAGAAGAGCTGTGGCCCTTTGGG - Intergenic
972075376 4:35079950-35079972 GAAAAGAGCTGTGGCCCTTCTGG + Intergenic
974674116 4:65069114-65069136 GAGAAGAGCTGTGGCCCTTTGGG + Intergenic
974878157 4:67722400-67722422 GACAAGAGCAGAGCCCTTTTGGG + Intergenic
976178892 4:82380867-82380889 GAAAAGAGCTGTGGCCCTTCTGG - Intergenic
976702738 4:87989133-87989155 GAAAAGAGCGGTGGCCTCTGAGG + Intergenic
977162668 4:93655012-93655034 GAAAAGACCTGTGCCCCATTTGG + Intronic
983454178 4:167941564-167941586 GACAAGTGGAGTGACCCCTTAGG - Intergenic
983784629 4:171715973-171715995 GAGAAGAGCTGTGGCCCTTTGGG + Intergenic
990867478 5:60396106-60396128 GAAAAGAGCAGTGCCCCCTTTGG - Intronic
993617948 5:90136363-90136385 GAAAATAGCTGTGGCCCTTTGGG - Intergenic
993703283 5:91143251-91143273 GAGAAGAGCTGTGGCTCCTTGGG - Intronic
994891392 5:105640304-105640326 GAGAAGAGCTGTGGCCCTTTGGG + Intergenic
997727141 5:136131534-136131556 TGAAATAGCAGTGACCCCTTTGG + Intergenic
997826573 5:137111948-137111970 GAAAAGAACAGTGCCTTATTTGG + Intronic
999448973 5:151664413-151664435 GAGAACAGCAGTGCACCATTCGG + Intronic
1005511969 6:26519446-26519468 GGACAGAGCTGTGCTCCCTTCGG - Intergenic
1010846965 6:80720731-80720753 GAGAAGAGCTGTGGCCCTTTGGG + Intergenic
1011034667 6:82959981-82960003 GAAAAGAGTTGTTCCTCCTTGGG + Intronic
1012122439 6:95384915-95384937 GAGAAGAGCTGTGCCCCTTCAGG + Intergenic
1013442882 6:110189573-110189595 GAAAAGAGGAGTGCTCTCTTTGG - Intronic
1015282435 6:131448198-131448220 GAAAAAGACAGTGCCCCATTAGG - Intergenic
1015897247 6:138029171-138029193 GAAACAAGGAGTGGCCCCTTGGG - Intergenic
1017763142 6:157586412-157586434 GAAAACAGCATTGCCCGCTCAGG + Intronic
1017813058 6:157998015-157998037 GAATAGAGCAGGGGCCTCTTAGG - Intronic
1020543723 7:9495698-9495720 GAAAAGAATAGTGCACCATTAGG - Intergenic
1021269944 7:18573883-18573905 GAGAAGAGCTGTGGCCCTTTGGG - Intronic
1021500702 7:21329528-21329550 GAAAAGAGCTGTGGCCCTCTGGG - Intergenic
1025603214 7:63018713-63018735 GAACTGAGCAGTGTCCCCTGCGG + Intergenic
1025778652 7:64580212-64580234 GAAAACATCAGTTCCTCCTTTGG + Intergenic
1028111839 7:86950381-86950403 GAGAAGAGCTGTGGCCCTTTGGG + Intronic
1028162041 7:87497037-87497059 GAAAAGAGCAGTTACCTCTCTGG - Intergenic
1030243939 7:107360475-107360497 GAGAAGAGCTGTGGCCCTTTGGG + Intronic
1030969015 7:116030802-116030824 GAAAAGAGAAGTGGCTCATTAGG + Intronic
1032389502 7:131546778-131546800 GTGAAGGGCAGTGCCCCCTAGGG + Intronic
1032580359 7:133098187-133098209 GAAGACACCAGTGCTCCCTTTGG - Intergenic
1032658259 7:133955040-133955062 GAGAAGAGCTGCGGCCCCTTGGG - Intronic
1034252121 7:149701118-149701140 GAGAAGAGCAGTGGCCCTTAAGG - Intergenic
1041191532 8:55360412-55360434 GAACAGAGCTGTTCCCCTTTAGG + Intronic
1042880023 8:73477110-73477132 GAAGAGAGTAGTGCCACCTGGGG + Intronic
1043758377 8:84032244-84032266 GAAAAGAGCTGTGGCCCTTCAGG + Intergenic
1044600192 8:93996093-93996115 AGAAAGAGCAGGGCCCCTTTAGG - Intergenic
1046570698 8:115961971-115961993 TAAAAGGGCATTGCCACCTTTGG - Intergenic
1047104607 8:121719469-121719491 GAGAAGAGCTGTGGCCCTTTGGG - Intergenic
1048339042 8:133524947-133524969 GAGAAGAGCTGTGGCCCGTTGGG - Intronic
1051151672 9:14086321-14086343 AAAAATAGCAGTACCCACTTTGG + Intronic
1051355273 9:16234748-16234770 GAGAAGAGCTGTGGCCCTTTTGG + Intronic
1055893393 9:81147051-81147073 GGAAACAGCAATGCCCACTTGGG + Intergenic
1056694618 9:88836334-88836356 GAGAAGAGCAGAGCCCTGTTAGG - Intergenic
1056809243 9:89751465-89751487 CAAGAGAGCAGAGACCCCTTAGG + Intergenic
1057461235 9:95264117-95264139 AAAAAGAGCAGTTCCACATTTGG - Intronic
1057870807 9:98715689-98715711 GAGGAGAGCAGTGCTCCCTACGG - Intergenic
1192414173 X:70963346-70963368 AAAAAAAGAAGTGCCCCCATTGG + Intergenic
1198941755 X:141964170-141964192 GCAAAGAGCAGGGGCCCCCTGGG + Intergenic
1200752147 Y:6956299-6956321 CAAAAGAGCACTGTCCCCTCTGG + Intronic
1201296923 Y:12471651-12471673 CAAAAGAGCACTGTCCCCTCTGG - Intergenic