ID: 990875140

View in Genome Browser
Species Human (GRCh38)
Location 5:60475855-60475877
Sequence CCCTGCAACGCTATGTGATG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 110}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990875140_990875142 5 Left 990875140 5:60475855-60475877 CCGCATCACATAGCGTTGCAGGG 0: 1
1: 0
2: 0
3: 4
4: 110
Right 990875142 5:60475883-60475905 TGAGTGAAATGTCATATAGAAGG 0: 1
1: 0
2: 1
3: 12
4: 223

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990875140 Original CRISPR CCCTGCAACGCTATGTGATG CGG (reversed) Intronic
900480548 1:2896054-2896076 CCCTGCCACACTTTGAGATGCGG - Intergenic
905494463 1:38373725-38373747 CCCTGCAAAGCTATCTTTTGTGG - Intergenic
911330195 1:96518207-96518229 CCTTGAAACACTATGTGAAGTGG - Intergenic
913614000 1:120538072-120538094 CCCTGCAAAGCTATCTGAAAAGG + Intergenic
914373894 1:147055043-147055065 CCCTGCAAAGCTATCTGAAAAGG + Intergenic
914576267 1:148972821-148972843 CCCTGCAAAGCTATCTGAAAAGG - Intronic
916933860 1:169607125-169607147 CACTGCAAAGCTAAGGGATGAGG + Exonic
921157139 1:212447509-212447531 CCCTACATCACTATGTAATGTGG + Intergenic
924903218 1:248424320-248424342 CCCTGCAAAGCTATCTTTTGTGG - Intergenic
924903340 1:248425817-248425839 CCCTGCAAAGCTATCTTTTGTGG + Intergenic
924924522 1:248665987-248666009 CCCTGCAAAGCTATCTTTTGTGG - Intergenic
1064737272 10:18395270-18395292 CCCTGCAACGCATTGAGAAGAGG - Intronic
1068602967 10:58974943-58974965 CCCTGCAAAGCTATCTCTTGTGG + Intergenic
1068921497 10:62489441-62489463 CCCTGCAAAGCTCTGAGAAGAGG + Intronic
1076471633 10:130723054-130723076 CCCTGCAAAGCTATCTCTTGTGG - Intergenic
1077187879 11:1243555-1243577 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077188300 11:1245226-1245248 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077188835 11:1247326-1247348 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077189254 11:1248997-1249019 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1078532948 11:12151078-12151100 CCCTGGAAGCCAATGTGATGTGG - Intronic
1084535053 11:69751516-69751538 CCCAGCAAGGCTGGGTGATGTGG + Intergenic
1084601994 11:70151346-70151368 CCCTGCAGAGCTGTGTGCTGTGG - Intronic
1087624487 11:100581461-100581483 CTGTGCAAAGCAATGTGATGTGG - Intergenic
1098509795 12:71298309-71298331 CAATGCAATGCTGTGTGATGAGG - Intronic
1100299120 12:93291004-93291026 CCCTGCAAAGCTATCTCCTGTGG + Intergenic
1102444388 12:112990624-112990646 CCCTGCAAAGCTGTGTCCTGTGG - Intronic
1103324908 12:120114045-120114067 CCCTGCTGAGCTATGTGATTTGG + Intronic
1103510790 12:121472338-121472360 CCCTGGAATGCTATGTTAAGTGG - Intronic
1105967523 13:25398145-25398167 CCCTGCAAAGCCATCTCATGTGG - Intronic
1112886374 13:104177581-104177603 CCCTGCAAAGCTATCTGGTGTGG + Intergenic
1113597424 13:111543528-111543550 CCCTGTTAAGCTCTGTGATGGGG - Intergenic
1113598855 13:111554257-111554279 CCCTGCAAAGCTGTGTTTTGTGG + Intergenic
1115938623 14:38583747-38583769 CCCTGCAAAGCCATGTTTTGTGG + Intergenic
1117718012 14:58600417-58600439 GCCTGCCAGGCTATGTGTTGTGG - Intergenic
1125318590 15:38458466-38458488 CACTGAAACGCTATATGCTGGGG + Intronic
1129714301 15:77838050-77838072 CCCCTCAGAGCTATGTGATGCGG + Intergenic
1130728731 15:86467684-86467706 CCCTGAAATACTGTGTGATGAGG - Intronic
1135393059 16:22110258-22110280 CTCTGCAGCGTGATGTGATGTGG + Intronic
1136023791 16:27456903-27456925 CCCTGGAAGGCGGTGTGATGGGG + Intergenic
1138337437 16:56264158-56264180 CACTGCAACCCCAGGTGATGAGG - Intronic
1139361272 16:66401715-66401737 CCCGGCAACCCTATGGGAGGAGG - Intronic
1139368803 16:66452001-66452023 GCCTGCAAAGCAATCTGATGGGG + Intronic
1140656977 16:77151111-77151133 TCCAGCAACTCTATGTGATTGGG - Intergenic
1145785537 17:27591460-27591482 CCCTGCATTGCTGTGTGATCTGG + Intronic
1150445063 17:65222366-65222388 CCCAGTCAGGCTATGTGATGAGG - Intronic
1153348513 18:4053606-4053628 TCCTGCTTCGCTATGTGAAGAGG + Intronic
1155954576 18:31946358-31946380 CCCTGCAAAGCTATTTTGTGGGG + Intronic
1160088371 18:75801468-75801490 CCCTGGAGGGCCATGTGATGAGG - Intergenic
1163746128 19:19048771-19048793 CCCTGCAAAGCTATCTCTTGTGG - Intronic
1165309935 19:35023684-35023706 CCCTGCAATGCTGTGGGGTGGGG - Intronic
1165341793 19:35217824-35217846 CCCTGCAACACTATGCCATTGGG + Intergenic
927593139 2:24374014-24374036 TCCTCCAACGCTAGGGGATGGGG - Intergenic
928867258 2:35931749-35931771 CCAAGCAAAGCTATGTGCTGTGG + Intergenic
933249694 2:80015450-80015472 CCCTGAAGCGCTCTCTGATGGGG + Intronic
934141197 2:89049592-89049614 CCCTGCAAAGCTACCTGTTGTGG + Intergenic
934228042 2:90150953-90150975 CCCTGCAAAGCTACCTGTTGTGG - Intergenic
937312038 2:120908556-120908578 CCCTGCAGCCATCTGTGATGTGG + Intronic
938149380 2:128868876-128868898 CCCTGCAAGGCAATGAGATCTGG + Intergenic
944301437 2:198129142-198129164 CCCTGCAAAGCTATCTCTTGTGG + Intronic
946089685 2:217209830-217209852 CCCTGCAAAGCTATCTTTTGTGG + Intergenic
946291191 2:218746719-218746741 CCATGAAACCCTATGGGATGAGG - Intronic
947611685 2:231528655-231528677 CCCTGGAGCTCTATGAGATGTGG - Exonic
948480780 2:238249008-238249030 CCCTAAAAGGCTCTGTGATGGGG - Intronic
1169871502 20:10253484-10253506 CCCACCAGCTCTATGTGATGTGG - Intronic
1171165180 20:22963874-22963896 CCCTGCAAAGCTATCTCTTGTGG - Intergenic
1175430045 20:58895104-58895126 TGCTGCATCGCTACGTGATGTGG + Intronic
1177873048 21:26596710-26596732 CACTGCAACCCTGTGTGATGGGG + Intergenic
1183069579 22:35386869-35386891 CCATGCAGCGCTATGTGAAGCGG + Exonic
949403313 3:3688242-3688264 CCCTGCAAAGCTATCTCTTGTGG - Intergenic
952666011 3:35905225-35905247 CCCTGCAAAGCTATCTCTTGTGG - Intergenic
952966547 3:38624472-38624494 CCCAACAACCATATGTGATGGGG + Intronic
954876353 3:53805508-53805530 CCCTGCTGCACTCTGTGATGGGG + Intronic
957288029 3:78241834-78241856 CCCTGCAAAGCTATCTTTTGTGG + Intergenic
960447234 3:117763417-117763439 CTCTGAAAAGCTATGGGATGTGG + Intergenic
966930892 3:184674806-184674828 CCCGGCTACACTGTGTGATGGGG - Intronic
967068767 3:185943717-185943739 ACCTACAAAGCTATCTGATGTGG - Intergenic
969400759 4:6953997-6954019 CCCTGCCACGGCATGTGGTGCGG + Intronic
970503162 4:16699312-16699334 CCAACCAACGCTATGTGATAAGG + Intronic
974488105 4:62529699-62529721 CCCTGCAAAGCTGTGTTTTGTGG - Intergenic
975490663 4:74984931-74984953 CCCTGCCATCCTCTGTGATGAGG - Intronic
976582240 4:86750791-86750813 CTCTGCAACGGTTTGTGGTGGGG - Exonic
981091939 4:140741298-140741320 CCCTGCAAAGCTATCTCTTGTGG + Intronic
985359014 4:189152791-189152813 CCATGCAACGCTACATGATTTGG - Intergenic
985359116 4:189153662-189153684 CCCTGCACAGCTTTGTCATGTGG - Intergenic
986949548 5:13066175-13066197 CCCTGCAACGCTGTTTCTTGTGG - Intergenic
987965244 5:24864293-24864315 CCCTGCAACGCTGTCTCTTGCGG - Intergenic
989315365 5:40071788-40071810 CCCAGCAAAGCCATGGGATGGGG + Intergenic
990875140 5:60475855-60475877 CCCTGCAACGCTATGTGATGCGG - Intronic
991334848 5:65535605-65535627 CCCTGCAACTATGTGTGACGTGG - Intronic
992364111 5:76074265-76074287 CCCCACAATGCTGTGTGATGCGG + Intergenic
998058547 5:139100434-139100456 GCCTGCACAGCTCTGTGATGCGG - Intronic
1001076993 5:168637251-168637273 CCCTGCAAAGCTATCTCTTGAGG - Intergenic
1002569811 5:180133929-180133951 CGCTGCAAAGCTGTGTGGTGGGG + Intronic
1003330542 6:5124990-5125012 CCCTGCACTGCTAGGTGCTGGGG - Intronic
1007627396 6:43254221-43254243 CCCAGCAAGGCAATGTGATTTGG - Intronic
1015681670 6:135815257-135815279 CCCTGCAAAGCTATCTCTTGTGG - Intergenic
1015865923 6:137726434-137726456 CCCTACAACAATCTGTGATGTGG + Intergenic
1016028580 6:139314131-139314153 CCCTGCAAAGCTATCTCTTGTGG + Intergenic
1016539268 6:145145270-145145292 CCCTACAAGGCCTTGTGATGTGG + Intergenic
1017063685 6:150509063-150509085 CCCTGCAACGCCATCTTTTGTGG + Intergenic
1017232998 6:152092682-152092704 CCCTGCAAGGCGCTGTGATTAGG + Intronic
1032398326 7:131606696-131606718 CCCTGCAAGGCCCTTTGATGTGG + Intergenic
1039029520 8:33294456-33294478 CCCAGCAAAGCCATGGGATGGGG - Intergenic
1039740643 8:40379705-40379727 CTCTGCATCCCTCTGTGATGTGG + Intergenic
1040919461 8:52600131-52600153 CCTTGCAGGGCTGTGTGATGAGG - Intergenic
1041177574 8:55212324-55212346 CCCTGCAAAGCTATCTCCTGTGG - Intronic
1042742749 8:72069045-72069067 CCCTGCACAGCTATGTGGAGAGG + Exonic
1043002822 8:74780331-74780353 CCCTGCAAAGCTGTCTTATGTGG + Intronic
1046866717 8:119159221-119159243 CCCTGCAAAGCTGTGTCTTGTGG - Intergenic
1048702979 8:137115489-137115511 CCCTTCAACGCTGTGTGCTTTGG - Intergenic
1055045627 9:71921189-71921211 CCCTGCAAAGCTGTGTTTTGTGG + Intronic
1057580046 9:96279638-96279660 CCCTGCAAAGCTCTCTGTTGTGG - Intronic
1061710330 9:132482982-132483004 CCCTTCCAGGCTATGTGAGGGGG + Intronic
1185962964 X:4565715-4565737 CTCTGCAACGCTCTGACATGGGG + Intergenic
1200817926 Y:7553090-7553112 CCCTGAAAAGCTATCTGATGGGG + Intergenic