ID: 990882235

View in Genome Browser
Species Human (GRCh38)
Location 5:60552167-60552189
Sequence GCTTCTCTCATCTATGAATG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990882233_990882235 -9 Left 990882233 5:60552153-60552175 CCTCACCTCTCTGGGCTTCTCTC No data
Right 990882235 5:60552167-60552189 GCTTCTCTCATCTATGAATGAGG No data
990882228_990882235 29 Left 990882228 5:60552115-60552137 CCATGTCTAGAAACAAGTGCTAG No data
Right 990882235 5:60552167-60552189 GCTTCTCTCATCTATGAATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990882235 Original CRISPR GCTTCTCTCATCTATGAATG AGG Intergenic
No off target data available for this crispr