ID: 990877292

View in Genome Browser
Species Human (GRCh38)
Location 5:60500024-60500046
Sequence ATGAGCCACCACACCCAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 20830
Summary {0: 151, 1: 938, 2: 2950, 3: 6588, 4: 10203}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990877292_990877294 0 Left 990877292 5:60500024-60500046 CCAGGCTGGGTGTGGTGGCTCAT 0: 151
1: 938
2: 2950
3: 6588
4: 10203
Right 990877294 5:60500047-60500069 ACCTCTAATCCCAGCACTTAGGG No data
990877292_990877298 13 Left 990877292 5:60500024-60500046 CCAGGCTGGGTGTGGTGGCTCAT 0: 151
1: 938
2: 2950
3: 6588
4: 10203
Right 990877298 5:60500060-60500082 GCACTTAGGGAGATTGAAACAGG 0: 1
1: 1
2: 28
3: 894
4: 13413
990877292_990877299 29 Left 990877292 5:60500024-60500046 CCAGGCTGGGTGTGGTGGCTCAT 0: 151
1: 938
2: 2950
3: 6588
4: 10203
Right 990877299 5:60500076-60500098 AAACAGGATAACTTGAGCCCAGG 0: 1
1: 1
2: 79
3: 1816
4: 17351
990877292_990877293 -1 Left 990877292 5:60500024-60500046 CCAGGCTGGGTGTGGTGGCTCAT 0: 151
1: 938
2: 2950
3: 6588
4: 10203
Right 990877293 5:60500046-60500068 TACCTCTAATCCCAGCACTTAGG 0: 64
1: 7094
2: 188230
3: 319327
4: 203668

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990877292 Original CRISPR ATGAGCCACCACACCCAGCC TGG (reversed) Intronic
Too many off-targets to display for this crispr