ID: 990877298

View in Genome Browser
Species Human (GRCh38)
Location 5:60500060-60500082
Sequence GCACTTAGGGAGATTGAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 14337
Summary {0: 1, 1: 1, 2: 28, 3: 894, 4: 13413}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990877291_990877298 14 Left 990877291 5:60500023-60500045 CCCAGGCTGGGTGTGGTGGCTCA 0: 117
1: 658
2: 2057
3: 4596
4: 7475
Right 990877298 5:60500060-60500082 GCACTTAGGGAGATTGAAACAGG 0: 1
1: 1
2: 28
3: 894
4: 13413
990877292_990877298 13 Left 990877292 5:60500024-60500046 CCAGGCTGGGTGTGGTGGCTCAT 0: 151
1: 938
2: 2950
3: 6588
4: 10203
Right 990877298 5:60500060-60500082 GCACTTAGGGAGATTGAAACAGG 0: 1
1: 1
2: 28
3: 894
4: 13413

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990877298 Original CRISPR GCACTTAGGGAGATTGAAAC AGG Intronic
Too many off-targets to display for this crispr