ID: 990887731

View in Genome Browser
Species Human (GRCh38)
Location 5:60614191-60614213
Sequence ATAAAATCAAGGCTCAGATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 348
Summary {0: 1, 1: 0, 2: 2, 3: 36, 4: 309}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990887731_990887735 -3 Left 990887731 5:60614191-60614213 CCCCATCTGAGCCTTGATTTTAT 0: 1
1: 0
2: 2
3: 36
4: 309
Right 990887735 5:60614211-60614233 TATCTTTTCTGACTGTAGAGCGG 0: 1
1: 1
2: 2
3: 29
4: 201

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990887731 Original CRISPR ATAAAATCAAGGCTCAGATG GGG (reversed) Intronic
902532899 1:17101837-17101859 AGAAAATCAAGGCTCAGAAAAGG - Intronic
902749456 1:18497316-18497338 ATAGACTCTAGGCTCAGCTGCGG + Intergenic
903475192 1:23614644-23614666 AGAAAATTAAGGCTCAGAGATGG - Intronic
904943873 1:34184887-34184909 ATAAAGACAAGACTCAGATACGG + Intronic
906414830 1:45613167-45613189 AGAAACTGAAGGCTCAGAAGAGG + Exonic
906809757 1:48813853-48813875 TTCAAATCAAGGCTCAGGAGAGG + Intronic
907192403 1:52660345-52660367 ATTCAATCAAGGCTCAGAGCCGG + Intronic
907490134 1:54804045-54804067 AGGAAACTAAGGCTCAGATGGGG - Intergenic
908396739 1:63731925-63731947 ATAAAATCAAGCTTTAGTTGTGG + Intergenic
909085397 1:71164759-71164781 ATAAAATCCTGGCTCAGGTTTGG - Intergenic
909737526 1:78982292-78982314 GTATATTCAAGGCACAGATGGGG + Intronic
909810081 1:79923003-79923025 ATAACATAAAGGCTCTGATATGG + Intergenic
910488290 1:87740121-87740143 ATAAAATCAAGGCTGTTATGAGG - Intergenic
912022776 1:105126846-105126868 ATAAAATCATTGCTCATAAGAGG - Intergenic
912999820 1:114568695-114568717 AAAAAATCAAGGCACAATTGTGG + Intronic
915552941 1:156645791-156645813 AGAAAATAAAGGCTCAGAGAAGG + Intronic
917032437 1:170708405-170708427 ATATAATTAAGGCTTAGGTGTGG + Intronic
917036886 1:170757815-170757837 AGAAAATCAAAGGTCAGGTGTGG + Intergenic
917219898 1:172717508-172717530 AAAAAAAAAAAGCTCAGATGGGG - Intergenic
921354639 1:214274696-214274718 ATAAACACAAGGCTCAAGTGGGG + Intergenic
922410631 1:225371502-225371524 ATAAAATCAAGAATTAGATAAGG + Intronic
923183921 1:231550893-231550915 ATCAAATCATGGCTCAGACAAGG + Intronic
1063569970 10:7206343-7206365 ATATCATGAAGGCTTAGATGTGG - Intronic
1063935291 10:11071378-11071400 ATAAAAGTAAGGTTCAGAGGAGG + Intronic
1063955955 10:11267269-11267291 ACATAATAAAGGCTCAAATGTGG + Intronic
1065388972 10:25162873-25162895 ATAAAATTATGGGCCAGATGTGG + Intergenic
1065407403 10:25384727-25384749 CTAAAATGAAAGCTAAGATGAGG - Intronic
1066276992 10:33878888-33878910 ATAATATCTAGGATCAAATGTGG + Intergenic
1068115954 10:52738126-52738148 GAAAATTCTAGGCTCAGATGGGG + Intergenic
1069582546 10:69575495-69575517 AAAAAATCAAGGCCCAGAGAGGG + Intergenic
1070253174 10:74790831-74790853 AAAAAATTAAGGGTTAGATGTGG + Intergenic
1070256565 10:74818196-74818218 AAAAAAAAAAGGCTCAGGTGTGG + Intergenic
1070886062 10:79900699-79900721 ATAAAATGATGGCTAAAATGAGG - Intergenic
1071042197 10:81325572-81325594 ATAAAATTATGGGTCAGGTGTGG + Intergenic
1071301038 10:84256387-84256409 AAAAAATTGAGGCTGAGATGGGG + Intronic
1072240369 10:93490150-93490172 ATAAGATCAAGGCTCTGCTTGGG + Intergenic
1072282620 10:93881746-93881768 AAACAATAAAGGCACAGATGTGG - Intergenic
1072890972 10:99324400-99324422 AGAAAATTGAGGCTCAGATTAGG - Intergenic
1073166759 10:101461526-101461548 ATAAAATCAAATCTGAGAAGAGG + Intronic
1074316206 10:112363912-112363934 AAAAAAAAAAGGCTGAGATGGGG + Intergenic
1075023183 10:118966107-118966129 ATTAAAACAAGGGTCAGATGTGG + Intergenic
1075194798 10:120347028-120347050 AAAAAAAAAAGGCTAAGATGAGG - Intergenic
1076078776 10:127559058-127559080 ATAATCTCAAGCCTCAGTTGGGG + Intergenic
1076587692 10:131560663-131560685 AGAAAATGAGGGCTCAGATCTGG + Intergenic
1078096260 11:8299121-8299143 AGAAAATCAAAGCTCAGACAGGG + Intergenic
1078400478 11:11021969-11021991 ATAAAATGAAGGTTCAGAGAGGG - Intergenic
1078666349 11:13328874-13328896 GAAAAATCAAGGCTCAGAGAGGG - Intronic
1079515947 11:21268810-21268832 ATAAAAACCAGACTCAGATGTGG + Intronic
1079667370 11:23122833-23122855 CTAAAATGAAGGCTCATTTGAGG - Intergenic
1081342921 11:41949769-41949791 ACAAAATCAAAGCTTAGATAGGG - Intergenic
1082002733 11:47402450-47402472 ATAAAAGCAAGAGTCAGGTGTGG + Intergenic
1082074565 11:47966361-47966383 ATAAAATAAAGGCCCAGAGAAGG - Intergenic
1082075551 11:47973436-47973458 AAAAAATCAAAGCCCAGAAGTGG - Intergenic
1085336513 11:75700888-75700910 AGGAAATCAGGGCTCAGACGGGG + Intergenic
1085427881 11:76421193-76421215 AGAAAATGAAGGCTCAGAGAAGG + Intergenic
1087054198 11:93917658-93917680 ATAAAATCACAGCTGAAATGTGG + Intergenic
1087844537 11:102957680-102957702 ATGAAATGAAGGCTAAAATGAGG + Intergenic
1088610403 11:111571043-111571065 ATAAATCCAAGGGGCAGATGGGG - Intergenic
1089273743 11:117318906-117318928 ATAAAATCAAGTCTCAAAAAGGG - Intronic
1090511389 11:127379112-127379134 ATAGAATTAAGTCTCAGATTTGG - Intergenic
1090866417 11:130704753-130704775 ATTAAATGAAGGGTCAGGTGCGG + Intronic
1090966622 11:131603255-131603277 ATAAAGTCAAGACTCTGAAGTGG - Intronic
1091354011 11:134921812-134921834 AAGAAACCAAGGCTCAGAAGGGG + Intergenic
1092369577 12:7905592-7905614 ATAAATTCAAAGCTCAGAAGTGG + Intergenic
1092445571 12:8553511-8553533 ACAAAATCATGCCTCATATGAGG - Intergenic
1094297832 12:28927822-28927844 ATGAAGTCAAGGCTCAGACCTGG - Intergenic
1095093570 12:38130396-38130418 GTAAAATCCAGGGCCAGATGTGG - Intergenic
1095144522 12:38709801-38709823 ATAAATTCATGGCTCAGTTTTGG - Intronic
1095183020 12:39167869-39167891 ATAAAAACAAAACTCAGGTGTGG - Intergenic
1095205049 12:39430273-39430295 ATAAAATTAAGGGTCAGGTGTGG + Intronic
1095461392 12:42447985-42448007 ATAAAATCACTGCTCATATGAGG - Intronic
1096850677 12:54433866-54433888 ATAAAATAAAGAATGAGATGGGG - Intergenic
1097647573 12:62255363-62255385 ATAAAATCAAGGTTCATAGTAGG - Intronic
1099689288 12:85930656-85930678 AGAAAATCAAGGGTCATATAAGG + Intergenic
1099778872 12:87168775-87168797 ATAAAGTAAAAGCTCAAATGTGG - Intergenic
1100403481 12:94252230-94252252 AGAAAATCAAGACTGAAATGAGG - Intronic
1101715011 12:107302955-107302977 ACAAAATCAAAGGCCAGATGTGG - Intergenic
1101755093 12:107615183-107615205 GTAAAATCAAAAGTCAGATGTGG - Intronic
1102032776 12:109752640-109752662 GTAAAACAAGGGCTCAGATGAGG + Intronic
1103069128 12:117926246-117926268 AGAAAACCAAGGCTGGGATGGGG - Intronic
1103252514 12:119512480-119512502 ATGAAATCAATGCTGTGATGGGG + Intronic
1103982932 12:124748436-124748458 GTAAAATCAAGACTCATCTGTGG - Intergenic
1104626903 12:130364326-130364348 ATAAAATCAAGCCCCAGATGTGG - Intronic
1105831010 13:24162755-24162777 AGAAAAGGAAGGCTCAGAGGAGG + Intronic
1106478757 13:30120611-30120633 AAAAAACAAAGGCTCAGAAGAGG + Intergenic
1107106613 13:36650018-36650040 ATAAAATAAAGGAGCAGAAGAGG + Intergenic
1108386240 13:49901838-49901860 AAAAAATCCTGGGTCAGATGTGG + Intergenic
1108498785 13:51049914-51049936 AAGAAATCAAGGCCCAGAGGGGG - Intergenic
1108537261 13:51396998-51397020 ATAAAATCAAGACTCAGTTTAGG + Intronic
1109068803 13:57736528-57736550 ATAAAATCCAGTCTCTAATGTGG - Intergenic
1109450375 13:62506689-62506711 ATAAAATCAGGGGTCACATGTGG + Intergenic
1110179326 13:72596140-72596162 GGAAAGCCAAGGCTCAGATGAGG + Intergenic
1111018038 13:82406402-82406424 ATCAGAACAAGACTCAGATGTGG + Intergenic
1111731448 13:92081977-92081999 AGAAAATCAAGGCCCAGATAAGG + Intronic
1114849179 14:26362185-26362207 CTAAAATCATGGCTCTGTTGTGG - Intergenic
1116181835 14:41544247-41544269 ATGAAAACAAGGTTCAGAAGTGG - Intergenic
1117729910 14:58712074-58712096 ATAAAACAAAGACTCTGATGTGG + Intergenic
1119371895 14:74153133-74153155 ATAAAATGTAGGCTCAGGTCAGG - Intronic
1122245282 14:100398390-100398412 ATAAAACCAATGCTCCGATAGGG - Intronic
1125097355 15:35870261-35870283 AGAAAGTCAAAGCACAGATGGGG - Intergenic
1127244119 15:57152373-57152395 AACAAAACAAGGCTCAGAGGTGG + Intronic
1128434688 15:67635091-67635113 ATAAAACAAAGGCTGGGATGAGG - Intronic
1128693321 15:69742277-69742299 ATAAAACCAAGGCCCAGAGAGGG + Intergenic
1128915998 15:71563006-71563028 ATAACATCAAGTCTCAGATCTGG + Intronic
1129032251 15:72627900-72627922 AGAAAATCCAGGCTCTGAGGAGG + Intergenic
1129124012 15:73422418-73422440 ATAAAATGAAAGCTCAGCAGGGG - Intergenic
1130579433 15:85122649-85122671 ATAAAAGCAAGGGTTAGAGGTGG + Intronic
1131333920 15:91529138-91529160 CTAAGGTCAAGGCTCAGAAGAGG + Intergenic
1131386521 15:92012754-92012776 AAAAAAAAAAGGCTCAGACGAGG + Intronic
1131520115 15:93108194-93108216 ACAAAATCATGGGCCAGATGTGG + Intergenic
1131654544 15:94442363-94442385 GGAAACTCAAGGCTCAGATCTGG - Intronic
1133588956 16:7224147-7224169 AAAAAAAAAAGGCTCAGTTGAGG + Intronic
1133669152 16:8000515-8000537 CTAAAATAAAGACTAAGATGAGG + Intergenic
1134291471 16:12905223-12905245 AGAAAATCATGGCTCAGGTGAGG + Intronic
1134412684 16:14016175-14016197 ATCAAATGAAGGAACAGATGTGG + Intergenic
1135189262 16:20341525-20341547 ATAAAATGCAGGCTCTGATTTGG + Intronic
1136500517 16:30667759-30667781 AGGAAATCAAGGCTCAGAGGGGG - Intronic
1136541670 16:30930662-30930684 ATAAAAGCAAGGCCCAGAGAGGG - Intronic
1137334969 16:47539222-47539244 ATAAACTCAAAGCTCACAGGTGG - Intronic
1137392277 16:48091685-48091707 AGAAAGTCAAGGCTCAGACTGGG + Intronic
1137823482 16:51467489-51467511 ATTATAATAAGGCTCAGATGAGG - Intergenic
1137902536 16:52284486-52284508 ATAAAATTAAGTTTCAGAGGAGG + Intergenic
1139250988 16:65495936-65495958 AGAAAACCAAAGCTCAGATGGGG + Intergenic
1141381592 16:83582060-83582082 AGAAACTCAAGGCTCAGAGAGGG - Intronic
1141401455 16:83750653-83750675 ATAAAATGAAGGCAGAGATCAGG + Intronic
1142893438 17:2959781-2959803 AAGAAATTAAGGCTCAGAAGGGG - Intronic
1144838725 17:18172429-18172451 AGGAAAGCAAGGCTCAGAGGAGG - Intronic
1145201940 17:20953450-20953472 CTAAAATAAAGGCTAATATGTGG + Intergenic
1146967579 17:37046053-37046075 ATAAAATCCAGTCTGAGATGGGG - Intronic
1147861032 17:43523530-43523552 ATAAAATGTAAGCTCAGCTGAGG + Intronic
1148342483 17:46881592-46881614 AACAAAGTAAGGCTCAGATGAGG - Intronic
1148412853 17:47482696-47482718 ATGAATTCAGGGATCAGATGGGG + Intergenic
1149549720 17:57531409-57531431 AAATAACCAAGGCTCAGAGGAGG + Intronic
1149820684 17:59774259-59774281 ATAACATCAAAGGACAGATGTGG + Intronic
1150043065 17:61884179-61884201 AAAAAAACAAGCCTTAGATGAGG + Intronic
1150430851 17:65115933-65115955 AAAAAATCAAGTCACAGATGGGG - Intergenic
1150923975 17:69513377-69513399 CTTAAATCAAGGCTGAGATTCGG + Intronic
1151401130 17:73856827-73856849 ATTTAATCAAGGAACAGATGGGG + Intergenic
1152326928 17:79647014-79647036 ATAAAATCAAGGAGGAGAGGTGG - Intergenic
1154398548 18:14012333-14012355 ATAAAATTTTGGCTCAGATGTGG - Intergenic
1155974583 18:32115300-32115322 ATAAAATAAAAGTACAGATGAGG - Intronic
1156422122 18:36965857-36965879 ATAAAATCTAGGCTTATAAGTGG - Intronic
1156898633 18:42274929-42274951 TTAAAATGTAGGCTCTGATGAGG + Intergenic
1158293912 18:55972676-55972698 AAAAAATCAAGGCTCAATTCAGG - Intergenic
1158902310 18:61975456-61975478 ATAAAATCATGCCTCTGAAGGGG + Intergenic
1160268215 18:77359231-77359253 AGAAAACCAAGACTCAGAGGTGG + Intergenic
1162355083 19:10178264-10178286 ATAAAATAAAGGGCCAGGTGAGG + Intronic
1164873556 19:31667301-31667323 CTGAAACCAAGGCCCAGATGTGG + Intergenic
1165530289 19:36393843-36393865 ACAAAATGAAGTCTCTGATGTGG + Exonic
1165762174 19:38327846-38327868 AGGAAATCAAGGCTCAGAGACGG - Exonic
1167755894 19:51413518-51413540 AAGAAATGAAGGCTCAGAGGGGG + Intronic
1168244522 19:55105058-55105080 AAAAAAAAAAGGGTCAGATGCGG - Intronic
926307995 2:11653518-11653540 ATAAAGTCATGGCTCAGAGACGG + Intergenic
927441055 2:23118257-23118279 AGAAAATCAAGGCCCAAATAAGG + Intergenic
927846621 2:26475631-26475653 TTAAAATCAAGGCTAATATGAGG + Intronic
927847346 2:26478378-26478400 AAAAAATCAAGGCTAATATGAGG - Intronic
928193161 2:29192977-29192999 ATAAATACAAGGCCCAGATGTGG - Exonic
928762177 2:34597507-34597529 ATAAAATAAAGCCTCAGATTTGG - Intergenic
929159841 2:38820567-38820589 ATAAAACCAAGGACCAGAAGAGG - Intronic
930950168 2:57131815-57131837 ATAAAAAGATGGCACAGATGTGG - Intergenic
932362651 2:71121806-71121828 ATAAAATAAAGGCTAATATTAGG + Intronic
932599563 2:73113927-73113949 ATAAAATGTCAGCTCAGATGGGG + Intronic
933756836 2:85646103-85646125 TTAAAATCCAGGTTCTGATGTGG - Intronic
934086828 2:88516885-88516907 ATGAAATCAAGTGTTAGATGAGG - Intergenic
935731821 2:106070513-106070535 ATAAAATGCAGCCTCAGGTGAGG + Intronic
936053465 2:109242733-109242755 AGAAGATCAAGGCCCAGCTGTGG - Intronic
937934992 2:127236353-127236375 ATCAAAACAAGATTCAGATGTGG + Intergenic
939663303 2:144917974-144917996 ATAAAAATGCGGCTCAGATGTGG - Intergenic
940967449 2:159855633-159855655 AGAAAATCAAGGCTCAGAGAGGG - Intronic
940991521 2:160102349-160102371 ATGAAATCAAAACTCAGAAGTGG + Intronic
941458529 2:165738345-165738367 ATAAAATCAAGCTTCAGACTTGG + Intergenic
942337979 2:174911560-174911582 CTAAAATTTAGGCTGAGATGGGG + Intronic
944119738 2:196227954-196227976 ATAAAAACAAGAGTCAAATGAGG + Intronic
946136940 2:217655317-217655339 AGAAAATCAAGTATCACATGAGG - Intronic
947269904 2:228322448-228322470 ATAAAAGCAAGGCACAAATATGG - Intergenic
1169997093 20:11570791-11570813 CTAAAATCAAGGCACTGGTGAGG + Intergenic
1170241887 20:14175219-14175241 AGAAAATGTAGGCTAAGATGTGG - Intronic
1171340841 20:24427108-24427130 ATAAAATCATGCCTGAGATAAGG + Intergenic
1172214067 20:33222489-33222511 ATAAAATCAGGGTTCAGATGAGG + Intronic
1172228942 20:33324018-33324040 AGGAAACCAAGGCCCAGATGGGG + Intergenic
1173222222 20:41139551-41139573 AGGAAATCAAGGCTCAGAGAAGG - Intronic
1173672559 20:44809137-44809159 AGGAAATCCAGGCTCAGAGGTGG + Intronic
1174379341 20:50146668-50146690 AAAAGACCAAGGCTCAGAAGGGG + Intronic
1174421488 20:50401894-50401916 AGAAAACCAAGGCTCAGAGAGGG + Intergenic
1174480434 20:50827617-50827639 ACAAAATAAAGGATGAGATGGGG - Intronic
1175225195 20:57440496-57440518 AGGAAATCGAGGCTCAGAGGAGG - Intergenic
1175561638 20:59934827-59934849 ATAGAATCAAAGCTCAGTTGTGG + Intronic
1175701383 20:61140096-61140118 ATAAAAACAAGGGACAGATTGGG - Intergenic
1178707135 21:34885667-34885689 ATAAGATCAAGACCCAGCTGAGG + Intronic
1178902015 21:36605889-36605911 ATAACTTCAAGGGTCAGAGGAGG + Intergenic
1179354046 21:40642100-40642122 GGAAAATCAAGGCTCAGAGAGGG + Intronic
1179543795 21:42101049-42101071 AGAAAATCAAGGCTGGGAAGTGG - Intronic
1179661223 21:42876691-42876713 AGAAAATAAAGGGTGAGATGTGG - Exonic
1181011679 22:20044547-20044569 ATCAAATAAAAGCTCAGCTGTGG + Intronic
1181675977 22:24452690-24452712 ACAAAAAGAAGACTCAGATGAGG + Intergenic
1182926209 22:34127802-34127824 ATAAAACCAAGGCACAGAGAGGG + Intergenic
1183650979 22:39152999-39153021 ACAAAGTCAAGGCTCAGAGCGGG + Intergenic
1183961029 22:41412080-41412102 TAAAAATCAAGGCTCAGAGAGGG - Intergenic
1184110731 22:42392700-42392722 AAAAGAACAAGGCTCGGATGGGG + Intronic
1184139570 22:42570788-42570810 CTAAAATCCAGGCCCAGAAGTGG + Intronic
949124226 3:426505-426527 ATGAAATCAAGCCACATATGTGG - Intergenic
949389447 3:3543036-3543058 ATAAAATGAAGGCTCAGACAAGG + Intergenic
949664649 3:6323243-6323265 AAAAAACAAAGGCTCAGATAGGG + Intergenic
950433243 3:12963632-12963654 AGAAAATCAAGACTCAGAGATGG + Intronic
952499827 3:33950469-33950491 AGAAAACCAAAACTCAGATGAGG - Intergenic
952817354 3:37457315-37457337 TTAAGATCTAGGCTCTGATGGGG + Intronic
952831736 3:37570873-37570895 TCTAAATCAGGGCTCAGATGAGG + Intronic
953158637 3:40397856-40397878 AAAAAACCATGGCTCAAATGTGG - Intronic
953875255 3:46662936-46662958 ACATAAGCAAGGCTCAGCTGCGG + Intergenic
955049976 3:55400932-55400954 ATGAAATGAAGGCACAGGTGGGG - Intergenic
955852004 3:63230700-63230722 ATGAAATTGAGGCTCAGGTGAGG - Intronic
956049449 3:65231869-65231891 CTAAAATCAAGGCATTGATGTGG - Intergenic
956490918 3:69771069-69771091 ATAAAATCAAGTTTCTGATCTGG - Intronic
956515408 3:70041062-70041084 ATAAAAGTAAGGCTCAGTTTTGG + Intergenic
956556548 3:70529664-70529686 AGAAAATGAAGGCTCAGAGCAGG - Intergenic
959084606 3:101837822-101837844 ATAAAATCCAGAATCAGATTAGG + Intronic
959269503 3:104188994-104189016 ATAAAATCATGGCTCAGCGCTGG + Intergenic
959467423 3:106704865-106704887 ATGAAATAAAGGCTCAGAAATGG + Intergenic
961976699 3:131032690-131032712 AGAAAACCAAAGCTCAGATTAGG - Intronic
962003472 3:131324806-131324828 AGAAAACCAATGCTCAGAGGGGG - Intronic
962266900 3:133950284-133950306 ATAAAATCTAGGCCCAGCCGGGG - Intronic
962777966 3:138681455-138681477 ATAAAATCAAGCCTCAGACTGGG - Intronic
964723149 3:159787872-159787894 ATAGGATTCAGGCTCAGATGAGG - Intronic
965495447 3:169392648-169392670 ATAAAATAAGGCCTAAGATGAGG + Intronic
967546716 3:190738629-190738651 CTAAAATCAAAGCTGTGATGGGG - Intergenic
967714532 3:192747275-192747297 GGAAAATCAAGGCTCAGAACAGG + Intronic
970899328 4:21140498-21140520 TTAAAATCGAGGCACAGAGGAGG - Intronic
970909178 4:21254717-21254739 AGAAAATTAAGGCTGAGAAGAGG + Intronic
972234805 4:37119037-37119059 AAAAAATCTGGGCTCACATGTGG + Intergenic
973953684 4:56041941-56041963 TTAAAATCTATGCTCAGAAGTGG + Intergenic
976811203 4:89103200-89103222 AGAAAAGAAAGGCTCAAATGTGG - Intronic
977504205 4:97881154-97881176 ATAAAATAAAGTCTGAGAAGAGG + Intronic
977785181 4:101025052-101025074 ATAAAATCAAGTCTTGGTTGTGG - Exonic
979503199 4:121463274-121463296 ATAAACTCAAGGTGCAAATGAGG - Intergenic
979522455 4:121684760-121684782 ATAAATTGCAGGCACAGATGAGG - Exonic
980821987 4:138029252-138029274 GTAAAAAAAAAGCTCAGATGTGG - Intergenic
981281058 4:142959131-142959153 TTAAAATCTAGGCTTACATGGGG + Intergenic
981680052 4:147387245-147387267 ATAAAAGTTAGGCTCAGAAGAGG - Intergenic
982604744 4:157500143-157500165 ATGAAATAAAGGCTCAGGTGAGG + Intergenic
983375628 4:166923914-166923936 ATAAAATTTAGGGTCAAATGAGG - Intronic
983627659 4:169818548-169818570 ATATAATGAAGGCTCAGACAGGG - Intergenic
984374599 4:178911512-178911534 ATAAAATCAAAGCTTAGTTGGGG + Intergenic
984540616 4:181032820-181032842 ATAAGTACAAGGCTGAGATGTGG + Intergenic
984750132 4:183264213-183264235 GTAAAGTCACGGCTCAGAAGGGG + Intronic
986986937 5:13511171-13511193 ATAAAATACTGGCTCAAATGTGG - Intergenic
989250105 5:39303696-39303718 AAAAAATCAATTCTCAGCTGGGG + Intronic
989485981 5:41992360-41992382 CTAAAATCAAGGGTCTGGTGTGG + Intergenic
990279897 5:54239029-54239051 ACAGAATCAAGACTCAGATGAGG + Intronic
990887731 5:60614191-60614213 ATAAAATCAAGGCTCAGATGGGG - Intronic
991094858 5:62729048-62729070 ATATAATGAAGGCTCATAAGTGG + Intergenic
991457053 5:66815307-66815329 AGAAAGTCAAGCCTCAGATAAGG - Intronic
991492952 5:67201088-67201110 ATAAAATCAAGCCAGACATGAGG - Intergenic
991710958 5:69408256-69408278 ATAAAAACAAGCCCCAGAGGAGG - Intronic
992852637 5:80826010-80826032 CTAAACTCAAGGCTCAGGTGTGG + Intronic
994018186 5:94992785-94992807 ATAAAAGGAAGGTTGAGATGGGG - Intronic
994172695 5:96675580-96675602 AGAAAAGAAAGGATCAGATGAGG + Exonic
994945690 5:106386056-106386078 ATAAAATCTAGGCCCAAATTGGG + Intergenic
998403759 5:141862308-141862330 GAAAAATCAAGCCTCAGATGGGG + Intronic
999075987 5:148796023-148796045 ATAAAATCAAAGAACCGATGGGG + Intergenic
999319611 5:150605422-150605444 AGAAAATTGAGGCTCAGATAGGG + Intronic
999320217 5:150609879-150609901 AGAAAATGGGGGCTCAGATGGGG - Intronic
1000219601 5:159200254-159200276 ATAAAAAAAAAGCTCAGAGGAGG + Intronic
1000932300 5:167266061-167266083 ATAAAGTCAAGTCCCAGTTGTGG + Intergenic
1000942217 5:167375377-167375399 ATAAAATCCAGGCGCAGTTCCGG + Exonic
1001819319 5:174697647-174697669 ATAAAATGGAGGCTCAGAGAGGG - Intergenic
1002309232 5:178304632-178304654 ATAAACTCAAGGCCCAGACAAGG + Intronic
1003436081 6:6089686-6089708 CTAAAATCAAGGCATTGATGGGG - Intergenic
1004687971 6:17965873-17965895 ATAAAAGTAAGGCTAAAATGGGG + Intronic
1006859662 6:37162470-37162492 ACAAAGTCAAGGTTCAGAGGAGG - Intergenic
1007272543 6:40649431-40649453 AAAAAAACCAGGCTCAGAAGCGG - Intergenic
1007505096 6:42329428-42329450 ATAATGTGAAGGCTCAGGTGGGG + Intronic
1007826761 6:44606620-44606642 AGAAGATCAAGGCTCAGAGGTGG - Intergenic
1009539186 6:64929210-64929232 AAAAATTGAAGGCTGAGATGAGG + Intronic
1011142031 6:84169021-84169043 ATAAAATCATGCCTCTGATATGG + Intronic
1012233111 6:96783396-96783418 ATAAAATCAAGCGACAGCTGCGG - Intergenic
1012497473 6:99849986-99850008 ATAAAAGCAAGGCTCATAAAAGG + Intergenic
1012710721 6:102600620-102600642 ATAAAATCAACCATCAGATGTGG + Intergenic
1013823916 6:114188183-114188205 AGAAGCTGAAGGCTCAGATGGGG + Intronic
1015631508 6:135236379-135236401 ATAAAATCAAGTCTCAGTGAAGG + Intergenic
1016310969 6:142733163-142733185 ATAAAATTAACCCTCATATGAGG + Intergenic
1016638975 6:146326922-146326944 AGAAAATCAAGGCACATATTGGG - Intronic
1016703629 6:147081491-147081513 ATAACATGAAGGAACAGATGAGG + Intergenic
1018526388 6:164714319-164714341 ATCAAAACCAGGCTCAGATATGG + Intergenic
1019495056 7:1334033-1334055 AAAAAAAAAAGGATCAGATGTGG - Intergenic
1021310953 7:19095115-19095137 ATGCAATCAAGGATCACATGAGG - Intronic
1021553615 7:21897915-21897937 ATAAAATGAAAGCTGAAATGAGG - Intronic
1022301818 7:29108940-29108962 ATAAAATTAGGCCTCCGATGTGG - Intronic
1023390637 7:39708280-39708302 ATTTAATCAAGGCTCAGAAATGG + Intergenic
1023575955 7:41627004-41627026 ATCAAATCAAGCCCCAAATGTGG + Intergenic
1025079815 7:55971700-55971722 ATGAAATAAATGCTCAGTTGGGG + Intronic
1026249770 7:68659323-68659345 ATAAAAACAATGGCCAGATGCGG + Intergenic
1027221394 7:76216490-76216512 AAGAAATCAAGGCTCAGAGAAGG - Intronic
1027355736 7:77352891-77352913 ATAAAATCAATTCACAGTTGTGG - Intronic
1027647133 7:80815886-80815908 ATGAAATCAAAGATAAGATGTGG + Intronic
1028411900 7:90539055-90539077 TCAAAACCAAGGCACAGATGTGG - Intronic
1032806246 7:135357586-135357608 ATAAAATCAGAGCACAGATCTGG + Intergenic
1033260299 7:139838290-139838312 ATAAAAGCAATGCTGAGAGGGGG - Intronic
1036512556 8:9414082-9414104 AGGAAACCAAGGCTCAGATCAGG - Intergenic
1038200959 8:25412202-25412224 ATAAAATCAGGTAGCAGATGCGG - Exonic
1038509081 8:28114236-28114258 ATAAAATAAAGGCTCTGAAATGG + Intronic
1038881768 8:31622046-31622068 ATAAAATCAAGCCACAGACTGGG + Intergenic
1042502116 8:69520856-69520878 ATAAAATCAAAACTCAGAGCAGG - Intronic
1043094503 8:75949373-75949395 ATAAAAGCTAGGATCAGTTGAGG + Intergenic
1044707855 8:95025441-95025463 CTAAAATTAAGGTTCAGATAAGG - Intronic
1045064753 8:98435368-98435390 AGAAAAGCAAGGTGCAGATGGGG + Intronic
1048037308 8:130689397-130689419 AGGAAATCAAGGCCCAGAAGAGG - Intergenic
1049021315 8:139959430-139959452 ATAAAATGGAGGCTCAGAGAGGG + Intronic
1049967625 9:793607-793629 ATAAAACCAAGGATCTTATGTGG - Intergenic
1049967724 9:794441-794463 ATAAAACCAAGGATCTTATGTGG - Intergenic
1050460403 9:5872634-5872656 ATTAAAACCAGACTCAGATGTGG + Intergenic
1050604389 9:7285425-7285447 ATAAAATCACTGCTAAGCTGAGG + Intergenic
1050655347 9:7822333-7822355 GTAAAATCAAGGCTCTAAGGAGG - Intronic
1052745553 9:32436896-32436918 AGAAAAGCAAGGCTCAGAGATGG - Intronic
1054453298 9:65415133-65415155 ACAAAGACAAGGCTGAGATGTGG + Intergenic
1054874998 9:70086776-70086798 ATTGAATCAAGGCTCAGCTGGGG - Intronic
1054952332 9:70866599-70866621 TTCAGATGAAGGCTCAGATGAGG + Intronic
1056020404 9:82433151-82433173 ATGAAACCAAGGGTCAGAAGTGG + Intergenic
1056774675 9:89502263-89502285 ATTAGATCAATGGTCAGATGGGG - Intergenic
1056985312 9:91358758-91358780 AAAACATCAAGTCTCAGATATGG - Intronic
1057006372 9:91564192-91564214 ATAAATTCTAGACTCACATGTGG - Intronic
1057435108 9:95032785-95032807 ATAAAATAAAAGCACAGAGGTGG - Intronic
1059436208 9:114278008-114278030 AGAAAACCAAGGCTCAGAGAGGG - Intronic
1060098518 9:120815565-120815587 ATAAAATCAATGCTAAGAAATGG + Intronic
1061516726 9:131094420-131094442 GTAAAATCAAGGCTACGGTGGGG + Intronic
1061592812 9:131608921-131608943 ATAAACTCCAGGCTGTGATGAGG - Intronic
1061997129 9:134192285-134192307 AGAAAACCAAGGCTCAGAGAGGG + Intergenic
1062084085 9:134639725-134639747 CCCAACTCAAGGCTCAGATGAGG + Intergenic
1186111630 X:6263663-6263685 ATAATACTAAGGCTCAGAGGGGG - Intergenic
1186170280 X:6869433-6869455 TAAAAATCTGGGCTCAGATGGGG + Intergenic
1187973133 X:24678324-24678346 ATGAAATAAAGGAACAGATGAGG + Intergenic
1188418116 X:29962384-29962406 ATAAAATAAAGGGACAAATGTGG - Intergenic
1188859458 X:35239584-35239606 ATAAATTCAAATCTCAGAAGTGG + Intergenic
1189644428 X:43111564-43111586 ATAAGATACAGGCTCAGATGAGG + Intergenic
1189749346 X:44203577-44203599 AAAAAATGAAGTCTCAGAGGCGG - Intronic
1192128061 X:68521075-68521097 ATAAACTGAAGGGTCAAATGTGG - Intronic
1192288759 X:69768128-69768150 GTAAAGTCAAGCCACAGATGGGG - Intronic
1194006520 X:88500650-88500672 ATAAAATCATGGTTCAGAGGTGG + Intergenic
1195422072 X:104686843-104686865 ATAACATCTAGGAACAGATGTGG - Intronic
1196365638 X:114920824-114920846 AAAAAATCAATTCCCAGATGAGG + Intergenic
1197255200 X:124255673-124255695 ATAAAATCAAGGCATATGTGTGG - Intronic
1197462633 X:126761541-126761563 ATAAAATTAAGGGACAGATGTGG - Intergenic
1197783305 X:130177419-130177441 AGAAAAACAAGGCTCAGTTCAGG + Intronic
1198610812 X:138397838-138397860 ATAAAATTTTGGCTCAGAAGAGG + Intergenic
1199837364 X:151605256-151605278 AAGAAATCAAGGCTCAGAGATGG - Intronic
1200927060 Y:8664144-8664166 GAAAAATCAAGGCTCATCTGAGG - Intergenic
1200943903 Y:8812600-8812622 ATAAAACCATGGCTCAGAGACGG + Intergenic
1201560593 Y:15312202-15312224 TCAAAATCTGGGCTCAGATGGGG + Intergenic
1201695493 Y:16819623-16819645 ATAGAAACAAAGCTCTGATGTGG + Intergenic