ID: 990869148

View in Genome Browser
Species Human (GRCh38)
Location 5:60412396-60412418
Sequence AAATACCTCCAGATGGAGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 266
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 248}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990869148 Original CRISPR AAATACCTCCAGATGGAGTA AGG (reversed) Intronic
903308192 1:22429485-22429507 ACATACTTCCAGCTGGATTAAGG - Intergenic
905712024 1:40113292-40113314 AATTAACTCAAGATGGATTAAGG + Intergenic
905941065 1:41863898-41863920 AAATACATCCAGATTAAGAAGGG + Intronic
906360639 1:45154893-45154915 AAAAACCTCAAGATGGATTAAGG + Intronic
906856688 1:49314016-49314038 AATTAACTCAAGATGGATTAAGG - Intronic
907647588 1:56259641-56259663 GAATATCTCCTGTTGGAGTAAGG + Intergenic
907837400 1:58123355-58123377 AGATGCTTTCAGATGGAGTAAGG - Intronic
908174681 1:61543105-61543127 AATTAACTCAAGATGGATTAAGG - Intergenic
909429200 1:75567151-75567173 AAACACCTGCAGAAGCAGTATGG - Intronic
912151974 1:106870669-106870691 AATTAACTCCAAATGGATTAAGG - Intergenic
916001027 1:160615917-160615939 TAAAGCCTCCAGATGGAGTGTGG + Intronic
919221020 1:194628643-194628665 AATTAACTCAAGATGGATTACGG + Intergenic
921698256 1:218237327-218237349 AATTAACTCAAGATGGATTAAGG + Intergenic
921805377 1:219448369-219448391 AATCAACTCCAGATGGATTAGGG - Intergenic
922771751 1:228188882-228188904 AATTACCTCCAAATGGATCATGG - Intergenic
923458247 1:234185126-234185148 AAATACTTGCAGAAGGAGGAGGG + Intronic
924321004 1:242850308-242850330 AATTAACTCAAGATGGATTAAGG - Intergenic
1064172290 10:13044496-13044518 AATTAACTCAAGATGGATTAAGG - Intronic
1064846221 10:19657324-19657346 AAAGACCTGAAGATTGAGTATGG - Intronic
1065200654 10:23309926-23309948 AAATCCCTCCAGGTGGATTTTGG - Intronic
1065253931 10:23845880-23845902 AAATAACTCAAGGTGGATTAAGG - Intronic
1067665837 10:48278130-48278152 AATTAACTCAAGATGGATTAAGG - Intergenic
1068575612 10:58681015-58681037 AATTAACTCAAGATGGATTAAGG + Intronic
1069117149 10:64521768-64521790 AAATATGTCTAGATGGAGAAAGG - Intergenic
1070226556 10:74514381-74514403 AAATATCTCCAGAAGGTGAAGGG - Intronic
1071036854 10:81258097-81258119 AAATACCTCTAGATGGTGTCTGG + Intergenic
1072404832 10:95140884-95140906 AATTAACTCAAGATGGATTAAGG + Intergenic
1073694877 10:105853544-105853566 AAATACCTCAAAATGGGGTAGGG + Intergenic
1075456377 10:122587650-122587672 AAACACCCCCAGATGCAGCAGGG + Intronic
1075954709 10:126512860-126512882 AAATCCCACAAGATGGAGAAAGG - Intronic
1076038869 10:127226287-127226309 AAATACCTGTAGATAGGGTAGGG - Intronic
1076140615 10:128076178-128076200 AAATACACCCAGATGGAGTAAGG - Intronic
1076455967 10:130595812-130595834 ACATACATCCAGATGGATTCTGG + Intergenic
1078171997 11:8935258-8935280 AAATACCTTCAGAGAGAGTGAGG + Intergenic
1078275708 11:9843666-9843688 AAATAACTAAAGATGGAGTCTGG - Intronic
1079358943 11:19754284-19754306 AATTAACTCCAGAAGGAATAAGG + Intronic
1080513229 11:32996164-32996186 AATCAGCTCCAGATGGATTAAGG - Intergenic
1081982994 11:47281606-47281628 AAATTTCTCCAGATTGAGGATGG - Exonic
1083313920 11:61802543-61802565 GAAAACCTCCAGATGGAAGAAGG - Intronic
1083326043 11:61873520-61873542 AAATACATTCAGATGTATTATGG - Exonic
1084294175 11:68199885-68199907 AAATACCTGCAAATGAAGAATGG + Intronic
1085806486 11:79641559-79641581 AAAAATCTGCAGATGGTGTAAGG - Intergenic
1086099717 11:83086410-83086432 AAATATCTCCAGAAAGACTAGGG + Intergenic
1086806650 11:91252107-91252129 AATTAACTCAAGATGGATTAAGG - Intergenic
1087117169 11:94537831-94537853 AACTCTCTCCAGATGGAGGAAGG - Intergenic
1088231188 11:107675224-107675246 AAATACATCAAGATGGAACAAGG + Intergenic
1088804343 11:113338399-113338421 AAATATGTCCATATGGAGTTAGG - Intronic
1088937139 11:114413939-114413961 AACTACCTAAAGATGGAGAAAGG - Intronic
1091706195 12:2695092-2695114 AAATACTTGCTGATGGAGTCTGG + Intronic
1093028257 12:14264391-14264413 AAAAACATCCAGAGGGAGAAAGG - Intergenic
1094424522 12:30304618-30304640 AGATAACTCCAGATGGTCTATGG + Intergenic
1096888194 12:54739133-54739155 AATCACCTCAAGATGGATTAAGG - Intergenic
1097200126 12:57271163-57271185 AATGACCTCCAGAGGGAGTAAGG - Intronic
1097448386 12:59704833-59704855 ATCCACCTCCAGATGGAGGATGG + Exonic
1098279305 12:68846966-68846988 AAAAACTTCAAGGTGGAGTAGGG - Exonic
1098489779 12:71061769-71061791 AAAGAACTCCAGAGGGAGCATGG + Intronic
1103389311 12:120559671-120559693 AAATAACACCAGGCGGAGTACGG - Intronic
1103932954 12:124460266-124460288 AAATACCTGGAAATGGAGTGCGG + Intronic
1105680991 13:22727312-22727334 AGATAGCTTCAGATGGAATATGG + Intergenic
1108839324 13:54593086-54593108 AGATTCCACCAGATGGAGTAGGG - Intergenic
1108933552 13:55861256-55861278 AAATACCTCCAGAGTGATAATGG - Intergenic
1109503573 13:63269656-63269678 AATTAGCTCAAGATGGAATAAGG + Intergenic
1109549320 13:63872675-63872697 AAATTCCTACAGATGGTATAAGG - Intergenic
1110375962 13:74794257-74794279 AAAGACCACCAGATGGAGGCAGG + Intergenic
1110793252 13:79608425-79608447 AATTACCTCAAAATGGATTAAGG - Intergenic
1110968415 13:81730438-81730460 AATTAACTCAAGATGGAGTAAGG - Intergenic
1112137496 13:96597821-96597843 AATTAACTCAAGATGGAATAAGG - Intronic
1112682567 13:101783826-101783848 AATTAACTCAAGATGGATTAAGG - Intronic
1112907709 13:104444896-104444918 AATTAACTCAAGATGGATTAAGG + Intergenic
1113330470 13:109322023-109322045 AATCAACTCCAGATGGATTAAGG + Intergenic
1113684960 13:112276708-112276730 ACATTCCTTCAGATGGAGCAAGG + Intergenic
1114727330 14:24953061-24953083 TAGTGCCTCCAGATGGAGTGTGG - Intronic
1115299743 14:31870828-31870850 AATCAACTCAAGATGGAGTAAGG + Intergenic
1115433623 14:33348897-33348919 AAATGCCTCCATTTGGAGTTAGG + Intronic
1116271870 14:42780718-42780740 AATTAACTCAAGATGGATTAAGG - Intergenic
1117641531 14:57804612-57804634 AATTACCTCAAGATGGATTAAGG + Intronic
1124410552 15:29432959-29432981 AAAGACCTGCAGATGGAGGTGGG - Intronic
1125145183 15:36458970-36458992 AAATACCACCAGAAGGATGAGGG - Intergenic
1125438530 15:39674680-39674702 AATTAACTCCAGATGGATTAAGG + Intronic
1130766271 15:86874623-86874645 AAATCCCTCTATGTGGAGTAAGG + Intronic
1133879962 16:9772352-9772374 AAATACCTCCAAAGGGAGGGGGG - Intronic
1135226771 16:20666938-20666960 AATTAACTCAAGATGGAGTAAGG + Intronic
1137026401 16:35479759-35479781 AAATACTTCCAGGTGGAATTGGG - Intergenic
1138083570 16:54114548-54114570 AAAGTCCTCCAGGTGGAGTCAGG + Exonic
1138810832 16:60148531-60148553 AATTAACTCAAGATGGATTAAGG + Intergenic
1138838178 16:60463814-60463836 AAATACATACAGATGCAATAAGG - Intergenic
1139203543 16:65003999-65004021 AAATGCCTCCAGCTGGAAAATGG + Intronic
1140669656 16:77264914-77264936 AATTAACTCAAGATGGATTAAGG - Intronic
1142732974 17:1874688-1874710 AATTACCTCAAGATCGTGTAAGG - Intronic
1147226130 17:38979132-38979154 AAATATCTCAGGATGGAATAAGG - Intergenic
1148246860 17:46037905-46037927 AACTGCTTCCAGATGGAGTGTGG + Intronic
1148996450 17:51714469-51714491 AAAGAGCTCCAGAGGGAGGAAGG - Intronic
1149407532 17:56369076-56369098 AAATAGCTGGAGATGGTGTATGG - Intronic
1150536540 17:66048479-66048501 AACTAACTCCAGAAGGATTAAGG + Intronic
1153119533 18:1704625-1704647 AATTAACTCAAGATGGATTAAGG + Intergenic
1153177697 18:2397269-2397291 AAATACCCCCAAATGGAAAAAGG - Intergenic
1153519019 18:5934558-5934580 AAATACCTCTAGATGGATGGAGG - Intergenic
1153828766 18:8901052-8901074 AAATACCATCAGATGGGGCAGGG - Intergenic
1155280625 18:24235970-24235992 AGAGACTTCCAGATGGAGGATGG + Intronic
1157805673 18:50655785-50655807 AAATCCCTCCAGAGTGAGTAGGG - Intronic
1158738777 18:60115140-60115162 GAATAACTCAAGATGGATTAAGG - Intergenic
1158830242 18:61269331-61269353 AATCAACTCCAGATGGATTAAGG + Intergenic
1159741413 18:72175854-72175876 AATTACATGCAGATGTAGTATGG - Intergenic
1160361010 18:78278630-78278652 AATTAACTCAAGATGGATTAAGG - Intergenic
1164847440 19:31446059-31446081 CATTACCTCTAGATGGAGAAAGG + Intergenic
1166098166 19:40554546-40554568 AAACACCTGCAGCTGGAGCAAGG + Exonic
1167022763 19:46890848-46890870 AAATACCTCCTGAGTGACTAAGG - Intergenic
926410725 2:12599435-12599457 AATTACCTCCACTTGGAGTAGGG - Intergenic
927980630 2:27372617-27372639 AAATAGCTTCGGAAGGAGTATGG + Exonic
928794857 2:35005864-35005886 AATTAACTCAAGATGGATTAAGG + Intergenic
929264747 2:39905372-39905394 AGATAACACCAGAAGGAGTAGGG + Intergenic
930311840 2:49751961-49751983 AAATACTTCCAGAAGAAGTATGG + Intergenic
930855744 2:56016013-56016035 AGGCACCTCCAGATGGAGAAGGG + Intergenic
932384466 2:71318555-71318577 AATTACCTCAAGATGGATCAAGG - Intronic
933603623 2:84358812-84358834 AATTAACTCAAGATGGATTAAGG + Intergenic
934107156 2:88705550-88705572 AATTAACTCAAGATGGATTAAGG + Intronic
934604804 2:95686655-95686677 AAATATTTGCAGAGGGAGTATGG - Intergenic
936726426 2:115323378-115323400 AAATAACTGCAGATGTGGTAGGG - Intronic
936791016 2:116152020-116152042 AAATAACTCAAAATGGATTAAGG - Intergenic
936988116 2:118331238-118331260 CAATACCCCCAGATGGGGAAGGG + Intergenic
937308723 2:120888146-120888168 AGAAACCTCCAGAGGGAGAAGGG + Intronic
937532465 2:122845712-122845734 AAATACATACATATGCAGTATGG + Intergenic
937762809 2:125626361-125626383 AATTAACTCAAGATGGATTAAGG + Intergenic
937947823 2:127356721-127356743 AATCAACTCCAGATGGATTAAGG + Intronic
938136384 2:128761336-128761358 AATTAACTCAAGATGGATTAAGG - Intergenic
938845063 2:135199830-135199852 AAATACCTCCAGAATGAGCTAGG - Exonic
940112368 2:150169026-150169048 AAATATCTCCATATGGGGAAGGG - Intergenic
941586876 2:167370583-167370605 AAAGACATTGAGATGGAGTAGGG + Intergenic
942504228 2:176624739-176624761 AATTAACTCAAGATGGATTAAGG + Intergenic
943008618 2:182418573-182418595 AATGAACTGCAGATGGAGTAAGG + Intronic
943796672 2:192005182-192005204 AAAGACCACTTGATGGAGTAAGG + Intronic
944528482 2:200644212-200644234 AATTAACTCAAGATGGATTAAGG - Intronic
944695688 2:202198429-202198451 GAATACTTCCAGATGAAGTTAGG + Intergenic
945430019 2:209753160-209753182 AACTACTTCCACATGAAGTAGGG - Intergenic
945528197 2:210915383-210915405 AATTAACTCAAGATGGATTAAGG + Intergenic
1169469219 20:5869266-5869288 AAAAAACTTCAGATGGATTAAGG + Intergenic
1173318465 20:41966223-41966245 AATTAACTCAAGATGGATTAAGG - Intergenic
1174144673 20:48443398-48443420 AAAGACCTCCAGGAGGAGCAGGG + Intergenic
1176905106 21:14490973-14490995 AAAGCCCTCCATATGGTGTATGG - Intronic
1177050735 21:16229554-16229576 AATTAACTCAAGATGGATTAAGG + Intergenic
1178216814 21:30607931-30607953 AATTAACTCAAGATGGATTAAGG + Intergenic
1178542569 21:33466269-33466291 AAAAACCTCCTGATGGTATAAGG + Intronic
1179277432 21:39905190-39905212 AAGAACCTCCAGATGGAGACCGG - Intronic
1179319905 21:40280651-40280673 AAATACCTTCAGAGAGATTACGG + Intronic
1179770021 21:43607939-43607961 AATTAACTCAAGATGGATTAAGG + Intronic
1181016487 22:20072217-20072239 AAGCATCTTCAGATGGAGTAGGG + Intergenic
1181392345 22:22592882-22592904 AAATACCTCCAAATAAAGTGTGG - Intergenic
1182879924 22:33724531-33724553 AATTATCTCCAGATAGAGAAGGG + Intronic
1183636475 22:39066420-39066442 AAATACATCCAGATGGCCTGAGG - Intronic
952116782 3:30191730-30191752 AACTACCTCCAGAAGGAGGTAGG + Intergenic
953250479 3:41242151-41242173 AAATATCCACAGATGGAGCAAGG + Intronic
953711688 3:45276655-45276677 AAATAGCTGGAGATGAAGTAGGG + Intergenic
953756544 3:45651482-45651504 AATTAACTCAAGATGGATTAAGG - Intronic
954473768 3:50723689-50723711 AATTAACTCAAGATGGATTAAGG + Intronic
954527659 3:51286808-51286830 AATTAACTCAAGATGGATTAAGG + Intronic
954951718 3:54480662-54480684 AAATATCTCTAGAAGGAGGAAGG - Intronic
956376995 3:68624189-68624211 AAACACCTCAAGATGGATTAAGG - Intergenic
961424748 3:126836220-126836242 AAATACCTGGGAATGGAGTAGGG - Intronic
962974013 3:140430278-140430300 AAATACCTCCTGCAGGAGTCAGG + Intronic
964900400 3:161652446-161652468 TAAGACCTCCACATGCAGTAAGG - Intergenic
965873976 3:173294925-173294947 AATTAACTCAAGATGGATTAAGG - Intergenic
966164422 3:177001158-177001180 AAACAACTCAAGATGGATTAAGG - Intergenic
966991965 3:185241946-185241968 AAATAACTCAAGATGGATCAAGG - Intronic
967505535 3:190249038-190249060 AATTAACTCAAGATGGATTAAGG - Intergenic
972845606 4:42985131-42985153 AAATACCTTCAGAAGAACTAAGG - Intronic
973284729 4:48403019-48403041 TGATACCTCCAGATGCAGGAGGG - Intronic
973674085 4:53246682-53246704 AAACAACTCAAGATGGATTAAGG + Intronic
973709230 4:53611545-53611567 AAATAAGTAGAGATGGAGTAAGG + Intronic
973920897 4:55683811-55683833 AATTAGCTCAAGATGGATTACGG - Intergenic
974165545 4:58196739-58196761 TAAGACCTCCAGATGGAAAATGG + Intergenic
974263509 4:59555614-59555636 AATTAACTCAAGATGGATTAAGG - Intergenic
974607091 4:64167312-64167334 AAACACCTCCCTATGGAGTCAGG - Intergenic
977145304 4:93432578-93432600 AAATAGCTCAAAATGGAGTGAGG + Intronic
981181620 4:141752412-141752434 AATTAACTCAAGATGGATTAAGG - Intergenic
983863126 4:172733454-172733476 AAATACCCCCATAGGGATTATGG - Intronic
984052889 4:174889131-174889153 AAATACCACCACATTGAGGATGG - Intronic
984574782 4:181435506-181435528 AAATAATTCAAGATGGATTAAGG - Intergenic
985670640 5:1204834-1204856 AATTAGCTGCAGATGGACTAAGG - Intronic
986617873 5:9638728-9638750 AAATACCATCAGGTGGAGTCAGG + Intronic
986689080 5:10298917-10298939 AAATAGCTCCATGTGGGGTAGGG + Intronic
986931069 5:12822315-12822337 AATTAACTCAAGATGGATTAGGG - Intergenic
987836945 5:23174154-23174176 AATTAACTCAAGATGGATTAAGG - Intergenic
987902406 5:24029838-24029860 AAACAACTCAAGATGGATTAAGG - Intronic
989746994 5:44840496-44840518 AAATACCTCCAAATTTAATATGG + Intergenic
990004991 5:50935413-50935435 AAATACCTCCTGATATAGTTTGG - Intergenic
990233744 5:53743863-53743885 AATCACCTCAAGATGGATTAAGG + Intergenic
990869148 5:60412396-60412418 AAATACCTCCAGATGGAGTAAGG - Intronic
992919475 5:81499848-81499870 AACTTGCTCCAGATGAAGTATGG + Intronic
997020775 5:129999063-129999085 AAATAATTCCAGATGGATCAGGG - Intronic
1001307199 5:170584056-170584078 AACTACCTGAAGATGGAATATGG + Intronic
1002294010 5:178219047-178219069 AATAAACTCCAGATGGATTAAGG + Intronic
1004102853 6:12632568-12632590 ATTTACCTCAAGAAGGAGTAGGG - Intergenic
1004213066 6:13672152-13672174 AAATCCCTCCATTTTGAGTAGGG + Intronic
1004506392 6:16250209-16250231 CACCACCTCCAGATGGAGGAGGG + Intronic
1008245265 6:49163424-49163446 TAATAACTCCAGATGGATCAAGG + Intergenic
1008697046 6:54051057-54051079 AAATACCTCCTGAAGGACTTGGG - Intronic
1008736695 6:54553196-54553218 AATTAACTCGAGATGGATTAAGG + Intergenic
1009243022 6:61202649-61202671 AATTGCCTCCAGAGGGTGTATGG + Intergenic
1010320033 6:74496304-74496326 AAGTAATTCAAGATGGAGTAAGG - Intergenic
1016289562 6:142513742-142513764 AACTAACTCAAGATGGATTAAGG - Intergenic
1018851494 6:167643727-167643749 AAATGCCTCCAGGTGGAATGAGG + Intergenic
1019081516 6:169434237-169434259 AATTAACTCAAGATGGATTAAGG - Intergenic
1020716496 7:11680193-11680215 AATTAACTCAAGATGGATTAAGG + Intronic
1022463059 7:30630212-30630234 AAATATCACAAGATGGAGGAAGG + Intronic
1022550131 7:31230384-31230406 AATCAACTCAAGATGGAGTAAGG - Intergenic
1023176396 7:37439737-37439759 AAAAACCTTCAGTTGGAGAATGG + Intronic
1023403011 7:39804152-39804174 AAATACCTCCAGTTCAATTAGGG - Intergenic
1023455555 7:40334901-40334923 AATTAATTCCAGATGGATTAAGG - Intronic
1024033212 7:45482841-45482863 AAATTCTTCCCTATGGAGTAAGG - Intergenic
1024646325 7:51373985-51374007 AAATACCTCCAGTTCAATTAGGG + Intergenic
1028182617 7:87743961-87743983 AAATCACTCAAGATGGATTAAGG - Intronic
1030679318 7:112417973-112417995 AATTAACTCAAGATGGATTAAGG + Intergenic
1031256650 7:119459965-119459987 AAATAGCTACAAATGTAGTAGGG + Intergenic
1031530879 7:122874874-122874896 AATTAACTCAAGATGGATTAAGG + Intronic
1032798071 7:135293704-135293726 AAATACCAGCAGTTGGAATAGGG + Intergenic
1033051415 7:138007639-138007661 AAAAAGCTTCAGATGGACTAAGG + Intronic
1033964036 7:146951443-146951465 AATTAACTCAAGATGGATTAAGG - Intronic
1036023596 8:4877680-4877702 AAATAATTCCAGATGGAATAGGG - Intronic
1036762552 8:11519456-11519478 ACATACATCCACATGTAGTAGGG + Intronic
1037457529 8:19078810-19078832 AAATTCCTCCCTGTGGAGTAGGG + Intronic
1041847575 8:62349084-62349106 AAATAACTCCATATGGACAAAGG + Intronic
1043722835 8:83568398-83568420 AAATACTTCCATATAGTGTATGG - Intergenic
1043734516 8:83726953-83726975 AATTAACTCAAGATGGATTAAGG - Intergenic
1044390906 8:91649767-91649789 AATTAACTCAAGATGGATTAAGG + Intergenic
1045814264 8:106261422-106261444 AAATACCACCAGGTGGAGACAGG + Intergenic
1045949294 8:107833448-107833470 AATTAATTCAAGATGGAGTAAGG - Intergenic
1046235741 8:111422107-111422129 AATTAACTCAAGATGGATTAAGG - Intergenic
1046665569 8:116998837-116998859 TAATACCTTCGGAGGGAGTATGG + Intronic
1046721755 8:117628047-117628069 AAAAACCTCAAGAGGGAGAAAGG + Intergenic
1047553626 8:125904510-125904532 AAATGCATCCAGATGGAAAATGG + Intergenic
1052386151 9:27825640-27825662 AAATACTTCCAGATGGACCCAGG - Intergenic
1052665513 9:31489994-31490016 AATTAACTCAAGATGGATTATGG - Intergenic
1052738821 9:32373908-32373930 AGATGCCTGCAGATGGAGCATGG + Intergenic
1053133621 9:35635071-35635093 AAAGACCCCCAGATGGAATGTGG - Intronic
1053798625 9:41748747-41748769 AATTAACTCCAAATGGATTAAGG - Intergenic
1054837982 9:69699742-69699764 AAATACCTCCAGAAGAGCTAAGG - Intergenic
1056361869 9:85866537-85866559 AATTAACTCAAGATGGATTAAGG + Intergenic
1057984383 9:99696680-99696702 AATTAACTCAAGATGGATTAAGG + Intergenic
1058792346 9:108462314-108462336 AATTAACTCCAAATGGATTAAGG + Intergenic
1059063107 9:111053987-111054009 AAATAGCTCCACACGGAGCAAGG + Intergenic
1059168682 9:112103911-112103933 AAATGGCTCCAGATGGAGCATGG - Intronic
1185917757 X:4054882-4054904 AATTAACTCAAGATGGATTAAGG - Intergenic
1186323014 X:8451194-8451216 AAATAACTACAGAAGGAGTTTGG + Intergenic
1186982053 X:14967445-14967467 AATTAACTCAAGATGGATTAAGG - Intergenic
1187224112 X:17359516-17359538 AGATACATCTAGATGGAGGAGGG + Intergenic
1188045476 X:25421506-25421528 AATTAACTCAAGATGGATTAAGG - Intergenic
1188417181 X:29950164-29950186 AAATACATCCAGATGACATAAGG + Intronic
1188794411 X:34443793-34443815 AATTAACTCAAGATGGATTAAGG + Intergenic
1189017991 X:37304156-37304178 AATTAACTCGAGATGGATTAAGG - Intergenic
1189107456 X:38252097-38252119 AATTAACTCAAGATGGATTAAGG - Intronic
1190075026 X:47310722-47310744 AAATAACACAAGATGGAGGAGGG - Intergenic
1190884677 X:54521231-54521253 AAAAACCTCCAGATGTATTCAGG - Intergenic
1192058536 X:67798946-67798968 AATTAACTCAAGATAGAGTAAGG + Intergenic
1192302855 X:69924314-69924336 AATTAACTCAAGATGGATTAAGG - Intronic
1193553887 X:82930877-82930899 AAATACCTCCAGAGTGAAAATGG + Intergenic
1193578908 X:83237418-83237440 AAGTAACTCGAGATGGATTAAGG + Intergenic
1194390817 X:93315703-93315725 AATTAACTCAAGATGGATTAAGG - Intergenic
1194665174 X:96669970-96669992 AGATACCTGCATATGTAGTAGGG + Intergenic
1196233920 X:113257046-113257068 AAACAACTCAAGATGGATTAAGG - Intergenic
1197065777 X:122232494-122232516 AATTAACTCAAGATGGATTAAGG - Intergenic
1197493902 X:127153831-127153853 AAATGCCACCAGATGGAGGAAGG + Intergenic
1197882386 X:131180567-131180589 TAATACTTCCAGAGGGAGAAGGG + Intergenic
1199373578 X:147081492-147081514 AAAAAATTCCAGATGGATTATGG - Intergenic
1201898001 Y:19014793-19014815 TAATACCTACAGAGGGAGGAAGG + Intergenic
1201982805 Y:19925671-19925693 AAGTAGCTCCAGATGGAGAGTGG + Intergenic
1202033402 Y:20604157-20604179 AATTAACTCAAGATGGATTAAGG + Intergenic