ID: 990876687

View in Genome Browser
Species Human (GRCh38)
Location 5:60494308-60494330
Sequence CTGTAGCTGCACCAGCAGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 228
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 204}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990876687 Original CRISPR CTGTAGCTGCACCAGCAGAG GGG (reversed) Intronic
900223280 1:1520717-1520739 CTGTAGCTCTCCCAGCAGGGAGG + Intronic
901493481 1:9608448-9608470 CTGTAACTGCACGAGAGGAGAGG - Intronic
904433129 1:30477910-30477932 ATGCAGCTGCCCCAGCACAGAGG - Intergenic
904563622 1:31414191-31414213 CTGTAGCTGCAGCCGCAGAGGGG + Intronic
904635606 1:31878436-31878458 CTGTGGCTGCAGCAGCACAAAGG + Intergenic
905266984 1:36761104-36761126 CTGGAGATGCTTCAGCAGAGAGG + Intergenic
905397406 1:37675694-37675716 TTGTAGCTGCCCCAGCACTGTGG - Intergenic
906788607 1:48638649-48638671 CTGTTGCTCCCCCAGCAAAGTGG + Intronic
907404735 1:54247001-54247023 CTGTCCCTGCCCCTGCAGAGCGG - Intronic
908002236 1:59691538-59691560 CTCTTGCTTCACTAGCAGAGGGG + Intronic
909385978 1:75057259-75057281 CGGTAGCTGCACAAGAAGGGTGG - Intergenic
911357938 1:96844445-96844467 GTGCAGCTGCAGCAACAGAGAGG + Intergenic
912230670 1:107788970-107788992 CAGTAGCAACTCCAGCAGAGTGG + Intronic
915599196 1:156912207-156912229 CTGTACCTGCCCCACCAGACAGG + Intronic
916059208 1:161087282-161087304 CTGCTGCAGCAGCAGCAGAGTGG + Intronic
916268848 1:162919072-162919094 CTGCAGCTGCACCGGCAATGGGG + Intergenic
918037509 1:180889523-180889545 CTGTAGCAACACCAGCATGGTGG + Exonic
1063556868 10:7088788-7088810 CTCTAGCTGCAACAGAAGAATGG - Intergenic
1063978538 10:11435824-11435846 CTGCAGCTGCACCAGTAGAAAGG - Intergenic
1064007877 10:11712780-11712802 CCAGAGCTGCTCCAGCAGAGAGG + Intergenic
1067684388 10:48458000-48458022 CTGCAGCTGTACCCACAGAGGGG - Intronic
1067712356 10:48659052-48659074 CTGTGGCTCCTCCAGCTGAGGGG - Intergenic
1068856711 10:61805290-61805312 GTGTAGCTGTAGCAGCAGTGGGG - Intergenic
1074481611 10:113826931-113826953 CTGGAGGTGCAACAGCAGAGGGG - Intergenic
1075551482 10:123395820-123395842 CTGGTGCTGCACCATTAGAGTGG + Intergenic
1076229542 10:128808617-128808639 CTGTGGCAGCCCTAGCAGAGAGG - Intergenic
1079504101 11:21133853-21133875 CTGCAGCTGCACCTGGAGGGTGG + Intronic
1079812471 11:25012489-25012511 CTTCAGCAGCACCAGCAGAAGGG - Intronic
1080279553 11:30540862-30540884 CTGTAGCTACTCCACTAGAGTGG - Intronic
1080842880 11:36000843-36000865 CTGTAGTGGTTCCAGCAGAGTGG + Intronic
1080943205 11:36942646-36942668 CTGGAGCAGCAACATCAGAGAGG + Intergenic
1081358382 11:42142399-42142421 CAGTATCTGAACCAGAAGAGAGG + Intergenic
1083203776 11:61135256-61135278 CTGTAGCTGGGACAGCAGAAGGG - Intronic
1083592949 11:63905843-63905865 CTTTGGCTCCTCCAGCAGAGTGG - Intronic
1084188688 11:67489057-67489079 CTGGGGCTTCACCAGGAGAGAGG + Intronic
1085879524 11:80449382-80449404 CTGTTTCTGCAGCAGCATAGTGG - Intergenic
1087307877 11:96505762-96505784 GGAGAGCTGCACCAGCAGAGAGG - Intronic
1088501850 11:110491084-110491106 CTGTGGCTGCATCTGCAGGGAGG + Intergenic
1090384581 11:126349300-126349322 CTGCCACTGCTCCAGCAGAGCGG - Intergenic
1093498086 12:19780058-19780080 CTGTAGCTGCAGAGGCAGAGGGG + Intergenic
1095826212 12:46532099-46532121 GTGCAGCTGCTACAGCAGAGTGG - Intergenic
1097901193 12:64875332-64875354 CTGTCGCTGTACAACCAGAGGGG - Exonic
1102869094 12:116399478-116399500 CTGCAGCTGCAGAAGGAGAGTGG - Intergenic
1103699458 12:122841280-122841302 CTGTGGCTGGCCCAGCAGAGCGG + Intronic
1105281049 13:18962804-18962826 CTGCAGCTTCACCAGCAGCCTGG + Intergenic
1105290251 13:19048816-19048838 CTGCAGCTTCACCAGCAGCCTGG + Intergenic
1106393848 13:29361233-29361255 GTGTAGCTGTAGTAGCAGAGAGG - Intronic
1108903029 13:55436127-55436149 ATGTACTTGCACCAGCACAGAGG - Intergenic
1112718558 13:102215185-102215207 GTGCAGCTGGACCAGAAGAGTGG - Intronic
1113723547 13:112579723-112579745 TTGCCGCTGCACCAGCAGTGTGG - Intronic
1113907580 13:113826944-113826966 CTGTGGCTGCACCTTCAGACAGG - Intronic
1114898262 14:27022391-27022413 CTGTAGCTGCCCGGGCACAGTGG + Intergenic
1115058561 14:29162304-29162326 CAGCAGCAGCACCAGCAGAAGGG - Intergenic
1116725265 14:48554767-48554789 CAGCAGCAGCAGCAGCAGAGTGG - Intergenic
1117378352 14:55136079-55136101 TTGTAGGTGCTCCAGCAGTGAGG - Intronic
1119328525 14:73776740-73776762 CTGCAGCCTCCCCAGCAGAGTGG - Intronic
1121262631 14:92577515-92577537 CGGCAGCAGCAGCAGCAGAGAGG + Intronic
1122860166 14:104578979-104579001 CTTTACATGCACCAGCAGACGGG + Intronic
1123106447 14:105844014-105844036 GTGTTTCTGCACCTGCAGAGTGG + Intergenic
1123721375 15:23064553-23064575 CAGCAGCTGCAGCAGCACAGTGG - Intergenic
1124342797 15:28900982-28901004 CGGTAGCTGCTCCAGGAAAGTGG + Intronic
1126233410 15:46354176-46354198 CTGCAGCTGCAATGGCAGAGGGG - Intergenic
1129475606 15:75782853-75782875 TTGTAGCTGCTCCACCACAGAGG - Intergenic
1129796930 15:78384880-78384902 CTGTGGCTGCGCCAGGAGAGTGG + Intergenic
1131123434 15:89837791-89837813 CTTTTCCTGCAGCAGCAGAGTGG + Intronic
1132889909 16:2198533-2198555 CAGTTGCTGCACAGGCAGAGAGG - Intergenic
1133207958 16:4245268-4245290 CTCTAGCTACACAGGCAGAGTGG - Intergenic
1133845491 16:9449667-9449689 CAGTAGCTGCAGCAGCAGCAGGG + Intergenic
1134884677 16:17779598-17779620 CTGTAGCTACACCAGAAGGCGGG + Intergenic
1136622153 16:31436398-31436420 CCGCAGCTGCAGCAGCAGAAGGG + Exonic
1137010082 16:35312858-35312880 CTGCAGCTGCACCAAAAGAAGGG + Intergenic
1139026610 16:62825358-62825380 CGCTAGCTTCTCCAGCAGAGTGG + Intergenic
1139324745 16:66143740-66143762 TTGCAGCTGCCCCAGGAGAGTGG - Intergenic
1139590640 16:67931081-67931103 CTGCAGGTACACCACCAGAGGGG - Exonic
1141111861 16:81276440-81276462 CTGTGGCAGGAACAGCAGAGTGG - Intronic
1141160149 16:81624010-81624032 CTGTATCAGCAGAAGCAGAGGGG - Intronic
1141840586 16:86571749-86571771 CTGTTGCTCTCCCAGCAGAGTGG + Intergenic
1142480117 17:213878-213900 CTGGAGCTGCGTCAGCAGCGGGG + Exonic
1142504709 17:355430-355452 GTTTAGCTGCACCGGCAGACAGG - Intronic
1145836250 17:27956456-27956478 CTGCAGCTACACAAACAGAGTGG - Intergenic
1149665669 17:58363390-58363412 CTGTAGCTGCAGCAGCCGCTGGG - Exonic
1151474083 17:74335660-74335682 CTGGAGCTGCAGCAGCAGATGGG + Intronic
1151476010 17:74344701-74344723 CCGTAGGTGCTCCGGCAGAGAGG - Intronic
1152630644 17:81409373-81409395 CTGGAGCTGCGCCGGCTGAGTGG + Intronic
1152684037 17:81685008-81685030 CTGGAGCTGCCCCCCCAGAGGGG + Intronic
1153594896 18:6715526-6715548 AAGTAGCTCCACCAGCAGTGGGG - Intergenic
1153953702 18:10077963-10077985 CTGAAGCTTCACCAGGAGGGAGG - Intergenic
1156294067 18:35774106-35774128 CAGAAGCTGCAGCAGCAGAGGGG - Intergenic
1157452702 18:47800309-47800331 GTGTGCCTGCACCAGAAGAGCGG - Intergenic
1157565061 18:48674337-48674359 CAGGAGCTGCAGCAGCACAGGGG - Intronic
1161007827 19:1945199-1945221 CTCACGCTGCACCTGCAGAGGGG - Intronic
1163429626 19:17259503-17259525 CTGAAGCTGCAACAGGAGGGAGG - Intronic
1163786380 19:19277060-19277082 CTGTAGGGGCACCACCACAGTGG - Exonic
925920162 2:8632752-8632774 CTGGAGCAGCTCCAGCTGAGGGG + Intergenic
929756288 2:44768444-44768466 CTGTACCTGCCCCAGCAGCGGGG + Intronic
931091978 2:58896116-58896138 CTGGGGCTGCATCAGCCGAGAGG + Intergenic
932121658 2:69106471-69106493 CTGTATCTGCATCAGCATCGGGG - Intronic
933080256 2:77976842-77976864 CTGAAGCTGCAATGGCAGAGGGG - Intergenic
935780439 2:106505560-106505582 CCGTTGCTGCACTTGCAGAGTGG - Intergenic
936076398 2:109404451-109404473 CTGTCCCTGCCCCTGCAGAGTGG - Intronic
940591892 2:155739476-155739498 CTGAAGCTGCACCCTCAAAGAGG - Intergenic
940926892 2:159373707-159373729 CTGTAGTTCCACCACCAGGGAGG + Intronic
944471221 2:200055449-200055471 CTGCAGCTGCAATGGCAGAGGGG - Intergenic
945357425 2:208856762-208856784 CTGCAGCAGCAGTAGCAGAGGGG + Intergenic
947118379 2:226795330-226795352 CGGTAGCAGCAGCAGCAGCGAGG - Exonic
947233857 2:227919910-227919932 CTGTAGGTGCAGAAGCAGAAAGG - Intronic
947494003 2:230619664-230619686 CTGTAGCTGGACGAGCGGAGGGG + Intergenic
948080016 2:235198293-235198315 CTGGAGCTGCACCTGCAGGGTGG + Intergenic
1172151114 20:32791228-32791250 CTGTGGCTGCTCCAGCATTGAGG - Intronic
1172730394 20:37082211-37082233 CTGTATCATCACCAGCAGGGGGG - Intronic
1173639698 20:44592294-44592316 CTGAAGGAGCACCAGCAGAATGG - Intronic
1173650720 20:44662461-44662483 CAATAGCTTCACCAGAAGAGGGG - Intergenic
1174929203 20:54794503-54794525 CTGCAGCTGCAATGGCAGAGGGG + Intergenic
1175116132 20:56683811-56683833 CTGGAGCAGAAGCAGCAGAGAGG + Intergenic
1175234667 20:57501749-57501771 CTGACTCTGCACCAGCAGATGGG - Intronic
1175836736 20:62000863-62000885 CTGCATCTGCCACAGCAGAGAGG + Intronic
1176311616 21:5153825-5153847 CGGTGGCTCCACCAGCACAGGGG + Intronic
1178056958 21:28810487-28810509 CTTTAGTTGCACCAGCAGGCAGG - Intergenic
1179845434 21:44108210-44108232 CGGTGGCTCCACCAGCACAGGGG - Intronic
1180179069 21:46109883-46109905 CTGAAACTGCACCAGGAGTGGGG + Intronic
1181145117 22:20840301-20840323 CTGCTGCTGCAGCAGCACAGTGG + Intronic
1181339750 22:22168413-22168435 CTGTGGCTCCAGCACCAGAGTGG + Intergenic
1182128694 22:27835006-27835028 CTGCAGCTGCCCCAACAGAGGGG + Intergenic
1182466000 22:30516688-30516710 CTGTGACTGCCCCTGCAGAGTGG + Intergenic
1183544861 22:38450020-38450042 CTGCAGCGTCACAAGCAGAGGGG + Intronic
1184665854 22:45988718-45988740 CTGGAGCTGCCCCATCAGGGCGG - Intergenic
950824070 3:15797421-15797443 CTGTGGCTGCTCCAGCAAAAGGG + Intronic
952575997 3:34774859-34774881 CTGTAGCTTCACACGTAGAGTGG - Intergenic
954609707 3:51937838-51937860 CTCCAGCTGCCTCAGCAGAGGGG + Intronic
955023390 3:55143368-55143390 CTGTAGCTGTACCTGCATGGAGG - Intergenic
958838316 3:99172188-99172210 CTGTAGGTGCAATGGCAGAGAGG - Intergenic
960588738 3:119345374-119345396 CTGGAGCTGCCCCAGCACACTGG + Intronic
961645337 3:128389791-128389813 CTGAGGCTGCTCCAGCAGAATGG + Intronic
962230575 3:133661994-133662016 CGGCAGCTGCAGCAGAAGAGCGG + Intergenic
966875977 3:184321895-184321917 CCGTAGCTGGAGTAGCAGAGGGG - Exonic
967659603 3:192090707-192090729 CAGCAGCTGCAGCAGCACAGTGG - Intergenic
967891848 3:194369428-194369450 CTGTTGAGGCATCAGCAGAGGGG + Intronic
968811527 4:2801569-2801591 CTGCTGCAGCCCCAGCAGAGGGG + Intronic
968946247 4:3665951-3665973 CTGGAGCTGCAGGAGCACAGAGG + Intergenic
969522512 4:7686802-7686824 CTGCAGCTGCCCCAGGAGAAGGG + Intronic
970368429 4:15384554-15384576 CTGGAGCCTCACCAGCAAAGAGG + Intronic
970574781 4:17416684-17416706 CTGTAGAGGCACTGGCAGAGTGG - Intergenic
972125529 4:35760621-35760643 CTGCAGCAGCACTGGCAGAGGGG - Intergenic
973318133 4:48782166-48782188 CTTTTGCTGCACTAGCAGACTGG + Intergenic
975434310 4:74334040-74334062 CTGTGGCTCCACCAGCAGGAGGG + Intergenic
978271274 4:106893461-106893483 CTGCAGCTGCAATGGCAGAGGGG - Intergenic
979671717 4:123366607-123366629 CTAGAGCAGCAGCAGCAGAGAGG + Intergenic
980150014 4:129034002-129034024 CTCAAGTAGCACCAGCAGAGTGG + Intronic
981118160 4:141016514-141016536 CTGTGACTGCTCCCGCAGAGCGG - Intronic
981156176 4:141438980-141439002 CTGTAGCAGCAACATCAGACAGG - Intergenic
981337229 4:143581298-143581320 CTGCAGCTGCAATGGCAGAGAGG - Intronic
981483399 4:145260162-145260184 CTGGAGCTGGAGCAGCAGGGAGG + Intergenic
982861190 4:160451280-160451302 ATGTAGCTGAATTAGCAGAGAGG - Intergenic
983188647 4:164730151-164730173 TTGGAGCTGGAACAGCAGAGTGG + Intergenic
986284099 5:6347349-6347371 CTGGAGCTGCCGCAGCAGAGAGG - Intergenic
986906365 5:12498482-12498504 CTTTAGTTGCACCAGTAGAATGG - Intergenic
989164494 5:38421401-38421423 CTGTGACTGCTCCAGCAGAGTGG - Intronic
989165382 5:38428690-38428712 CTGGAGCTGCCACTGCAGAGAGG - Intronic
990517697 5:56545693-56545715 CTGCAGCTGTACCAGGACAGAGG + Intronic
990876687 5:60494308-60494330 CTGTAGCTGCACCAGCAGAGGGG - Intronic
991093941 5:62719734-62719756 CTGTCTGTGCAGCAGCAGAGGGG + Intergenic
992332353 5:75730284-75730306 CAGTGCCTGCATCAGCAGAGTGG - Intergenic
993531321 5:89028417-89028439 CTGGAAATGCACCAGCAAAGGGG - Intergenic
994112553 5:96023165-96023187 CTGTGGCTGCACAAGCAGTAGGG - Intergenic
999542070 5:152584788-152584810 CTGCAGCTGCAGTGGCAGAGGGG + Intergenic
1000475362 5:161700181-161700203 CTGTGGCTCAACCAGCACAGGGG + Intronic
1003865534 6:10359108-10359130 CTGTCACTTCACCAGCAAAGTGG - Intergenic
1004739775 6:18447516-18447538 CTGTCGCTGCTGCAGAAGAGTGG + Intronic
1005839987 6:29737965-29737987 CTGTAACTGCACCTGTGGAGAGG - Intronic
1005950046 6:30625255-30625277 CTGCATCTGCCCTAGCAGAGGGG - Intronic
1006406938 6:33850967-33850989 TAGAAGCTGCACCAGCAGAGGGG - Intergenic
1007008365 6:38390080-38390102 ATGTGACGGCACCAGCAGAGAGG - Intronic
1007079738 6:39091031-39091053 CTTTAAATGCACCAACAGAGAGG + Intergenic
1008870113 6:56262813-56262835 CTGTAGCAGCATCAGCAGCCTGG + Intronic
1010328876 6:74597843-74597865 CTGTAGCTGTATCAGGAAAGAGG + Intergenic
1010465884 6:76166343-76166365 CTGCAGCTGCAATGGCAGAGGGG - Intergenic
1011084013 6:83519018-83519040 GTGTATCTGTACCAGCATAGTGG - Intronic
1012733655 6:102911500-102911522 CTGAGGCTGCCCCAGCAAAGTGG + Intergenic
1012782241 6:103577209-103577231 GTTTAGATGCACCACCAGAGAGG + Intergenic
1013366865 6:109443508-109443530 CTGTTGTAGGACCAGCAGAGAGG + Exonic
1013648347 6:112168292-112168314 CAATGGCTGCACCAGTAGAGAGG + Intronic
1013692878 6:112667127-112667149 CTGGAGCTGCACGATCAGTGGGG + Intergenic
1014410421 6:121110996-121111018 GTGTAGCTGCATCAGTAGAAAGG + Intronic
1016840519 6:148520083-148520105 CTGCAGCTGCTCCGGCAGAAAGG + Intronic
1018146884 6:160900073-160900095 CTGCAGCTGCAATGGCAGAGGGG - Intergenic
1019096022 6:169579784-169579806 CGGTAGCTGCACAGGCAGAGTGG - Intronic
1021131140 7:16913976-16913998 CAGTAGCAGCAGCAGCAGTGTGG - Intergenic
1022459864 7:30594962-30594984 CGGCAGCAGCAGCAGCAGAGCGG - Exonic
1024096426 7:45986350-45986372 GTGTAGCTGCACCAGGGGACAGG - Intergenic
1024279920 7:47710376-47710398 CTCCTGCAGCACCAGCAGAGGGG + Intronic
1025023210 7:55496032-55496054 CTGTAGCTGCACTGGCAGCCAGG - Intronic
1029506481 7:100966478-100966500 CAGCAGCAGCACCAGCAGCGCGG - Exonic
1029946246 7:104536067-104536089 CTGTAGCTGTAGCTGCACAGAGG + Intronic
1030401628 7:109059067-109059089 CTGCATGTGCACCAGCAGAGAGG + Intergenic
1031001127 7:116415834-116415856 GTGTAGCTGAAACAGCAAAGTGG - Intronic
1031130618 7:117829234-117829256 CAGTAGCTGCTCCAGAATAGAGG - Intronic
1031923450 7:127617858-127617880 TTGTAGCTGCAAAGGCAGAGTGG + Intergenic
1033538485 7:142333916-142333938 CTGTAGCTTCACCCACAGAGAGG + Intergenic
1034272145 7:149808521-149808543 CTGTAGCTGCAGCTGCAACGTGG + Intergenic
1035866539 8:3089183-3089205 CCGAGGCTGCACCAGCAGAGTGG - Intronic
1037571505 8:20161902-20161924 CTGTAGGGGCACCAGCATGGTGG - Intronic
1037894654 8:22643838-22643860 CTGTAGCTGTCACATCAGAGAGG + Intronic
1038015301 8:23509649-23509671 CAGTGGCTGCACCCCCAGAGCGG - Intergenic
1039338713 8:36623244-36623266 CTGTCACTGCTCCTGCAGAGCGG - Intergenic
1039847193 8:41333964-41333986 CTGTGCCTGCTCCTGCAGAGTGG - Intergenic
1040510272 8:48087217-48087239 CTGGAGCTGCTGCAGGAGAGGGG + Intergenic
1042050410 8:64698316-64698338 CTTTAGCTCCAGCAGCAGGGGGG + Intronic
1044745284 8:95365062-95365084 CTGTAGCTCTGCCAGCGGAGTGG + Intergenic
1045603909 8:103750796-103750818 CTGAGGCTTCACCAGCAAAGTGG + Intronic
1047773950 8:128053783-128053805 GTACAGCTGCACCAGCACAGTGG + Intergenic
1048980928 8:139703184-139703206 CTGTGGCGGCCCCAGCGGAGGGG - Intergenic
1049744149 8:144256089-144256111 CTGAAACTGCCCCAGCAGAGCGG + Intronic
1054935004 9:70677374-70677396 CTGTTACTGCTCCTGCAGAGTGG - Intronic
1058402761 9:104636750-104636772 ATGTGGCTTCCCCAGCAGAGGGG - Intergenic
1062467572 9:136687814-136687836 CTGTGGCTGCCCCGGCAGCGGGG - Intergenic
1189233041 X:39466877-39466899 CTGGAGCTGAAACAGCAGAAGGG - Intergenic
1189318570 X:40073500-40073522 CAGTAGCAGCACCAGCAGCAAGG - Exonic
1190287690 X:48971747-48971769 CTGTTGCTGCTCCTGCAGCGGGG - Intergenic
1192691803 X:73372853-73372875 CTGTAGCTGCAATGGCAGATGGG + Intergenic
1192756264 X:74049558-74049580 CTGTAGCTGCAATGGTAGAGGGG - Intergenic
1193352211 X:80476756-80476778 CTGTATCTGCAGTAGCAGTGAGG + Intergenic
1196245191 X:113391740-113391762 CTGCAGCTGCAATGGCAGAGGGG + Intergenic
1196324444 X:114385920-114385942 CTCTAGTTGCACTAGCACAGTGG - Intergenic
1197273969 X:124456475-124456497 CTTAAGCTTCACCAGCAAAGAGG - Intronic
1198966859 X:142236865-142236887 CTGGAGCTGAAGCAGCTGAGAGG - Intergenic
1202266136 Y:23021192-23021214 CTGTGGCTGCACCAGCACACAGG - Intergenic
1202419129 Y:24654935-24654957 CTGTGGCTGCACCAGCACACAGG - Intergenic
1202451657 Y:25015149-25015171 CTGTGGCTGCACCAGCACACAGG + Intergenic