ID: 990875298

View in Genome Browser
Species Human (GRCh38)
Location 5:60477521-60477543
Sequence CTGTTAAGATGGAGGAAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 486
Summary {0: 1, 1: 0, 2: 7, 3: 40, 4: 438}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990875298 Original CRISPR CTGTTAAGATGGAGGAAAAA AGG Intronic
900271652 1:1793162-1793184 CTGTGAACATGGAGGAAATAAGG - Intronic
901343820 1:8520430-8520452 CTGGTAAGATGCAGTAAATATGG + Intronic
901352100 1:8606570-8606592 TTCTTAAGATGGAAGGAAAAAGG - Intronic
901419772 1:9143068-9143090 AAGTTAAAAGGGAGGAAAAAAGG - Intergenic
902956774 1:19930567-19930589 CTGTTAAAATTGTGGACAAATGG - Intergenic
905197541 1:36292128-36292150 CTGAGAAGAGGAAGGAAAAATGG - Intronic
907681463 1:56568132-56568154 GTGGGAAGGTGGAGGAAAAATGG + Intronic
907713582 1:56907111-56907133 CAGTTCAGAGGGAGGAAATAAGG + Intronic
908177382 1:61569230-61569252 CTGTTAACAAGGAGGAAAGTCGG + Intergenic
908464516 1:64378984-64379006 CGGATAAGAAGGAGGAAGAATGG - Intergenic
909004625 1:70260634-70260656 CTCTTATGATGGTGAAAAAAAGG - Exonic
909573368 1:77143494-77143516 CTTTTATTATGGGGGAAAAATGG - Intronic
909744011 1:79070229-79070251 ATGTTACCATTGAGGAAAAATGG + Intergenic
910511775 1:88014774-88014796 CCGTAAGGATGGAGGAACAAAGG - Intergenic
910741776 1:90527099-90527121 ATGTTAAGCTGGAGGAAAGTGGG + Intergenic
911299905 1:96159135-96159157 CTATGAAAATGGAGGAAAAATGG + Intergenic
915204326 1:154258446-154258468 CTATTAAGATGAAGGATATATGG + Intronic
915646826 1:157278543-157278565 CTGTTAGGAAGGAGGAAAATCGG + Intergenic
916102970 1:161408677-161408699 CTGTTAAACTCCAGGAAAAAGGG - Intergenic
916646176 1:166787270-166787292 CTGGCAAGATGGTGGAGAAAGGG - Intergenic
916688428 1:167168908-167168930 ATGTTAAGATGGAAAAAATAAGG + Intergenic
916951789 1:169787901-169787923 CTGATAAGATATAGGAAAATGGG - Intronic
917412757 1:174776691-174776713 CCATTAAAATGGAGGGAAAAAGG - Intronic
918827655 1:189346454-189346476 CTTTGAAGATGGAAGAAGAAGGG - Intergenic
919816398 1:201443506-201443528 TTGTTAAAATGCAGGAAAAGTGG + Intergenic
920849261 1:209617648-209617670 CTGATGAGTTGGAGAAAAAATGG - Intronic
921137083 1:212271231-212271253 CTGTTAACTGGGAGGAAAAGAGG - Intergenic
921608459 1:217182438-217182460 ATGTTAAGTTGGGTGAAAAAAGG + Intergenic
922247864 1:223818038-223818060 CTGTTTACATAAAGGAAAAATGG + Intronic
922987198 1:229874954-229874976 CTGTAAAGGGAGAGGAAAAATGG + Intergenic
923260594 1:232264368-232264390 CTGCAGAGATGGAGAAAAAATGG - Intergenic
923749541 1:236734898-236734920 TTGCCAAGATGGAGGAAGAAAGG + Intronic
924044221 1:240011307-240011329 CTGGTCAGATGGAGGAAAGTTGG - Intergenic
1062996692 10:1872814-1872836 CTGTTAGGCTGGTGAAAAAAGGG + Intergenic
1063001653 10:1929899-1929921 CTGCTAGAATGAAGGAAAAATGG + Intergenic
1066553291 10:36583216-36583238 CTGTGAAGAGGGAAGAAAATTGG - Intergenic
1067986948 10:51159807-51159829 ATGGTCACATGGAGGAAAAAAGG + Intronic
1068857576 10:61812964-61812986 CTATTGAGATGGGGGGAAAATGG + Intergenic
1069336097 10:67352612-67352634 CTGCTAACATACAGGAAAAATGG - Intronic
1069658589 10:70108523-70108545 CTGATAAGAGGGAGGCAAGAAGG - Intronic
1070477642 10:76845863-76845885 CTGTTAATTTGGAGAAAATAAGG + Intergenic
1070640729 10:78167059-78167081 GTGTTCTGATGGAGGAAAAAGGG + Intergenic
1070690319 10:78520090-78520112 CTGTTACAATGGAGGAAATGTGG + Intergenic
1071405077 10:85322068-85322090 CTATTTAGATTGATGAAAAATGG + Intergenic
1071957982 10:90779792-90779814 GTGTCCAGATGGAGGACAAATGG + Intronic
1073748499 10:106497171-106497193 CTGCTAAGATGTAGGCATAAAGG + Intergenic
1074399871 10:113133251-113133273 GTGTTGAGATGGAGGAATAAAGG - Intronic
1074399877 10:113133301-113133323 GTGTTAAGATGGAGGAATAGAGG - Intronic
1074866548 10:117547276-117547298 CTGTTTAGAAGGAGGGAAGAGGG + Intronic
1074966146 10:118492369-118492391 TGGTCAGGATGGAGGAAAAAAGG + Intergenic
1075428440 10:122361046-122361068 CTGGGAAGAGGGAGGGAAAATGG + Intergenic
1075708984 10:124520600-124520622 TTGTTAACATGCAGGACAAAGGG + Intronic
1078360135 11:10661603-10661625 CTTTGAGGATGGAGAAAAAAGGG - Intronic
1079382123 11:19947487-19947509 CAGTGACGATGGTGGAAAAAGGG - Intronic
1079435440 11:20443100-20443122 TTGGTAAGACTGAGGAAAAATGG - Intronic
1080251257 11:30236403-30236425 CTTTTAAAATGGAGTAAAAATGG + Intergenic
1080597372 11:33785610-33785632 CTAATAAGAAGGAAGAAAAAAGG + Intergenic
1081412113 11:42772051-42772073 ATGTGGAGATGGAGGAAAAAAGG + Intergenic
1081506954 11:43727791-43727813 CTGGCAAAGTGGAGGAAAAAAGG - Intronic
1081730507 11:45368801-45368823 CTGTTAAGACAGATGAAAATGGG + Intergenic
1081978625 11:47252207-47252229 CTCTTCAGATGGAAAAAAAATGG - Intronic
1082230284 11:49756706-49756728 ATATTAAGATGTAGGAAACAAGG - Intergenic
1085839298 11:79992710-79992732 CTGTTGAGATGGCAGAATAATGG + Intergenic
1086418540 11:86614460-86614482 CTGCTCAGATGGAGCAAAGAGGG - Intronic
1086619770 11:88872249-88872271 ATATTAAGATGCAGGAAACAAGG + Intronic
1086739943 11:90354321-90354343 CTGTTAAGAGTGAGGGCAAATGG + Intergenic
1086992501 11:93319453-93319475 CTGTTCAAATAGTGGAAAAATGG - Intergenic
1087221876 11:95555094-95555116 CTGTGAAGAAGGAAGTAAAATGG - Intergenic
1087268077 11:96082753-96082775 CTGGAAAGAAGGAGGTAAAAAGG + Intronic
1088215741 11:107506832-107506854 CTCTGAAGATGTAGGAGAAAAGG + Intronic
1088980644 11:114860040-114860062 CTTTGAAGATGGAGGAAGAAGGG + Intergenic
1089433614 11:118443187-118443209 CTGGGAATAGGGAGGAAAAAGGG + Intronic
1090367194 11:126216464-126216486 CTGTAAAGACAGAGGAAAAGAGG - Intronic
1090532536 11:127606007-127606029 CAGTTACGACAGAGGAAAAAAGG + Intergenic
1092445210 12:8549465-8549487 CTGTCAAGAAGAAGGAAAAATGG + Intergenic
1092519036 12:9247478-9247500 CTGTTTAGATGGAGAAACAATGG - Intergenic
1093625400 12:21340772-21340794 CAATTAAGATGGAGAAAGAAAGG + Intronic
1093685797 12:22052728-22052750 ATTTCAAGATGGAGGAAAATGGG + Intronic
1093736255 12:22624382-22624404 CCTTTTAGATGGAGGAAAACGGG - Intergenic
1094038585 12:26098207-26098229 CTTTTAAGATGGTGGAAAAACGG + Intergenic
1094650506 12:32371396-32371418 CTGCCAAGAAGGAGTAAAAAGGG - Intronic
1095163196 12:38940983-38941005 CACTGAAGAGGGAGGAAAAACGG + Intergenic
1095497769 12:42803317-42803339 CTGGTAAGAAGGAGGAAATCTGG + Intergenic
1096311729 12:50526934-50526956 TGGTTAAGACAGAGGAAAAAAGG - Intronic
1096327215 12:50674767-50674789 CTGTGCAGATGATGGAAAAAAGG - Intronic
1096546504 12:52343826-52343848 CTTTGAAGATGGAGGAAGAGGGG - Intergenic
1097557604 12:61159118-61159140 CTGTCAAGATTGTGGAGAAAAGG + Intergenic
1098700425 12:73617031-73617053 CTGTAAAGATAGAGTAAGAAAGG - Intergenic
1099360169 12:81690936-81690958 CTTATAAGAAGGAGGCAAAAGGG - Intronic
1099404221 12:82240332-82240354 CTGTTAAAAAGTAGGCAAAAAGG - Intronic
1101111263 12:101488516-101488538 CTAATAAGAAGGAAGAAAAAAGG - Intergenic
1101213444 12:102557906-102557928 ATGTTCAGATGGAGAAATAATGG + Intergenic
1102726080 12:115066297-115066319 CTTTCGAGATGGAGGAAAATGGG - Intergenic
1106203885 13:27570520-27570542 TTGTTAAGAAGGGGGACAAATGG + Intronic
1106312667 13:28567528-28567550 AGGTGAAGATGGAGGAAAGATGG + Intergenic
1106920171 13:34554698-34554720 CTATTTTGATAGAGGAAAAATGG - Intergenic
1107147627 13:37075782-37075804 CTGTTTAGATGCATGTAAAATGG + Intergenic
1107252265 13:38378500-38378522 CTATTAACATAGAGGAAAATGGG + Intergenic
1107474633 13:40723598-40723620 CTCAAAAGATGCAGGAAAAAAGG - Intergenic
1107846297 13:44516881-44516903 CCTATAAGATGGAGGAAGAAAGG + Intronic
1108588634 13:51892806-51892828 CTGCTAGGACGGAGGAACAAAGG - Intergenic
1109138182 13:58679911-58679933 TTATTAAGATGGAGAAAAACTGG + Intergenic
1109482710 13:62977355-62977377 GTGTTAAGAAGTAGGACAAAGGG + Intergenic
1109511770 13:63386125-63386147 ATGTTATGATGAAGGAAAATAGG + Intergenic
1109704358 13:66070590-66070612 TTGTAAAAATGGAGGGAAAATGG + Intergenic
1109916593 13:68995242-68995264 TTCTTAAGATGGAAGGAAAAAGG - Intergenic
1110441986 13:75536540-75536562 CTTATAAGAGGGAGGAAAAAGGG + Intronic
1110456335 13:75694290-75694312 TTGTTAAGATGGAGAAATGAAGG + Intronic
1110599176 13:77351699-77351721 CTTTGAAGAAGAAGGAAAAAGGG + Intergenic
1111704130 13:91726800-91726822 CTGTGCAGATGGAGGAAAAAGGG - Intronic
1112186237 13:97130482-97130504 CTGTTCAGCTGGAAGAAACAGGG + Intergenic
1113239334 13:108318872-108318894 CTGGTGAGATTGAGGAGAAAAGG - Intergenic
1113247634 13:108416179-108416201 CTGGCAAGATTGAGGAGAAATGG - Intergenic
1113453527 13:110430779-110430801 CTGTTAAGGTTGAAGAATAAGGG + Intronic
1113504903 13:110809175-110809197 CTGGAAAGATGCAGGAGAAATGG + Intergenic
1116836750 14:49776073-49776095 TTGTTAAAATGGAGGAGGAAGGG - Intronic
1117403221 14:55376811-55376833 CTGCTAAGAGCAAGGAAAAAAGG + Intronic
1117533734 14:56684693-56684715 CTCTTAGGATGGAGGAAAAATGG - Intronic
1117547405 14:56804774-56804796 TTTTAAAGATGGAGGAACAAAGG - Intronic
1117658447 14:57980320-57980342 GTGTTAGGATGGAGGCAAATGGG + Intronic
1118554128 14:66994904-66994926 TTTTTAAGATAGAAGAAAAAGGG + Intronic
1119053769 14:71397242-71397264 ATGTCATGATGGAGGAAAAATGG - Intronic
1119363342 14:74070167-74070189 CTGTTATTTTGGAGGAAAATAGG - Intronic
1119916239 14:78404777-78404799 ATGATAAGATGGAGTAATAAGGG + Intronic
1120486880 14:85125266-85125288 CTGTCAGGATGAAGAAAAAAAGG - Intergenic
1121821269 14:96969318-96969340 CTGTTAGGATGTAGAGAAAAGGG + Intergenic
1123768170 15:23502165-23502187 CTGTTAAAATGGAGAAGCAATGG + Intergenic
1123962172 15:25415137-25415159 TTGGTAAGTTTGAGGAAAAAAGG - Intronic
1126108494 15:45162308-45162330 CTTTGAGGATGGAGGCAAAAGGG - Exonic
1126277769 15:46904221-46904243 TTTTGAAGATGGAGGAAAAGGGG - Intergenic
1126525245 15:49646826-49646848 CTGGTAAGAGCGAGGAAGAAAGG - Exonic
1126732071 15:51694013-51694035 GGGTTGAGAGGGAGGAAAAATGG - Intronic
1127077581 15:55342747-55342769 ATGTTAAGACTGTGGAAAAATGG - Intronic
1127576046 15:60293409-60293431 CTGGGAAGATGGAGAACAAAAGG + Intergenic
1128219683 15:65959455-65959477 CTGTTTTGATGGAGGAAAAGTGG - Intronic
1128826301 15:70720469-70720491 CTGTTAAGAAAGGGGAAGAATGG - Intronic
1130868081 15:87949137-87949159 CTGCAAAGAGGGAGGAAGAAGGG + Intronic
1130958271 15:88642437-88642459 CTGTTAAGATAGATGGAATATGG + Intronic
1131263071 15:90899414-90899436 GTGTGAAGATGGAGGGGAAAAGG + Intergenic
1133169550 16:3973109-3973131 CTGTTAAAATGCAGTAAATATGG - Intronic
1134360953 16:13530690-13530712 CTGTAAGGAAGGAAGAAAAAGGG - Intergenic
1135926223 16:26696331-26696353 CTGTTAAGATTAATTAAAAAAGG + Intergenic
1138033996 16:53584004-53584026 CTGTGAAGATGGAGGTCAATTGG + Intergenic
1138292368 16:55858687-55858709 ATTTTAAGCTGGAGGAAATAGGG - Intronic
1138332082 16:56223315-56223337 CTTTTAAGATAGAGGAAAGCAGG - Intronic
1139029828 16:62866522-62866544 CTGTTAATAGGGAAGAAAGAAGG + Intergenic
1140709991 16:77668739-77668761 CAGTTATGATAGAGGAAAGAGGG - Intergenic
1140724982 16:77803758-77803780 CTGTCACGTTGTAGGAAAAATGG + Intronic
1141092395 16:81139267-81139289 ATGTTAACATTGAGGAAATAGGG + Intergenic
1143032259 17:3974297-3974319 CTGTAGAGATGGAGGCAAGAGGG - Intergenic
1143051644 17:4130851-4130873 TTTTTAAGACTGAGGAAAAAGGG + Intronic
1143370009 17:6433748-6433770 ATGTGAAGATGGAGGGAACAAGG - Intronic
1143925882 17:10369888-10369910 CTGTTCAAATGGAGAACAAATGG - Intronic
1144926800 17:18818243-18818265 CTGTTAACATTGAGTAAAACAGG - Intergenic
1145842883 17:28010962-28010984 CAATTATGATGGAAGAAAAAGGG - Intergenic
1146675118 17:34767994-34768016 GTTTTAAGATGGAAGAGAAATGG - Intergenic
1148968650 17:51459469-51459491 TTTTTAAAATGAAGGAAAAATGG - Intergenic
1149784216 17:59421796-59421818 CTGTTAACAGGGAGGATAAATGG + Intergenic
1150206017 17:63408237-63408259 CTGATTAGATGTAGGAAATAAGG + Intronic
1150253828 17:63727449-63727471 CTGTTAATTAAGAGGAAAAAAGG - Intronic
1150447492 17:65238511-65238533 CTGTTAAAATGGAGCTACAATGG - Intergenic
1151065708 17:71147452-71147474 CTTTTAAAAAGGAGGAAAAATGG - Intergenic
1152548781 17:81018856-81018878 TTGTTTAGATGGAGGAAGCAAGG + Intergenic
1153625502 18:7019091-7019113 ATGTTCTGATGGAGGATAAAAGG - Intronic
1153897974 18:9586173-9586195 CTATTAAGATAGAGAAAATATGG + Intronic
1154052534 18:10974603-10974625 CCGTAAAGATGGGGGAAGAATGG + Intronic
1154088096 18:11327065-11327087 CTTATAAGAAGGAGGCAAAAGGG + Intergenic
1154184553 18:12171570-12171592 AGGTTAAAATGAAGGAAAAAAGG - Intergenic
1155367789 18:25066153-25066175 CTGTTGGGCTGGAGCAAAAAAGG - Intronic
1155421179 18:25658286-25658308 CTATGAGGATTGAGGAAAAAGGG - Intergenic
1156451698 18:37270122-37270144 CGGCTAAGTTTGAGGAAAAAAGG + Intronic
1157502542 18:48201611-48201633 CTGGAAAGATGGAGGGAAAGAGG - Intronic
1157636963 18:49168169-49168191 CTCTGAGGAAGGAGGAAAAAGGG + Intronic
1157739708 18:50081460-50081482 CTGTAAAGGTGGTGGGAAAAGGG + Intronic
1157871692 18:51235366-51235388 CTGTGAAAATGGAGGGAAGATGG - Intergenic
1158337311 18:56426809-56426831 GTGTTCATTTGGAGGAAAAAAGG - Intergenic
1159299404 18:66543485-66543507 CGGTTAAGATGCAGTAAAATTGG - Intronic
1159617953 18:70603382-70603404 CTGTAAAGATTGAGGAGAGAGGG + Intergenic
1159991419 18:74913368-74913390 CTGTTAAAAAGGAGAAAAGAAGG + Intronic
1160351340 18:78182765-78182787 CAGTTAAAATGGAGGACAATAGG + Intergenic
1162972288 19:14187923-14187945 CTGGTTAGAGGGAGTAAAAATGG + Intronic
1163682329 19:18690269-18690291 CTGTGAAGCTGGAGTAAAACGGG + Intronic
1165555311 19:36625936-36625958 CTGTTAAAATGAAGAAAAACTGG - Intronic
1166540323 19:43600872-43600894 CAGTTAGGAAGGTGGAAAAAAGG - Exonic
1167805943 19:51785532-51785554 TTGTAAAGATTGAGGGAAAAGGG - Intronic
1168057756 19:53872960-53872982 CTCTTGAGAAGGAGGAAAATAGG + Intronic
1168481023 19:56719693-56719715 CTGCTGGGATGGAGGAAAGATGG + Intergenic
1168568798 19:57446886-57446908 CTGTAAAAATGTATGAAAAATGG + Intronic
926509597 2:13758209-13758231 CTGTTGAGATGGACTAAAGAGGG - Intergenic
927059271 2:19399369-19399391 CAATGAATATGGAGGAAAAAAGG + Intergenic
929001814 2:37354243-37354265 CTATTCAGATGGAAGACAAAAGG - Intronic
929050724 2:37834499-37834521 CTGTTTTGATGGCAGAAAAAAGG + Intergenic
929532056 2:42759220-42759242 CTGCTGAGATGGAGGAAAAATGG - Intergenic
930066863 2:47334380-47334402 CTGTGCAGATGTAGGAAAAAGGG - Intergenic
930068423 2:47345489-47345511 ATGCTAAGATGGAGGCAGAAAGG - Intronic
930280666 2:49365517-49365539 CTCTTCAGATAAAGGAAAAAAGG + Intergenic
930549824 2:52819447-52819469 CTCATAAGAGAGAGGAAAAATGG + Intergenic
930579205 2:53189463-53189485 CTGTAAAGCTAGAGGAGAAAGGG - Intergenic
931152523 2:59590383-59590405 CAGTAAAGCTGGAGGAGAAAAGG - Intergenic
931152659 2:59592212-59592234 CAGTAAAGCTGGAGGAGAAAAGG - Intergenic
931247694 2:60505070-60505092 CTGTGAAGAGGCAGGAGAAAGGG - Intronic
931292405 2:60885441-60885463 CTGTTACCAAGGGGGAAAAAAGG - Intronic
931541727 2:63336823-63336845 AGGGTAAGATGGAGGATAAAAGG - Intronic
931931295 2:67138129-67138151 TTTTTAATATGAAGGAAAAAAGG - Intergenic
933088743 2:78092075-78092097 CACTTAAGCTGGAGGACAAAGGG + Intergenic
933481839 2:82868024-82868046 AAGTTAAAATGGAGGAAGAATGG - Intergenic
933572009 2:84025093-84025115 CTCTGAAGATGGAGGAAGGAGGG + Intergenic
933885739 2:86718655-86718677 CTGCCAAGAGGGAAGAAAAATGG + Intronic
933924439 2:87078050-87078072 CTGCCAAGAGGGAAGAAAAATGG - Intergenic
934099535 2:88640276-88640298 CTTTTTAAATGGAGGGAAAATGG + Intergenic
934757820 2:96836678-96836700 CTGTTAAGAGGGTGAAAAGATGG - Intronic
935027924 2:99295146-99295168 CTTTGCAGCTGGAGGAAAAAGGG - Intronic
939459788 2:142485062-142485084 ATGTTAATATAGAGGAAATAAGG - Intergenic
940117776 2:150228118-150228140 ATGTTAGGATTGAGGAAATATGG - Intergenic
941521303 2:166547502-166547524 CTGTTAAAATATAGAAAAAATGG - Intergenic
942509720 2:176685154-176685176 TTGTTAATCTGGATGAAAAACGG - Intergenic
943044720 2:182846653-182846675 GTTTTAAAATGGAGGAAAAGAGG - Intronic
943171789 2:184410793-184410815 TTTTTAAGATGAAGGAAATAAGG - Intergenic
943186070 2:184608814-184608836 GTGTCAAGATGGAGCAAAGAGGG + Intronic
943445875 2:187987348-187987370 CTGTTAAGGAGGAGAAAAGAGGG + Intergenic
944588550 2:201195517-201195539 CTGTTAAGATGAAAGACTAAAGG + Intronic
945117513 2:206422549-206422571 GAGTTAATATGGAGGAAAATGGG + Intergenic
945502602 2:210595432-210595454 CTGCTAAAATGGGGGAAATAAGG - Intronic
945584594 2:211643547-211643569 CAGTTAAAATGCAAGAAAAAAGG - Intronic
945593343 2:211762092-211762114 GTGTTGCGATGGAAGAAAAAGGG - Intronic
945714606 2:213342790-213342812 TTTTTAAGATGGTGGAAAATTGG + Intronic
946491857 2:220156341-220156363 TTGTTGGGTTGGAGGAAAAAAGG - Intergenic
946680034 2:222203852-222203874 CTGTTAAAATGGAGGAAGAGTGG - Intronic
946707454 2:222472615-222472637 CTGCTAAGATGTAGGCATAAAGG - Intronic
947057375 2:226121572-226121594 CTATTAAGATGGAAGAAACCAGG - Intergenic
947427217 2:229994800-229994822 CTTTTAAGAGAGAGGAAAACAGG - Intronic
948321046 2:237069987-237070009 ATGTTAAGATGGACAAAACAGGG + Intergenic
1169651938 20:7878513-7878535 CTGTTAAGATGTAGGCCTAAAGG - Intergenic
1169788779 20:9387594-9387616 CTGTGAAAATGCAGGAAATAGGG + Intronic
1170914142 20:20606149-20606171 CTGTGAAAATGGAAGGAAAAGGG - Intronic
1172028648 20:31966911-31966933 CTGTAAAATGGGAGGAAAAAAGG + Intergenic
1173404555 20:42753407-42753429 ATATTTAAATGGAGGAAAAATGG + Intronic
1173801956 20:45899588-45899610 GTGTGAGGATGGAGGAAGAAAGG - Intronic
1174892635 20:54413073-54413095 GTGTGAAGATGCTGGAAAAAGGG - Intergenic
1175769800 20:61616482-61616504 CTCTTACTGTGGAGGAAAAAAGG - Intronic
1176889158 21:14293514-14293536 CTCTTATGATGGATGAAAAGAGG - Intergenic
1176904616 21:14484386-14484408 CCTTTAGGATGGAGGAAAGAGGG + Intergenic
1176934762 21:14853670-14853692 CTCATAAGATGGAGGCAAGAAGG + Intergenic
1178064343 21:28887449-28887471 TTGTGAATATGGTGGAAAAAAGG - Intergenic
1179164853 21:38927358-38927380 CTTTGAAGATGGAGGAAGGAAGG - Intergenic
1181445389 22:22968726-22968748 AGGTTAAAATGAAGGAAAAATGG + Intergenic
1182147843 22:28007884-28007906 CTGATTAGGAGGAGGAAAAATGG - Intronic
1182168321 22:28199820-28199842 GTGTTACTCTGGAGGAAAAATGG + Intronic
949405486 3:3709509-3709531 TTGTTAAAATGGAGAAAAAGGGG - Intronic
949821242 3:8117684-8117706 CAGTAAAGATGTAGAAAAAATGG - Intergenic
950375071 3:12564589-12564611 CTGTTAAAAAAGAGAAAAAAGGG - Intronic
951338049 3:21448411-21448433 CTGCAAAGAAGGAAGAAAAATGG + Intronic
951445796 3:22779030-22779052 TTGGTAAGTTTGAGGAAAAAAGG - Intergenic
952220749 3:31321736-31321758 ATGTTGAGAAAGAGGAAAAAAGG - Intergenic
952756123 3:36869239-36869261 ATGTTAAGATGGAGAAACACTGG + Intronic
952827435 3:37536092-37536114 GTCTTCAGATGGAGGAAAGATGG + Intronic
952913795 3:38214857-38214879 ATCTAAACATGGAGGAAAAAGGG + Intronic
954803966 3:53204526-53204548 CAGTCAAGATGGAGTAAAAAGGG + Intergenic
955102868 3:55869214-55869236 ATGTGAAAATGGAGGAAAAAGGG + Intronic
956460532 3:69467133-69467155 CTGGTAAGATGGAAAAAGAATGG + Intronic
956616121 3:71174543-71174565 CTGTGAAGATGGATGAAATCAGG - Intronic
957770666 3:84687779-84687801 ATGTTAAGATGAAGTAAAACTGG - Intergenic
960183116 3:114606525-114606547 CTGCTAAAATGGAAGAGAAAAGG + Intronic
960357784 3:116674832-116674854 CAGTGAAGAGGGAGGACAAAAGG - Intronic
962158388 3:132973491-132973513 GTGATAAGATGGAGGAATAGAGG - Intergenic
962465200 3:135651024-135651046 TTGATAAAATGGAGGAGAAATGG + Intergenic
963015958 3:140824013-140824035 CTGAGTAGATGGAGGAGAAAGGG - Intergenic
963105327 3:141642212-141642234 CTGTTAGGCTGAAGGCAAAATGG + Intergenic
963323112 3:143831103-143831125 CTCTTAAAATGGAAAAAAAAAGG + Intronic
963998031 3:151734008-151734030 CTGTGAAGAAGCTGGAAAAAGGG + Exonic
964282046 3:155078396-155078418 CGATTAATATAGAGGAAAAATGG - Intronic
964345669 3:155752188-155752210 CTCTTAGGAAGGAGGAAAAGGGG - Intergenic
964894149 3:161574639-161574661 CTTTCAAGAAGGAGGAGAAAGGG - Intergenic
965849345 3:173004517-173004539 CTGTTAACATAGAGGATGAAGGG - Intronic
969646982 4:8436481-8436503 CTGTTAAGATCTAGGAAAAAGGG + Intronic
971260221 4:25050299-25050321 CCGTGAATATCGAGGAAAAATGG - Intergenic
971742330 4:30536462-30536484 CTGTTAAGAGGCAGGAGAATTGG - Intergenic
973087792 4:46089660-46089682 TTGTTAAGAAGTAGGAAAATAGG + Intronic
974353408 4:60779740-60779762 CAATCAAGATGGAGGAGAAATGG + Intergenic
975379977 4:73688729-73688751 CTGGTAAGACTGAGGAGAAAAGG + Intergenic
977180066 4:93863199-93863221 CTGGTAAGAATGTGGAAAAAAGG + Intergenic
977474439 4:97487535-97487557 ATGTTAAGATGTAAAAAAAATGG - Intronic
977529868 4:98188361-98188383 CTGCAAAGATGAAGGTAAAATGG - Intergenic
977691576 4:99917684-99917706 TTTTTCAGATGAAGGAAAAATGG - Intronic
977796959 4:101177502-101177524 CTGTTAAGCTTGGGAAAAAAAGG + Intronic
977899421 4:102402267-102402289 CGGTTAAAATGGATGAAGAAAGG + Intronic
978279397 4:106991952-106991974 ATGTTAAAATGGAAGCAAAAAGG - Intronic
978637386 4:110825619-110825641 CTGGTAAGATTGTGGAGAAAAGG - Intergenic
978826529 4:113030920-113030942 ATATTGAGATGGAAGAAAAATGG + Intronic
979639362 4:122995571-122995593 CTTTTATAAAGGAGGAAAAATGG + Intronic
981764745 4:148235898-148235920 CAGTAAAGATGGAGGAAGAAAGG - Intronic
982524140 4:156456365-156456387 CTGGTGAGGTTGAGGAAAAAAGG + Intergenic
982796861 4:159656676-159656698 ATGTTAAAATGAAGGAAAATTGG - Intergenic
982851777 4:160326500-160326522 CTGGTAAGATTGTGGAGAAAAGG - Intergenic
982979569 4:162115592-162115614 CTGTGAAGATGGAGGTTACAAGG - Intronic
983287526 4:165758798-165758820 CTGTTAGGATGCAGAAGAAAAGG + Intergenic
983755777 4:171333636-171333658 CTGGTAAGATGGCAGAGAAAAGG + Intergenic
983770866 4:171547249-171547271 CTGTAAACATGGAGGATAAAAGG - Intergenic
983854796 4:172630688-172630710 ATGTTGAGTTGGAGGAATAAAGG - Intronic
984521724 4:180810138-180810160 CTGTTTGGAAGGATGAAAAAGGG + Intergenic
984839472 4:184054648-184054670 CTGTTCCAATGGAGGAAAAGGGG - Intergenic
985120169 4:186631960-186631982 CTGTTAAGGTGTGGGACAAAGGG - Intronic
985247028 4:187989276-187989298 CTCATAAGATGGAGGGGAAAAGG + Intergenic
986040003 5:3984181-3984203 CTCTTGAGGTGGAGGAAAATTGG + Intergenic
986440888 5:7780784-7780806 CACTTCAGATGGAGTAAAAAAGG - Intronic
986826617 5:11529115-11529137 CTGTGAAGATCTAGGAAATAAGG + Intronic
986866236 5:11992077-11992099 CTGTTAAGAAGAAAGAGAAAAGG + Intergenic
987100671 5:14588783-14588805 CAGCTAATAGGGAGGAAAAAGGG + Intronic
988534654 5:32055929-32055951 CTGGTAAAATGGAGCAAAACGGG + Intronic
988658333 5:33237103-33237125 CTGGCAAAATGGAGGAAAAATGG + Intergenic
988771938 5:34440966-34440988 CTGCTCAGGTGGAGGACAAAGGG + Intergenic
988877723 5:35466625-35466647 ATGCTGAGATAGAGGAAAAATGG - Intergenic
990875298 5:60477521-60477543 CTGTTAAGATGGAGGAAAAAAGG + Intronic
991126765 5:63078450-63078472 CTTTTAAGAAGCAGGATAAAAGG + Intergenic
991255273 5:64606913-64606935 CTGTTAACATGGAGAAAAACAGG - Intronic
991362605 5:65836551-65836573 CTGTTAGGAAGGAGGAAAAAGGG - Intronic
991433150 5:66568899-66568921 ATGTTAAGATGCAGGAGGAATGG - Intergenic
991496872 5:67235457-67235479 CTCTTAAGATGGAAATAAAATGG + Intergenic
991674371 5:69076437-69076459 CCTTTATGAAGGAGGAAAAAAGG + Intergenic
993372083 5:87105408-87105430 CTCTTAGGTTGGAGGAACAAAGG + Intergenic
993719348 5:91306900-91306922 AGTTTAAGAGGGAGGAAAAAAGG + Intergenic
994442422 5:99826616-99826638 AGGTTAAGATGGAAGAAAATAGG - Intergenic
994735861 5:103555080-103555102 CTGTTAAGATTGGGGGAAGAAGG - Intronic
994776654 5:104042938-104042960 ATGTTAAGAAGGAGGAGAATAGG - Intergenic
994964384 5:106649540-106649562 CTCATAAGATGGATGAATAAAGG + Intergenic
995138639 5:108707463-108707485 GTTTTAAGATAGAGGAATAAAGG + Intergenic
995141558 5:108740926-108740948 TTGTTAAGATGGAGTAAACCAGG - Intergenic
995238354 5:109856972-109856994 GTGTTATGAAGGAGTAAAAAGGG + Intronic
995495930 5:112743217-112743239 CTTTTAAGAAGGAGGCAGAAGGG - Intronic
996026558 5:118652912-118652934 CTTTTGTGATGGGGGAAAAATGG + Intergenic
996329990 5:122317842-122317864 CTGATTAGGTGGAGGAAGAAAGG - Intronic
996534220 5:124559865-124559887 CTGTTCTAATGGATGAAAAATGG - Intergenic
997068071 5:130585943-130585965 CTGTTAAGATTAAGGGAAAAGGG - Intergenic
997768330 5:136527282-136527304 CTATTGAAAAGGAGGAAAAAGGG - Intergenic
997841347 5:137243205-137243227 CTGTTAAGAGAAAGGAAACATGG - Intronic
998043538 5:138968606-138968628 CTGTTAAGAGGATGGAAAGAAGG - Intronic
999793065 5:154960966-154960988 CTCTCCAGATGGAGGAGAAAGGG + Intronic
1000576306 5:162979489-162979511 ATGTGAAGAGGGAGTAAAAATGG + Intergenic
1001001981 5:168016069-168016091 ATGTTATGATGGAGGAACCAAGG - Intronic
1001227590 5:169958540-169958562 CTATTAAAATAGAGGACAAAAGG + Intronic
1001353932 5:171002300-171002322 CTGATGAGAAGGAGGAAAACTGG + Intronic
1002490042 5:179569322-179569344 CTTTAATGATGGAGGAAGAAGGG + Exonic
1002922583 6:1583028-1583050 AAGTTAATATGGAGAAAAAAAGG + Intergenic
1003291194 6:4779658-4779680 CTGCTAGGATTGAGGAAAAACGG + Intronic
1004612529 6:17257175-17257197 CTGCTAAAATGTAGGAAGAAAGG - Intergenic
1005528174 6:26673198-26673220 CTGCAAAGAAGGAGGAAAAAAGG - Intergenic
1005529341 6:26687096-26687118 CTGCAAAGAAGGAGGAGAAAAGG - Intergenic
1005530936 6:26705213-26705235 CTGCAAAGAAGGAGGAGAAAGGG - Intergenic
1005531684 6:26713504-26713526 CTGTGAGGAGGGAGGAGAAAAGG - Intergenic
1005539111 6:26788161-26788183 CTGTGAGGAGGGAGGAGAAAAGG + Intergenic
1005539860 6:26796423-26796445 CTGCAAAGAAGGAGGAGAAAGGG + Intergenic
1005541455 6:26814550-26814572 CTGCAAAGAAGGAGGAGAAAAGG + Intergenic
1005542621 6:26828441-26828463 CTGCAAAGAAGGAGGAAAAAAGG + Intergenic
1006180314 6:32150269-32150291 CTGGTAGGATAGAGGAACAAGGG - Intronic
1006265236 6:32916062-32916084 CTCTAATAATGGAGGAAAAAGGG + Intergenic
1006800879 6:36758974-36758996 CTGTTAAGATGAGGGCAAAATGG + Intronic
1007360317 6:41350971-41350993 GGGTTATGATGGAGGAAAGAGGG - Intergenic
1007524768 6:42482025-42482047 CTGTCAACTTGGTGGAAAAAAGG - Intergenic
1007694345 6:43722708-43722730 CTGTTAACAATGAGGAATAATGG + Intergenic
1008125053 6:47658725-47658747 CTGTTAACATTTAGGATAAATGG - Intronic
1008189134 6:48432860-48432882 CTGTTTAGAAAGAGGAAAAATGG - Intergenic
1009009945 6:57830387-57830409 CTGTGAGGAGGGAGGAGAAAAGG + Intergenic
1009010677 6:57838564-57838586 CTGCAAAGAAGGAGGAGAAAGGG + Intergenic
1009012261 6:57856612-57856634 CTGCAAAGAAGGAGGAGAAAAGG + Intergenic
1009013436 6:57870558-57870580 CTGCAAAGAAGGAGGAAAAAAGG + Intergenic
1009247303 6:61254810-61254832 CTATAGAGATGAAGGAAAAAGGG - Intergenic
1009288461 6:61852982-61853004 GTGTGAAGATGGAGGAAACAGGG - Intronic
1009305113 6:62079748-62079770 CTGCTAAGAGGGAGGATGAAAGG + Intronic
1010333829 6:74657426-74657448 CTGTTAAAATGGAGGGCACATGG - Intergenic
1011466363 6:87661457-87661479 CTCTTGAGATGGGGGAGAAAAGG + Intronic
1011862099 6:91771600-91771622 AAATTAAAATGGAGGAAAAATGG + Intergenic
1012500329 6:99881213-99881235 CGGTGTATATGGAGGAAAAATGG + Intergenic
1012656586 6:101830724-101830746 CTGGTGAGGTGGGGGAAAAAAGG + Intronic
1012737516 6:102969046-102969068 CTTTTAAGATGGAAGAAAGATGG - Intergenic
1012912210 6:105131375-105131397 AAATTAAGATGGAGAAAAAATGG - Intronic
1013017709 6:106176148-106176170 CTGTTAACATGGTGGAGAGAAGG - Intergenic
1013478451 6:110531030-110531052 CTGCTAAGATGTAGGCATAAAGG - Intergenic
1013642355 6:112098158-112098180 CTGTTACGAAGGAGAAATAAAGG + Intronic
1013794084 6:113865659-113865681 GGATTGAGATGGAGGAAAAAGGG - Intergenic
1014158792 6:118142432-118142454 CCATTAAGATGGAAGAGAAAAGG - Intronic
1014272963 6:119354063-119354085 CTTTTAAGAGAGGGGAAAAATGG - Intergenic
1014763065 6:125379244-125379266 CTGAAAAGAGGGAGGAAAGAAGG + Intergenic
1015789433 6:136951535-136951557 CTGTTAAGATGGAGTGAAGGAGG - Intergenic
1016047962 6:139499719-139499741 CTGTCAATATAGAGGAAACAGGG - Intergenic
1017336360 6:153265096-153265118 TTGTTAAGATAGAGGAAACTGGG + Intergenic
1017920138 6:158864695-158864717 CTGTACAGAAGGAAGAAAAAGGG - Intergenic
1017955500 6:159174347-159174369 CTTTTAGGAGGGAGGAAAACGGG - Intronic
1018887067 6:167948605-167948627 TGGTTAAGTTTGAGGAAAAAAGG + Intronic
1019224288 6:170497524-170497546 CTGTTAAAAAGGAGGGATAATGG - Intergenic
1019833291 7:3355588-3355610 CCGTGAAGATGGAGGGAACAGGG - Intronic
1020034050 7:4953135-4953157 CTGTAGGGATGGAGGAAACAGGG - Intronic
1021629338 7:22629116-22629138 CTTCTAAGAAGGAGGTAAAAGGG + Intronic
1023675281 7:42622282-42622304 CTGTAAAGCAGGAGGAAATATGG + Intergenic
1023707699 7:42959518-42959540 CTATTTAGAGTGAGGAAAAATGG + Intergenic
1024213823 7:47229486-47229508 CTGTTAGCATGGGGAAAAAAAGG + Intergenic
1024409403 7:49022809-49022831 ATGTTAAGATGGATAAAAAAGGG - Intergenic
1026002052 7:66568016-66568038 CTGTGAAGAAGAAGGAAATATGG + Intergenic
1026502338 7:70953312-70953334 CTTATAAGAGGGAGGAAAGAAGG + Intergenic
1027172299 7:75881342-75881364 CTGTTCAGAGGAAGAAAAAAGGG - Intronic
1027756398 7:82218297-82218319 CACTTAAGATGTAGGAAAACAGG + Intronic
1027826544 7:83123789-83123811 CTGTTAAGAAATAGGCAAAAGGG + Intronic
1027842376 7:83329646-83329668 CTGATAAGATAGAGAAAAAGGGG + Intergenic
1028216268 7:88137569-88137591 CTGGTTAGATAGAGAAAAAAGGG - Intronic
1028315209 7:89393172-89393194 CTTTTAGGAAGGAGTAAAAATGG - Intergenic
1028425984 7:90689421-90689443 CTCTTAAGATTGAGCAAGAATGG + Intronic
1028897585 7:96059736-96059758 CTGTGAAGATGGAGGACAGAGGG + Intronic
1029237298 7:99131727-99131749 CAGTGAAGAGGGAGGAAAAGAGG + Intronic
1029736730 7:102469392-102469414 CAGGTTAGATGGAGGAAACAGGG + Intronic
1029902869 7:104060494-104060516 ATGTTGAAATGAAGGAAAAAAGG + Intergenic
1029930907 7:104370113-104370135 CTCTAAGGATGGAGGAACAAAGG + Intronic
1030186796 7:106770553-106770575 TTGTTAAGATGGAGGAATGAGGG + Intergenic
1030408898 7:109149243-109149265 CTGGTGAGAATGAGGAAAAAGGG - Intergenic
1030939428 7:115627984-115628006 CTTTGAAGATGGAGAAAAAGGGG + Intergenic
1031048046 7:116915432-116915454 CTCCTAAGATAGAGTAAAAATGG - Intronic
1031125462 7:117768685-117768707 TTGTTGAGATGGAGTACAAAAGG - Intronic
1031556754 7:123186510-123186532 CTGTTAAGGTGAAGAAAAAGAGG - Intronic
1032317972 7:130857799-130857821 CTGTAAATGTGGAGGAAGAAGGG + Intergenic
1032660775 7:133981607-133981629 CTGGTAAGGTTGTGGAAAAAAGG + Intronic
1033183569 7:139204192-139204214 CTTTGAAGACGGAGGAAGAAAGG + Intergenic
1033533215 7:142287072-142287094 CTGTTAAGAAGGTGGACATAGGG - Intergenic
1034380097 7:150684456-150684478 CTGTTGAGATGAAGATAAAATGG - Intergenic
1035117933 7:156540485-156540507 ATTTTAAAATGGAGGAAAAAAGG - Intergenic
1035319784 7:158021327-158021349 CAGGTAAGAGGGAGGAAACATGG + Intronic
1036624008 8:10450520-10450542 CTGGTAGGATGGAGGTAAAGTGG + Intergenic
1036787032 8:11694749-11694771 CTGTGATCATGGAAGAAAAATGG - Intronic
1037277064 8:17191939-17191961 CTGGTGAGATGGTGGAGAAAAGG - Intronic
1037406498 8:18548004-18548026 CTAATCAGATGGGGGAAAAAAGG - Intronic
1037634665 8:20691084-20691106 CTCTTAAGACTGAGGAAATATGG + Intergenic
1039016851 8:33159115-33159137 AAGTAAGGATGGAGGAAAAAAGG - Intergenic
1039410669 8:37352600-37352622 CTGTCAAGAAGGAGGAAAAATGG + Intergenic
1040122827 8:43701441-43701463 CTTTTAAAAAGGAGGAGAAATGG - Intergenic
1040871890 8:52108244-52108266 GTGTTAAGATTGAGGAATATTGG + Intergenic
1041354262 8:56983535-56983557 CTGTTATGATGGAGGGCAACTGG - Intronic
1041392799 8:57361749-57361771 CTGCCAATATGAAGGAAAAAAGG - Intergenic
1041442895 8:57917435-57917457 CTGTTGAGAAGGAGGTAAAGTGG - Intergenic
1041765030 8:61410534-61410556 CTGTTCTGATGGAGGCCAAAAGG - Intronic
1041875118 8:62678957-62678979 CTCTTAAGATATATGAAAAAAGG + Intronic
1043679450 8:83003880-83003902 TTCTTAAAATGGAAGAAAAAGGG + Intergenic
1043960018 8:86406863-86406885 GTTTTAAAATGGAGTAAAAATGG + Intronic
1044063602 8:87670474-87670496 CTATTAAGATTAGGGAAAAAAGG + Intergenic
1044624944 8:94227719-94227741 ATGTTCAGAGGGTGGAAAAATGG + Intergenic
1044727665 8:95206632-95206654 CTGTTGGGAAGGAGGAAAGAGGG - Intergenic
1045564575 8:103299681-103299703 AGAGTAAGATGGAGGAAAAAAGG - Intronic
1047710864 8:127550900-127550922 CTGAAAAGATGAAGGAAAGAAGG - Intergenic
1047834449 8:128673118-128673140 TTTTTAATGTGGAGGAAAAAGGG + Intergenic
1048090952 8:131239672-131239694 GTCTTAAGGAGGAGGAAAAAGGG - Intergenic
1048120771 8:131579090-131579112 CTGTTAAGAAGGAGGATGGAAGG + Intergenic
1049960016 9:729415-729437 GTGTGAAGATGGGGGAAGAAAGG + Intronic
1050553279 9:6766905-6766927 ATGCAAAGATGGAGGTAAAAAGG - Intronic
1051130679 9:13856600-13856622 CTGTGAAGAGGTAGGAAAGATGG - Intergenic
1051769960 9:20566784-20566806 AGATTAAGAAGGAGGAAAAAGGG + Intronic
1052192133 9:25673344-25673366 CTGATACGAAGGAGGAAAACTGG - Intergenic
1052316935 9:27125003-27125025 CAGTTATGAGAGAGGAAAAAGGG - Intronic
1053232534 9:36422774-36422796 CTGGAAATATGGGGGAAAAAAGG - Intronic
1055983335 9:82028957-82028979 CAATAAAGCTGGAGGAAAAAAGG + Intergenic
1058574596 9:106386853-106386875 ATTTTAAGTTGGAAGAAAAAAGG - Intergenic
1059866025 9:118514661-118514683 CTGATAAGATGGAGGGAATAGGG + Intergenic
1059866134 9:118515903-118515925 CTGTTAAAATTGAAGAGAAACGG + Intergenic
1059990316 9:119859191-119859213 ATGAAAAGATGGAGAAAAAAAGG + Intergenic
1060138709 9:121184501-121184523 CTGTTTGGAAGGGGGAAAAAGGG - Intronic
1060771384 9:126334649-126334671 CTGTAGAGAAGGAGAAAAAAAGG - Intronic
1061729278 9:132600991-132601013 CTGTTAAGATGGAGAATACAGGG + Intronic
1186371959 X:8955877-8955899 CTCATGAGATGGAGGAAAGAGGG - Intergenic
1186785038 X:12949250-12949272 CTTTGAAGATGGAGGAAGCAAGG + Intergenic
1187777024 X:22771900-22771922 CTGTTAAGATGGGAAAAAATAGG - Intergenic
1188368612 X:29341183-29341205 GTGTTAAGATGGAGTTATAATGG - Intronic
1189199387 X:39178730-39178752 CTTTTAAAATTGAAGAAAAATGG - Intergenic
1189355434 X:40306771-40306793 CTTTTAATATGGGGGAATAAAGG + Intergenic
1189431089 X:40948066-40948088 CTGTTGAGAATGAGGAACAACGG + Intergenic
1190615964 X:52232460-52232482 CTGTTATGATGGTTGAAGAAAGG - Intergenic
1190915201 X:54806916-54806938 CAGTTGTGATGAAGGAAAAATGG + Intergenic
1194105922 X:89767026-89767048 CTGTTAAGTGGGAGGATATAAGG + Intergenic
1194172843 X:90609275-90609297 CTGTTAAGTTAGTGAAAAAATGG - Intergenic
1194867894 X:99091340-99091362 CTGTCAAGGTTGAGGAGAAAAGG + Intergenic
1194965277 X:100281267-100281289 CTGTTGAGAAGGTGGAGAAAAGG - Intergenic
1195005568 X:100682284-100682306 AAGTTAATATGGAGTAAAAAAGG - Intronic
1195740307 X:108058669-108058691 CTCTTCAGATGGATGAAGAAGGG + Intronic
1198719454 X:139600158-139600180 CTGCTTAGATTGGGGAAAAAAGG + Intronic
1199078389 X:143549593-143549615 CTGCTGAGATGGAGGGAAAAAGG + Intergenic
1199177042 X:144801417-144801439 CTTATAAGAGGGAGGAAAGAAGG - Intergenic
1199243968 X:145581323-145581345 CTCTTACAGTGGAGGAAAAAAGG - Intergenic
1199634183 X:149800018-149800040 CAGATGAGAGGGAGGAAAAATGG - Intergenic
1200457878 Y:3414885-3414907 CTGTTAAGTGGGAGGATATAAGG + Intergenic
1200519069 Y:4186993-4187015 CTGTTAAGTTAGTGAAAAAATGG - Intergenic
1201857105 Y:18556834-18556856 CTGGAAACATGGAGGTAAAATGG - Intronic
1201876216 Y:18763546-18763568 CTGGAAACATGGAGGTAAAATGG + Intronic