ID: 990873875

View in Genome Browser
Species Human (GRCh38)
Location 5:60462727-60462749
Sequence GGTAGTGAATGATCATCTTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 80}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990873875_990873880 16 Left 990873875 5:60462727-60462749 CCTTAAGATGATCATTCACTACC 0: 1
1: 0
2: 1
3: 8
4: 80
Right 990873880 5:60462766-60462788 CATAAATCATTGCCATCCATTGG 0: 1
1: 0
2: 0
3: 9
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990873875 Original CRISPR GGTAGTGAATGATCATCTTA AGG (reversed) Intronic
905780709 1:40706751-40706773 GGTAGTCAAAGATTTTCTTATGG - Intronic
907488613 1:54794429-54794451 GGTAGTGAAAGATCTTCTATTGG - Intronic
907820942 1:57967824-57967846 GGTGGTGAATGATTATTATAAGG + Intronic
917908012 1:179608761-179608783 GGTAGAATATGATCATGTTAGGG - Intronic
918115423 1:181492004-181492026 GGGAGTGAAGGATCATCACATGG + Intronic
920834646 1:209498611-209498633 CATGGTGAATGATCATTTTATGG + Intergenic
923435448 1:233963802-233963824 GATAGTGAATGACCTCCTTATGG - Intronic
1068095046 10:52480794-52480816 GGTAGTGAAGAATCACCTTTTGG - Intergenic
1072935700 10:99711110-99711132 TCTGGTGAATGATTATCTTAGGG - Intronic
1073857426 10:107693687-107693709 GGTAGTAAATGGTCATTTTATGG - Intergenic
1075673109 10:124277624-124277646 GGGAATGAATGACCATCTTCAGG - Intergenic
1078797702 11:14609617-14609639 TGTAGTGAATGATCATTTTAGGG + Intronic
1080042337 11:27772053-27772075 GGTAGGGAATGGTCATCCTAAGG + Intergenic
1093989951 12:25578575-25578597 GGTAGTGAATCTTCATATCAAGG - Intronic
1100870429 12:98905134-98905156 GCTAGTCAATGAACCTCTTAGGG - Intronic
1103192378 12:119012594-119012616 GGTAGACAAAGATCATCTTGGGG - Intronic
1110091722 13:71458066-71458088 GGTAATGAGTGTTCATCTTTTGG - Intronic
1110283318 13:73720569-73720591 AGTAGTGAATGAACACCTGAGGG + Intronic
1125698953 15:41662799-41662821 TATAGTGAAGGATCATATTAAGG + Intronic
1126667655 15:51089725-51089747 GTAAGTGAATGAGCATCTTGAGG - Intronic
1126704021 15:51391144-51391166 GGAAATGCATGATCATTTTATGG - Intronic
1128589878 15:68886461-68886483 GATAGTGAAAGATAATTTTACGG + Intronic
1130695823 15:86130228-86130250 GGTAGTGTATGTTCATCTGCTGG - Intergenic
1131945141 15:97611270-97611292 GGAAGTAAATGATCATCTGAAGG + Intergenic
1138229866 16:55328986-55329008 GGTAGTGCATGGTCAACCTAGGG - Exonic
1140155158 16:72417419-72417441 GGTAGTTAATAATCATATAAAGG - Intergenic
1143597224 17:7922573-7922595 GGAAGTAAATGATAATCTTTGGG - Exonic
1152158800 17:78653947-78653969 TGCAGTGAATGATCATGTGAAGG + Intergenic
1155904852 18:31437540-31437562 AGTAGTGAATGATGCTCTTTGGG + Intergenic
1163137956 19:15326634-15326656 AGTAGTGCATGGTCATTTTAAGG - Intronic
1163922756 19:20308176-20308198 TGTAGTGAATGATCAGCCTCTGG + Intergenic
1163946432 19:20539885-20539907 TGTAGTGAATGATCAGCCTCTGG - Intronic
1163954141 19:20619308-20619330 TGTAGTGAATGATCAGCCTCTGG - Intronic
1163961556 19:20700223-20700245 TGTAGTGAATGATCAGCCTCTGG + Intronic
1163972961 19:20817940-20817962 TGTAGTGAATGATCAGCCTCTGG + Intronic
1164131978 19:22371847-22371869 TGTAGTGAATGATCAGCCTCTGG - Intergenic
1164167646 19:22696215-22696237 TGTAGTGAATGATCAGCCTCTGG + Intergenic
928059587 2:28097436-28097458 GGTAATTAAAGATCATTTTAAGG - Intronic
934191880 2:89805839-89805861 CGAAGTGAATGATCATCGAATGG + Intergenic
943945852 2:194062838-194062860 GGTAGTAAATGATCAGCATTTGG - Intergenic
944767443 2:202878802-202878824 GGTTGTGAATGCTCTACTTAAGG + Exonic
946535148 2:220619730-220619752 GGGAGTGATTAATCACCTTAGGG - Intergenic
1170301280 20:14886962-14886984 AGAAGTGTATGATCATCTTGTGG - Intronic
1174336793 20:49868134-49868156 GGTACTCAATGATCTTCTCAAGG - Intronic
1177206839 21:18020046-18020068 GGCATTGAATGATCCTTTTAAGG + Intronic
1203320871 22_KI270737v1_random:59336-59358 TGAATTGAATGACCATCTTATGG + Intergenic
955074724 3:55602734-55602756 GGGGGTGAATGAACATCTGATGG - Intronic
959183467 3:103011580-103011602 GCTAGTGAATGATTTCCTTAAGG + Intergenic
960524426 3:118693398-118693420 GGTACTGAATGATCACTTTCTGG + Intergenic
966019415 3:175189059-175189081 GAGAGTGAATCTTCATCTTATGG + Intronic
966261001 3:177979305-177979327 GGTAGAGAAAGACCATTTTAAGG - Intergenic
967457810 3:189709888-189709910 GGTAATGCATGTCCATCTTATGG - Intronic
970591269 4:17562441-17562463 GGTGGAGACTGAGCATCTTATGG + Intergenic
972799911 4:42463323-42463345 GATAGTGAATAACCATCTTGAGG + Intronic
974264703 4:59569775-59569797 GTTACTGTATGAACATCTTAGGG - Intergenic
977502324 4:97856357-97856379 GGAAGTGAAGGATCTTTTTAAGG - Intronic
978761856 4:112361609-112361631 GGTAGTGAAAGGTCATCAGATGG - Intronic
979569127 4:122195672-122195694 TGTAGTCAATGATCATCTAATGG + Intronic
981533716 4:145777738-145777760 GGAACTTAATGGTCATCTTAAGG - Intronic
989116005 5:37952706-37952728 GGTAGTGAAATGTCATCGTAAGG - Intergenic
990873875 5:60462727-60462749 GGTAGTGAATGATCATCTTAAGG - Intronic
993444038 5:87990136-87990158 GGTAGTGAAATGTCATCTTCAGG - Intergenic
993917061 5:93756266-93756288 GTTAGGGAAGGATCATCATATGG - Intronic
999837912 5:155394386-155394408 GGTAGTGAATGATCAGCCTCTGG + Intergenic
1009912827 6:69954045-69954067 GGTATTGAATGAACCTGTTAGGG + Intronic
1013373830 6:109494976-109494998 GTCAGTGAATGATCCTCTCACGG + Intronic
1014580782 6:123134926-123134948 CTTAGAGAATGATCACCTTAAGG - Intergenic
1015663295 6:135600342-135600364 GGTAGTGAAGGACCATCTGATGG + Intergenic
1020399939 7:7764555-7764577 GATAGTGAAATAACATCTTAAGG + Intronic
1020711287 7:11608743-11608765 GGTTGTGGATGTTCATCTAAGGG - Intronic
1022278859 7:28884781-28884803 GGGAGTGAATGAACCTCTTATGG + Intergenic
1024527693 7:50362792-50362814 GGTTGAGGATGATAATCTTAGGG + Intronic
1025770899 7:64505600-64505622 CGTAGTGAATGATCAGCCTCTGG - Intergenic
1028215619 7:88128655-88128677 GATTGTGAATGATCACCTTATGG + Exonic
1033726699 7:144126461-144126483 TGTAGAGAATGATCCTCTTTTGG + Intergenic
1034017297 7:147600794-147600816 GGTAGTGAATATTTATTTTAGGG - Intronic
1039429817 8:37517061-37517083 GGTAGTCAGTGATTATCCTAGGG - Intergenic
1041901757 8:62989953-62989975 GGCAGGGAATGATAACCTTATGG - Intronic
1042638871 8:70910163-70910185 GGCAGTGAATGACTTTCTTAAGG + Intergenic
1042709417 8:71699695-71699717 CTTATTGAATCATCATCTTAAGG + Intergenic
1048337119 8:133511132-133511154 GGCAGTAAATACTCATCTTAGGG + Intronic
1055847713 9:80587274-80587296 GGAAGTGAATGAGTTTCTTATGG - Intergenic
1056773237 9:89494909-89494931 TGGAGTGAATGATGATTTTAAGG - Intronic
1057102484 9:92376213-92376235 GGTAGGGAATGAGAATCTTTGGG - Intronic
1189882677 X:45508633-45508655 GGTAATTAGTCATCATCTTATGG + Intergenic
1194023712 X:88725508-88725530 GGCAGTAAATAATCACCTTAAGG + Intergenic
1194180795 X:90709578-90709600 GGTAGTCAAGAACCATCTTAGGG + Intergenic
1196679264 X:118454261-118454283 ATTAGTGAATGACCATGTTAAGG - Intergenic
1197669773 X:129263675-129263697 GGTAGGGAACAATCAACTTAAGG + Intergenic
1200527458 Y:4291734-4291756 GGTAGTCAAGAACCATCTTAGGG + Intergenic