ID: 990877291

View in Genome Browser
Species Human (GRCh38)
Location 5:60500023-60500045
Sequence TGAGCCACCACACCCAGCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 14903
Summary {0: 117, 1: 658, 2: 2057, 3: 4596, 4: 7475}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990877291_990877293 0 Left 990877291 5:60500023-60500045 CCCAGGCTGGGTGTGGTGGCTCA 0: 117
1: 658
2: 2057
3: 4596
4: 7475
Right 990877293 5:60500046-60500068 TACCTCTAATCCCAGCACTTAGG 0: 64
1: 7094
2: 188230
3: 319327
4: 203668
990877291_990877294 1 Left 990877291 5:60500023-60500045 CCCAGGCTGGGTGTGGTGGCTCA 0: 117
1: 658
2: 2057
3: 4596
4: 7475
Right 990877294 5:60500047-60500069 ACCTCTAATCCCAGCACTTAGGG No data
990877291_990877298 14 Left 990877291 5:60500023-60500045 CCCAGGCTGGGTGTGGTGGCTCA 0: 117
1: 658
2: 2057
3: 4596
4: 7475
Right 990877298 5:60500060-60500082 GCACTTAGGGAGATTGAAACAGG 0: 1
1: 1
2: 28
3: 894
4: 13413
990877291_990877299 30 Left 990877291 5:60500023-60500045 CCCAGGCTGGGTGTGGTGGCTCA 0: 117
1: 658
2: 2057
3: 4596
4: 7475
Right 990877299 5:60500076-60500098 AAACAGGATAACTTGAGCCCAGG 0: 1
1: 1
2: 79
3: 1816
4: 17351

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990877291 Original CRISPR TGAGCCACCACACCCAGCCT GGG (reversed) Intronic
Too many off-targets to display for this crispr