ID: 990872107

View in Genome Browser
Species Human (GRCh38)
Location 5:60443500-60443522
Sequence AGCATTCTTTTCTCTACCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 308
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 282}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990872107_990872110 11 Left 990872107 5:60443500-60443522 CCCAGGGTAGAGAAAAGAATGCT 0: 1
1: 0
2: 1
3: 24
4: 282
Right 990872110 5:60443534-60443556 ATTTGAGGAGTGAAATTGAGCGG 0: 1
1: 0
2: 2
3: 26
4: 358
990872107_990872109 -4 Left 990872107 5:60443500-60443522 CCCAGGGTAGAGAAAAGAATGCT 0: 1
1: 0
2: 1
3: 24
4: 282
Right 990872109 5:60443519-60443541 TGCTGATGTAGAAGAATTTGAGG 0: 1
1: 0
2: 0
3: 21
4: 259

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990872107 Original CRISPR AGCATTCTTTTCTCTACCCT GGG (reversed) Intronic
901171312 1:7259732-7259754 ATCATTCTTTATTCTGCCCTTGG + Intronic
901184879 1:7366477-7366499 AGAATTCTTTTCTGGACTCTTGG + Intronic
901478971 1:9511053-9511075 AGCATCCTTTCCCCTACACTTGG - Intergenic
902280278 1:15369348-15369370 ATCCTCCTCTTCTCTACCCTAGG + Exonic
902742377 1:18447850-18447872 AGCATTAATTTTTCCACCCTGGG - Intergenic
903269469 1:22178462-22178484 AGCACTCTCTTCTCTCCCCCAGG + Intergenic
903519670 1:23937231-23937253 AAAATTCTCTTCTCTACCCCCGG + Intergenic
905676918 1:39832769-39832791 TGAATTCTGTTGTCTACCCTTGG - Intergenic
906038034 1:42765250-42765272 AGCCTTCTTTCCTCTCCCCCTGG + Intronic
906077628 1:43063643-43063665 AGCACTCTTTATTCTCCCCTTGG + Intergenic
906643604 1:47457271-47457293 TGCTTTTTATTCTCTACCCTTGG + Intergenic
906743789 1:48207586-48207608 TCCTTTCTTTTCTCCACCCTTGG + Intergenic
907006033 1:50914899-50914921 AGCATGTTTCTCTCTATCCTTGG + Intronic
907190773 1:52646267-52646289 AGTACTCTATTCTCTACTCTAGG - Intronic
908440267 1:64146505-64146527 AGCATTATTTGTTCCACCCTAGG + Intronic
908916147 1:69128996-69129018 AGCATTCTCTCCACTTCCCTGGG - Intergenic
909677225 1:78252173-78252195 AGCAAGCTTTTCTCTACACTGGG - Intergenic
910272534 1:85412090-85412112 AATATTCTTTTCTCTGCCATTGG - Intronic
910449838 1:87334065-87334087 TCCATTCTTTTCTCTATTCTTGG + Intronic
911088913 1:94001992-94002014 GGCATTTCTTTCTCTTCCCTAGG - Exonic
911215750 1:95191296-95191318 AGCTCTCTTTTCTCTTCCATTGG + Intronic
912528834 1:110305435-110305457 AGCCTTGTGTTCTCTGCCCTTGG - Intergenic
913425895 1:118729266-118729288 ACCATTCTATTCTCTCTCCTAGG - Intergenic
914225870 1:145719202-145719224 AAAATTCTTTTCTTTACCCTGGG - Intergenic
915026795 1:152838311-152838333 AGCTTTCTTTTCTCTTTCTTTGG + Intergenic
915216192 1:154342217-154342239 ACCATCCCTGTCTCTACCCTAGG - Intronic
916080740 1:161230464-161230486 CGCAGACTTTTCTCTTCCCTTGG - Exonic
916286013 1:163106614-163106636 AGCATTTTTTTCTCTGCAGTGGG - Intergenic
917856918 1:179108582-179108604 ACCATTCTTCTCTTTACCCTTGG + Exonic
919542135 1:198861557-198861579 AGCTTTCATTTCTCATCCCTAGG + Intergenic
920432132 1:205925614-205925636 AGGATTTTCTTCTCTGCCCTAGG + Intronic
921006169 1:211095584-211095606 ATCAATCTTTTTTCTACCCTGGG + Intronic
922035359 1:221842354-221842376 AGGATTCTTTTCTCTATCAAGGG + Intergenic
1063449127 10:6139804-6139826 AGCTTCCTATTCACTACCCTGGG + Intergenic
1063830101 10:9942701-9942723 ACCATTCTTTTCTCCTCTCTTGG - Intergenic
1064124714 10:12650107-12650129 AGCAGTCCCTCCTCTACCCTTGG + Intronic
1064189344 10:13192109-13192131 AGGATTCTTTTCTTTCCTCTTGG + Intronic
1064319626 10:14292303-14292325 AGCATTCTGTTCTATTCCATTGG - Intronic
1064606670 10:17049044-17049066 AGCATACTTTTCTATACTTTTGG - Intronic
1065798788 10:29332060-29332082 AGTCTTCTCTTCTCTACCCTAGG + Intergenic
1066030180 10:31413343-31413365 TGCATTTTTTTCTTTAGCCTAGG + Intronic
1067409007 10:46048428-46048450 AGCATCCCTTTCTCAACCCCTGG - Intergenic
1067704637 10:48597839-48597861 ATCAATATATTCTCTACCCTTGG + Intronic
1067826943 10:49582483-49582505 AGCATTCCTATTTCTAACCTTGG - Intergenic
1068375565 10:56175207-56175229 AGCCTTCTGTTTTCTGCCCTTGG + Intergenic
1071107928 10:82120468-82120490 AGCATTCTATTATAAACCCTGGG - Intronic
1071361718 10:84852752-84852774 CTCATTCTCTTCCCTACCCTAGG + Intergenic
1075473648 10:122713579-122713601 AGCATTCTTTTCTTTTCTCCTGG - Intergenic
1077069565 11:662346-662368 TCCAATCTTTTCTCTTCCCTGGG - Intronic
1078452632 11:11451882-11451904 CACATTCTTTTCTCTACACCAGG + Intronic
1078580426 11:12535461-12535483 AGAATTCTTGTCACTGCCCTGGG + Intergenic
1078735904 11:14020423-14020445 ACCATTCTCTTCTTAACCCTTGG - Intronic
1079326237 11:19494930-19494952 CTCATTCTTTTCTCTGCCCCTGG + Intronic
1079694852 11:23468546-23468568 TGCATTCTTTTCTCCACCCTTGG + Intergenic
1080160704 11:29171934-29171956 AGCATTATTTTTTCAACCTTTGG - Intergenic
1080527354 11:33138063-33138085 TGAATTCTTTTCTCTATACTTGG - Intronic
1081318260 11:41658663-41658685 AGCAATCTTTTCTCAGCCCAAGG + Intergenic
1083373514 11:62201390-62201412 AGCTTTCCTTTCTATATCCTTGG - Intergenic
1085823084 11:79814041-79814063 AGAATTCTCTTCTCTACCTGGGG - Intergenic
1086661171 11:89420422-89420444 AGCAGTCTTTTATCTACCAAGGG + Intronic
1089302520 11:117507305-117507327 AGCCTGCTACTCTCTACCCTGGG + Intronic
1089669118 11:120040150-120040172 TCCATTCTTTGCTCTACCGTAGG - Intergenic
1090641512 11:128733238-128733260 AGCATTCTTTACACTCCCCAAGG - Intronic
1091530069 12:1346064-1346086 AGCCTGCTTTTCTATAACCTGGG + Intronic
1092119702 12:6035264-6035286 ATCACTCTTTTCTATACTCTGGG - Intronic
1092317174 12:7429988-7430010 TCCAGTGTTTTCTCTACCCTTGG + Intronic
1092747991 12:11691388-11691410 TCCCTTCTTTTCTCTACCCAAGG + Intronic
1094045818 12:26165755-26165777 TGCATTTCTTTCTCTATCCTAGG - Intronic
1095170385 12:39027940-39027962 AACATTCTCTTCTCTTCCTTTGG - Intergenic
1095691061 12:45089118-45089140 GGCATTCTTTCCTCTAGCCTGGG + Intergenic
1095836298 12:46642825-46642847 AGCTTTCTACTCTCTTCCCTTGG - Intergenic
1100270660 12:93021477-93021499 AGCATTCTTCTCTAGACACTAGG + Intergenic
1100460960 12:94798872-94798894 ATGATTTTTTTCTTTACCCTAGG - Intergenic
1102398836 12:112611347-112611369 AGCATTCTTTTTACTTCCCTAGG + Intronic
1103802605 12:123549089-123549111 AGCCTTCTATTCTCTGACCTGGG - Intergenic
1104284538 12:127412662-127412684 AGCATTGTTCTCTCTCCCTTTGG - Intergenic
1109617050 13:64848849-64848871 ATAACTCTTTTCTCTTCCCTGGG + Intergenic
1109924463 13:69118167-69118189 AGCATTTTTTTCTCTCTACTTGG - Intergenic
1111428621 13:88123361-88123383 AGGCTTCTATTCTCTACCATTGG + Intergenic
1111522793 13:89427680-89427702 AGAATTCTGATCTCTCCCCTAGG - Intergenic
1111958613 13:94784708-94784730 AGCAATCTTTTCACTTCCCTGGG - Intergenic
1112233761 13:97615784-97615806 AGTTTTCTTTTCTCTTCCATTGG - Intergenic
1112803885 13:103140978-103141000 AGCATTTTTCTCTCCACGCTGGG + Intergenic
1112834679 13:103499860-103499882 AGCAATCTTTGCAATACCCTTGG - Intergenic
1113042087 13:106115340-106115362 ATGTTTCTTTTCTGTACCCTAGG + Intergenic
1113478118 13:110599831-110599853 AACCTTCTTTCCTCTACCCCAGG + Intergenic
1114193339 14:20457219-20457241 AGCATTCTTTTTGTTCCCCTTGG - Exonic
1114838017 14:26226883-26226905 AGCAATATTTTCCTTACCCTTGG - Intergenic
1117810519 14:59540961-59540983 AGAAATCTCTTCTCTATCCTTGG - Intronic
1118056729 14:62086856-62086878 AGCATTGTTTTCTATTCCATGGG - Intronic
1118332863 14:64827237-64827259 AGCATCCTCTCCTCTTCCCTGGG + Intronic
1118890841 14:69907529-69907551 ACCTTTGTTGTCTCTACCCTTGG - Intronic
1119428984 14:74553473-74553495 TGCATTCTGTTCCCTGCCCTTGG - Intronic
1120631265 14:86893986-86894008 AGCATTCTTTTCACTTTCATAGG + Intergenic
1124235200 15:27984087-27984109 ATCAATCTGTTCTTTACCCTGGG + Intronic
1125806088 15:42495008-42495030 AGCTTTCTTTCCTCTACACTCGG + Intronic
1127529317 15:59827839-59827861 AGGCATCTTTTCTATACCCTTGG - Intergenic
1127990743 15:64114402-64114424 ACCATTTTCTTCTCAACCCTTGG - Intronic
1128622501 15:69161729-69161751 AGTTTTCTTTTCTCTGCCCCGGG + Intronic
1130565275 15:84988731-84988753 TGCACTCTTTTCTCTGCTCTTGG + Intronic
1130836389 15:87654011-87654033 TGCCTTCTTATCTCTACTCTTGG + Intergenic
1132069723 15:98765745-98765767 TGCATTCTTTGCAGTACCCTAGG + Intronic
1136246059 16:28976678-28976700 AGTGTTCTTTTCTCTACTCCAGG + Intronic
1139173443 16:64659103-64659125 AGCATTCTACTCTCTACTGTTGG + Intergenic
1140437110 16:74956386-74956408 TGCATTCTCTTCTCTACACAGGG + Intronic
1141169924 16:81684812-81684834 AGCCTTCTTTTCTCCTTCCTAGG + Intronic
1141311795 16:82920573-82920595 AGCATTCTTTTCTTTTCCATAGG - Intronic
1143611057 17:8017547-8017569 AGCAAGCTTTTCTCTGCACTTGG - Intronic
1144211241 17:13017469-13017491 AGCGTCCTTTTCCCAACCCTTGG - Intronic
1145325838 17:21824170-21824192 AGCATTTTTCTCTCCATCCTTGG + Intergenic
1146615556 17:34354617-34354639 TCCATTCTATTCTCTGCCCTAGG - Intergenic
1146823298 17:36001605-36001627 AGCATTCTGACCTCTGCCCTGGG - Exonic
1148705809 17:49631012-49631034 AGAAATGTTTTCTTTACCCTGGG - Intronic
1150949701 17:69789358-69789380 AGCTGTATTTTCCCTACCCTTGG - Intergenic
1151421286 17:73999687-73999709 ATCATTCTACTCTCTACACTAGG + Intergenic
1151987366 17:77552615-77552637 AGAACTCAGTTCTCTACCCTTGG + Intergenic
1152901647 17:82944590-82944612 AGCATTCTCTTTTCTGCCATTGG - Intronic
1153368978 18:4292741-4292763 GGTAGTCTTTTCTCTCCCCTGGG + Intronic
1154400109 18:14028684-14028706 AGCATTCTTTTTTCCCACCTTGG - Intergenic
1155194401 18:23459621-23459643 CACATTCCTTTCTCTACCATTGG - Intronic
1157202552 18:45671627-45671649 CTCATTCTGTTCTCTGCCCTGGG + Intronic
1159322087 18:66865899-66865921 ATCATTCTTTACTCTTCCCAGGG - Intergenic
1159495759 18:69201716-69201738 AGCATTCTTTGCTCTGCCTATGG + Intergenic
1159614730 18:70568521-70568543 ACTATTTTTTTCTCTACACTTGG + Intergenic
1160007216 18:75076305-75076327 AGCATTTTTTTCTGTACCAGTGG + Intergenic
1164597477 19:29539741-29539763 TGCATTCTTCTCACTAGCCTCGG - Intronic
1166400925 19:42479329-42479351 AGGACTCTTTTCCCTTCCCTGGG - Intergenic
925814995 2:7738754-7738776 TGCATTCTTTTCACTGCCCCTGG - Intergenic
926497391 2:13607462-13607484 TACATTCTTTTCTTTACACTGGG - Intergenic
926867736 2:17378027-17378049 GGCATTCTTCTCTATACCCCTGG - Intergenic
928698618 2:33876199-33876221 TACATTCTTTTTTCTATCCTGGG + Intergenic
929602462 2:43212932-43212954 ATCATACTCTTCTCTGCCCTAGG - Intergenic
929929833 2:46245015-46245037 AGAATTCTTTGCCCAACCCTAGG + Intergenic
930266009 2:49199779-49199801 AGTGTTCTTTTCTCTATCTTAGG + Intergenic
930334023 2:50023040-50023062 TGCATTCTTGTTTCTTCCCTGGG - Intronic
931294550 2:60909035-60909057 AGCCTTTTTTTCATTACCCTAGG + Intronic
931335471 2:61337782-61337804 AGCATTCTTGACTCTGCCTTTGG + Intronic
933007130 2:77009311-77009333 AGCATTATTTTGTTTACCATGGG + Intronic
933121722 2:78546753-78546775 AGCCTTTTTTTCTCTCACCTTGG + Intergenic
933380601 2:81538874-81538896 TGCATTTTTCTCTCTTCCCTAGG + Intergenic
933594650 2:84271006-84271028 AGCATTATTTTTTATTCCCTGGG + Intergenic
933854739 2:86402354-86402376 AGGGTACTGTTCTCTACCCTGGG - Intergenic
935388153 2:102522960-102522982 TGCCTTCTTTTCTTTTCCCTTGG + Intronic
937348994 2:121147973-121147995 AACATTTTTTTCACTTCCCTGGG - Intergenic
937664509 2:124469165-124469187 AGCAATCTCTCCTCTACTCTGGG - Intronic
937813498 2:126224675-126224697 AGCTTTTTTTTTTCTTCCCTAGG - Intergenic
939869258 2:147508709-147508731 ATCATTCTATTCTCTACTTTTGG - Intergenic
940466015 2:154027677-154027699 AACATTCTTTTCTTAACTCTAGG - Intronic
941163819 2:162064012-162064034 AGCATTCATTCCTCTAACTTGGG + Intronic
943071221 2:183142859-183142881 AGCATTCTCTTCTCTCAGCTGGG + Intronic
943462316 2:188184393-188184415 AGCCTTTTCTTCTCTAACCTTGG + Intergenic
944143358 2:196480453-196480475 GGGATCCTCTTCTCTACCCTTGG - Intronic
944277634 2:197857278-197857300 TGCATTCTTTTCTCTATACCAGG + Intronic
944656471 2:201881000-201881022 AGCTTTCTTTTCTCTGGCTTAGG - Intronic
945118011 2:206428284-206428306 AGCTTTCTTTTCTCCTACCTTGG - Intergenic
947144266 2:227050348-227050370 AGCATCCCATTCTCTACACTTGG + Intronic
1168892541 20:1304340-1304362 AGCTGTCATTTCTCTCCCCTGGG + Intronic
1168907210 20:1416043-1416065 AGCATTCTTTTCCCTGGCATAGG + Intergenic
1169068367 20:2707135-2707157 ACCATTCTTCCCTCTGCCCTGGG - Intronic
1170230319 20:14039378-14039400 ATCATTCTTTTCAGTACCCCAGG - Intronic
1171147921 20:22802028-22802050 GTAATTCTTTTCTCTACCCTAGG + Intergenic
1172515302 20:35528913-35528935 AGCTCTGTTTTCTCTCCCCTGGG - Intronic
1173307180 20:41861874-41861896 AGCCTTCTCTTCTCTCCCCCAGG - Intergenic
1174915679 20:54651190-54651212 AACATGTTTTTCTCTATCCTAGG + Intergenic
1175111757 20:56653371-56653393 AGCATTCTTTCCTCTGTTCTGGG + Intergenic
1177082473 21:16657666-16657688 AGCATTCTTTTTTCTCCGCATGG - Intergenic
1177959660 21:27647061-27647083 AGTATTATTTTCTTTACCTTGGG - Intergenic
1181574427 22:23784628-23784650 AACATTGTTTTTTCTACCCGAGG - Intergenic
1181828152 22:25536762-25536784 AACATTCATTTCTCTCCCATGGG + Intergenic
1182753808 22:32662210-32662232 GGCATTCTTTTCTCCTCCCTTGG + Intronic
1183256350 22:36764947-36764969 AGGATTCTCTTCTGTACCCTGGG - Intronic
949185764 3:1189774-1189796 GGCATTTTTTTCTCTTCCTTGGG - Intronic
949811623 3:8012666-8012688 AGCCTCCTTTTCTCTAACCTGGG + Intergenic
951932607 3:27985619-27985641 AGCCGTCTTTTTTCTAGCCTTGG - Intergenic
952505692 3:34005117-34005139 AGCAGTCCTTCCTCTAGCCTTGG + Intergenic
953670340 3:44957033-44957055 TCTACTCTTTTCTCTACCCTTGG + Intronic
953730627 3:45444354-45444376 AGCATTTTTTTTTTTCCCCTAGG - Intronic
954635914 3:52070778-52070800 AGCTTCCTTTTCTCAGCCCTAGG - Intergenic
955374806 3:58386040-58386062 AGCTTCCTTCTCTCTTCCCTGGG + Intronic
955618692 3:60837280-60837302 AACATTTTTTTCTCTTCTCTTGG - Intronic
955948947 3:64222736-64222758 AGCATTTTCTTCTCTATCCAGGG - Intronic
956237339 3:67088687-67088709 AGGATTTTTTTTTCTACTCTGGG - Intergenic
958839533 3:99186814-99186836 AGCATTTTTTGATCCACCCTGGG + Intergenic
959919452 3:111854921-111854943 AGCATTCTTGCCTCTCCCCAAGG - Intronic
960676623 3:120201499-120201521 AAATTTCTTTTCTCTATCCTCGG + Intronic
962882979 3:139596266-139596288 ATAATTTTTTTCTCTACCCCTGG + Intronic
963120523 3:141772717-141772739 AGCATTTTTTTCTTTTCTCTAGG + Intergenic
963180000 3:142344928-142344950 AGGATTGTTTTCTCTATTCTGGG - Intronic
964889648 3:161519789-161519811 AGCATTATTCTCTCTCCACTTGG + Intergenic
965809584 3:172578074-172578096 AGCATTCCTTTGTCCACACTGGG + Intergenic
967574288 3:191072293-191072315 AGGACTCTTTTCTCTGCACTGGG + Intergenic
967693269 3:192502079-192502101 AAAATTCTCATCTCTACCCTAGG - Intronic
968796307 4:2707512-2707534 TGCATTCTTTTATTTACACTAGG - Intronic
969559192 4:7935783-7935805 AGAGTTCTTTTCTCTAGCCCTGG - Intronic
970239070 4:13989215-13989237 ATTATTCATTTCTCCACCCTTGG - Intergenic
970624568 4:17862533-17862555 AGCCTTCTTTTCTGTTCCATTGG - Intronic
971119188 4:23685160-23685182 AGCATTCTTTTCTCTGTTCCAGG + Intergenic
971513472 4:27457136-27457158 GGCAATCTTTTCTCCACCCTGGG - Intergenic
972871658 4:43307830-43307852 AACATTTTGTTCTCTACTCTTGG - Intergenic
975314142 4:72932494-72932516 AGCCTTGTTTTCTCTGCCCTAGG + Intergenic
975445393 4:74458280-74458302 ACCTTTGTTTTCTCTTCCCTGGG + Intergenic
977416837 4:96743955-96743977 AGCAGTCTTTGCTCTAAGCTGGG + Intergenic
979372288 4:119903554-119903576 AGGATTCTTTTGGCTACTCTGGG - Intergenic
979429245 4:120607642-120607664 AGCATTTGTTTCTCTTCTCTTGG + Intergenic
982671601 4:158326511-158326533 AGCATTCTCTTCCCTACTTTAGG - Intronic
983372123 4:166873753-166873775 ACAATTATTTTCTCTACACTAGG + Intronic
983852378 4:172597363-172597385 ATCTTTGTTTTCTCTACACTTGG + Intronic
984354665 4:178642366-178642388 AGAATTCTTTGCTCAGCCCTAGG - Intergenic
984987105 4:185341971-185341993 ACCATTCTCTTCTGTAACCTTGG - Exonic
985873261 5:2575719-2575741 AGCATTCTTTACTCTTCCCATGG - Intergenic
986970471 5:13329628-13329650 AGCATTCTTTTCTATAGTGTGGG - Intergenic
990038939 5:51356165-51356187 AGCTCTCTTTTCTCAACTCTGGG + Intergenic
990872107 5:60443500-60443522 AGCATTCTTTTCTCTACCCTGGG - Intronic
990872887 5:60452522-60452544 ATCATTGTCTTCTTTACCCTGGG - Intronic
993845483 5:92937514-92937536 AGCATTATTTACTCTGCTCTTGG - Intergenic
994772953 5:104006839-104006861 AGCATCCTTTTCTTTGCTCTTGG + Intergenic
995216255 5:109598320-109598342 AGCATAATTTGCTCTGCCCTTGG + Intergenic
995468861 5:112479139-112479161 AGCATTCTTCTCTCTCCCACTGG + Intergenic
995816335 5:116172520-116172542 TGCTTTCTGTTATCTACCCTAGG + Intronic
995981132 5:118105628-118105650 AGCACTCTTATCTCTTTCCTTGG + Intergenic
997447673 5:133953325-133953347 AGCCTTCTTTTCTGTTCCCTTGG + Intergenic
1000237591 5:159376841-159376863 GGCATCATTTTCTCTTCCCTGGG - Intergenic
1001065333 5:168530816-168530838 AGCTCTCTTTCCTCTGCCCTAGG - Intergenic
1001733681 5:173980995-173981017 GGTATTCTCTTCTCTCCCCTAGG + Intronic
1002363870 5:178695186-178695208 ATCATTCTTTGCTCTACTCAGGG + Intergenic
1003879333 6:10466047-10466069 AGCCCCCTTTTCTCTAGCCTCGG + Intergenic
1004921365 6:20379251-20379273 AGCACTATTTTCTCTATCTTTGG - Intergenic
1006822546 6:36909570-36909592 AAAATTTTTTTATCTACCCTGGG + Intronic
1009225715 6:61018648-61018670 AACATTATTTTCTCTCCCCCTGG + Intergenic
1010158241 6:72820663-72820685 AGCATTTTTTTTTCTCTCCTTGG + Intronic
1010936152 6:81864430-81864452 AGCTTTCATATCTCTACTCTTGG + Intergenic
1011003675 6:82620095-82620117 AGCATTGTTTTCCCTACTCTGGG - Intergenic
1011238559 6:85245581-85245603 AGCATTCTTTTCTCTTCCTGTGG + Intergenic
1011263591 6:85492784-85492806 AGCATGCTGGTCTCTGCCCTAGG - Intronic
1011925209 6:92634226-92634248 AACTTTCTCTTCTCTTCCCTTGG - Intergenic
1012981737 6:105838023-105838045 AGCCTTCTTTTATCTTCCCGTGG + Intergenic
1014138089 6:117910495-117910517 TGTCTTCTTTCCTCTACCCTTGG + Intronic
1014527605 6:122519589-122519611 ATCATTCTTTCCTCTTGCCTTGG - Intronic
1015201929 6:130592606-130592628 AGCATCCTTATCTCTTGCCTGGG - Intergenic
1015584887 6:134765635-134765657 AGAATTGTTTTCTCTTCCATTGG - Intergenic
1016312455 6:142748541-142748563 AGCATATGTTTCTCTACACTCGG + Intergenic
1016672718 6:146727671-146727693 AGCATTAGTCTCTCTGCCCTTGG - Intronic
1017468849 6:154720147-154720169 TTCATTCCTTTCTCTACCCTAGG - Intergenic
1018164439 6:161079962-161079984 AGGATTCCTTTCTCTATCCTAGG - Intronic
1018237026 6:161736548-161736570 AGCCTCCTTTTCTTTGCCCTGGG - Intronic
1018449202 6:163891029-163891051 AGCATTTTTTTCTCTTTCTTAGG + Intergenic
1018529664 6:164749487-164749509 CAGAATCTTTTCTCTACCCTTGG - Intergenic
1018852024 6:167647643-167647665 AGCATGCTTTCCTCTGCCCCTGG - Intergenic
1019882342 7:3874092-3874114 AGCATGCTTTTCTTTCCACTGGG + Intronic
1020465072 7:8468604-8468626 GGGATTCTTTTCTGTACCTTAGG + Intronic
1022161446 7:27715132-27715154 CACATCCTTTCCTCTACCCTTGG - Intergenic
1022336036 7:29423153-29423175 TTCCTTCTTTTCTCCACCCTGGG - Intronic
1023345909 7:39271011-39271033 AGCAGTCTCTTCTCTAGCCAGGG + Intronic
1024973859 7:55095288-55095310 AGCATCCTTTTCTGTACAGTGGG + Intronic
1025524898 7:61793149-61793171 ATCATTCTTTTTTTTATCCTGGG + Intergenic
1027008846 7:74723932-74723954 AGCACTCTTCTCTGTGCCCTAGG - Intronic
1028623539 7:92851130-92851152 AGCATTCTTTTTGCTACCTTCGG - Intergenic
1030484304 7:110147312-110147334 AGAATTCTTTTTTCTTCCTTAGG + Intergenic
1030713464 7:112781808-112781830 AGAATTCTTTGCTCAACACTAGG - Intronic
1031656486 7:124362386-124362408 AGCATTTTTTCATATACCCTTGG - Intergenic
1032264054 7:130358353-130358375 GGCATTCTAGTCTGTACCCTTGG - Intronic
1032527277 7:132588305-132588327 GGCATTCTTATCTCTCCCTTGGG + Intronic
1033477700 7:141706633-141706655 AGATTTCTTTTCTATAGCCTTGG - Intergenic
1033590676 7:142805691-142805713 AGCATGCTTTGCTCTGCACTGGG - Intergenic
1035637828 8:1160432-1160454 TGCATAATTTTCTCTAGCCTTGG + Intergenic
1035986240 8:4434990-4435012 TGCATACTTTTGTCTACTCTTGG + Intronic
1037026778 8:14048280-14048302 AACATTCTTTTCTTAACCCCAGG - Intergenic
1039366211 8:36930741-36930763 AGTATTGTTTTCTCTGCACTTGG + Intronic
1042207117 8:66340422-66340444 AACATTCCTTTCACTTCCCTTGG - Intergenic
1042242629 8:66679922-66679944 AGTCTTCTGTTCTCTAACCTTGG + Exonic
1044297881 8:90549431-90549453 AGCATTCTTCTGTCAACCCAAGG + Intergenic
1044439211 8:92203630-92203652 AGCATTTTTTTCTCTTATCTGGG + Intergenic
1044580656 8:93822734-93822756 AGCATTCAATTCCCTAACCTGGG - Intergenic
1044905445 8:96996221-96996243 CTCATTCTTACCTCTACCCTTGG - Intronic
1046910369 8:119619642-119619664 AACATTCTTTTCTCCACCACTGG + Intronic
1047175971 8:122540641-122540663 AGCATATTTTTTTCTACACTTGG - Intergenic
1048028620 8:130609995-130610017 AGCATTATTTTTTCTTCTCTGGG - Intergenic
1048375762 8:133821129-133821151 CCCATTCTTACCTCTACCCTAGG + Intergenic
1049328445 8:142037054-142037076 AGCATTCCTGTCTCTGCCCCTGG - Intergenic
1050293384 9:4180144-4180166 CTCATTCTGTTCTCTATCCTAGG - Intronic
1050787469 9:9423500-9423522 TGCATTTAATTCTCTACCCTAGG - Intronic
1050827195 9:9962233-9962255 AGCATGCTTTTCTTTCTCCTAGG - Intronic
1051250890 9:15157645-15157667 AGCATTTTTTTCTCTGACCCAGG + Intergenic
1051682149 9:19618266-19618288 AGCCTTCTTTTCTTTCCCCTGGG - Intronic
1052318681 9:27143869-27143891 CTCATGCTTTCCTCTACCCTGGG - Intronic
1052337092 9:27331220-27331242 AGCCATCCTTTCTCTACCCCTGG + Intronic
1052782345 9:32794485-32794507 AGCATTCTTAGCCCTACCCAAGG + Intergenic
1053643297 9:40107534-40107556 TGCATTTTTTTCTCTGCCCCAGG - Intergenic
1053762855 9:41357956-41357978 TGCATTTTTTTCTCTGCCCCAGG + Intergenic
1054541458 9:66269069-66269091 TGCATTTTTTTCTCTGCCCCAGG + Intergenic
1054761948 9:69012246-69012268 AGCAGACTTTTCTTCACCCTTGG - Intergenic
1055883926 9:81036562-81036584 ACGTTTCTTTTCTCTACCATTGG - Intergenic
1058063503 9:100524302-100524324 AGTATTCTATTTTGTACCCTAGG - Intronic
1060962299 9:127689796-127689818 AGCCTTCTTTTGCCTGCCCTTGG + Intronic
1061241581 9:129377341-129377363 AGCATTCTTCCCTCTAATCTTGG + Intergenic
1061884067 9:133582805-133582827 AGCACTCATGTCTCTACCCAAGG - Intronic
1185718952 X:2366570-2366592 AGCATTCTTTGCTGCATCCTGGG + Intronic
1186360024 X:8831266-8831288 AGCATTCTTTTGGCTACAGTAGG - Intergenic
1187470014 X:19561231-19561253 AGTATGCTTTTTACTACCCTAGG + Intronic
1187504611 X:19868827-19868849 AGCATTATTCTGTCTACCGTAGG - Intronic
1188918436 X:35941261-35941283 GGCCTTCTTTTCTCCTCCCTAGG + Exonic
1190000957 X:46686154-46686176 AACCTTTTCTTCTCTACCCTGGG + Intronic
1193513525 X:82434714-82434736 AACATTTTTTTCTCTCACCTTGG - Intergenic
1195553667 X:106197126-106197148 ATCATTCTTTCCTCTCCCCATGG + Intronic
1196892327 X:120303186-120303208 TGGATTGTTTTATCTACCCTAGG - Intronic
1198468606 X:136925597-136925619 AACTTTGTTTTCTCAACCCTAGG + Intergenic
1200842069 Y:7792497-7792519 AGCTTTTTTTTCCTTACCCTTGG - Intergenic
1200898281 Y:8400096-8400118 TGCATGGTTTCCTCTACCCTCGG - Intergenic