ID: 990888826

View in Genome Browser
Species Human (GRCh38)
Location 5:60625699-60625721
Sequence TTGGAATCCCTGAAGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 442
Summary {0: 1, 1: 1, 2: 2, 3: 44, 4: 394}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990888826_990888831 14 Left 990888826 5:60625699-60625721 CCCTCCTCCTTCAGGGATTCCAA 0: 1
1: 1
2: 2
3: 44
4: 394
Right 990888831 5:60625736-60625758 GACTGCTAAATATTTCCCATAGG No data
990888826_990888832 23 Left 990888826 5:60625699-60625721 CCCTCCTCCTTCAGGGATTCCAA 0: 1
1: 1
2: 2
3: 44
4: 394
Right 990888832 5:60625745-60625767 ATATTTCCCATAGGTCATTGAGG 0: 1
1: 0
2: 0
3: 62
4: 373

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990888826 Original CRISPR TTGGAATCCCTGAAGGAGGA GGG (reversed) Intronic
900716093 1:4145187-4145209 TTTAAATCCTGGAAGGAGGATGG + Intergenic
900757487 1:4446655-4446677 TTGGAATCTCTCTGGGAGGAGGG - Intergenic
900921609 1:5675207-5675229 TTGGAGTTCCTGAAGAAGGTGGG - Intergenic
901388231 1:8925242-8925264 ATTGAATCCGGGAAGGAGGAAGG - Intergenic
902538872 1:17138363-17138385 GACGAATCCCTGAAAGAGGATGG - Intergenic
902798220 1:18813395-18813417 TTGGGAGACGTGAAGGAGGATGG + Intergenic
902991723 1:20192374-20192396 TTAGAACCTCTGGAGGAGGAGGG + Exonic
904287879 1:29464228-29464250 TTGGAGTCTCTGAAGGAGGCAGG - Intergenic
904406395 1:30291827-30291849 TTGGAATACCAGAAGGAGAGGGG + Intergenic
905032123 1:34892389-34892411 TGGGAGTTCCAGAAGGAGGAGGG + Intronic
905260240 1:36712154-36712176 TAAGAATCACAGAAGGAGGAAGG - Intergenic
905805496 1:40874107-40874129 TTGGAAGCCCTGAGGCTGGAGGG + Intergenic
905846524 1:41238465-41238487 GTGCAAACCTTGAAGGAGGAGGG - Intronic
906239991 1:44236960-44236982 CTGGAGTCCCTGGAGGAGGTGGG - Intronic
906448765 1:45925663-45925685 TTGTCAGCCCTGAAGTAGGAGGG + Intronic
906537197 1:46558020-46558042 TTTGATTTCCTGAATGAGGAAGG + Exonic
907027235 1:51132618-51132640 TTGGTATCCCTGAAAGAGATGGG + Intronic
909264282 1:73536730-73536752 TTGGCATTCCTGAAAGAGAAGGG - Intergenic
909397179 1:75183153-75183175 TTGGCATCCCTGAAAGAGATGGG + Intergenic
910297443 1:85664165-85664187 TTGGCATCCCTGAAGGGGATGGG - Intronic
910504748 1:87937244-87937266 TTGGAATGAATGAAGGAAGATGG - Intergenic
910602442 1:89046403-89046425 ATGAAATGCCTGAAGAAGGAAGG + Intergenic
910638431 1:89434826-89434848 ATGAAATGCCTGAAGAAGGAAGG - Intergenic
910943077 1:92558121-92558143 CAGGAGTCCCAGAAGGAGGAAGG - Intronic
911310577 1:96287945-96287967 TTGGTATCTCTGAAAGAGAAGGG - Intergenic
912003539 1:104864322-104864344 TTGGAGACTCTGAAGGGGGAAGG - Intergenic
914387713 1:147187711-147187733 TTGGAATCCTGAAAGGATGAGGG + Intronic
914400757 1:147317829-147317851 TTGGAGTACCTGAAGGAGACGGG + Intergenic
915287381 1:154861616-154861638 GTGGATTCCCTGTAGGAGGTTGG - Intronic
915646345 1:157275406-157275428 ATTGAATCCGGGAAGGAGGAAGG + Intergenic
915675440 1:157525832-157525854 TAGGAACCCTTGAAAGAGGAAGG + Intronic
915847086 1:159277745-159277767 TGGGAATCCCTAAAGGTGGAAGG - Intergenic
917062702 1:171057491-171057513 CTGGAATACCTGAAGGAGATGGG + Intronic
917356275 1:174130085-174130107 TTGGAGTACCTGAAGGAGATGGG - Intergenic
917582171 1:176390330-176390352 CTGGAGTACCTGAAGGAGAAGGG - Intergenic
918098149 1:181351163-181351185 TGGGAATACCTTGAGGAGGACGG + Intergenic
918223132 1:182454484-182454506 TAGGAATTCCTTAAGGAGAATGG - Intronic
918344547 1:183595208-183595230 CAGGAAACCCTGAAGGAGGCAGG + Intronic
919260901 1:195192006-195192028 CTGGCATCCCTGAAAGAGAAGGG + Intergenic
920668425 1:207983726-207983748 ATGGAATCCCTGGAGGGGGCTGG + Intergenic
922664387 1:227456188-227456210 TTGGAAATTCTGAAGGAGGATGG - Intergenic
923135338 1:231112359-231112381 TTGGAATCCCAGAAGAAGAGGGG + Intergenic
923531859 1:234818227-234818249 TGGGAATCTCTGATGAAGGATGG + Intergenic
924466918 1:244306348-244306370 TTTAAACCCCTGAAGTAGGATGG - Intergenic
1063096752 10:2915462-2915484 TTGGAATCCCTGGAGGAGGTGGG + Intergenic
1063960957 10:11305125-11305147 TTGGATTTCCTGTGGGAGGAGGG - Intronic
1066073469 10:31846822-31846844 TTGGAGTTCCAGAAGGAGAAAGG - Intronic
1066796967 10:39133000-39133022 TTGGAGTCCCTTAAGGAGTATGG + Intergenic
1068405409 10:56582145-56582167 TTGGAATCCAGAAAGGAGTATGG + Intergenic
1068597999 10:58924669-58924691 TTGAAATCCCTGGAGGAGGAGGG + Intergenic
1069940695 10:71953305-71953327 ATTGAATCCAGGAAGGAGGAAGG + Intergenic
1071134412 10:82437152-82437174 TTGGAGTACCAGAAGGAGAAGGG - Intronic
1072040926 10:91605950-91605972 TGAGAAGCTCTGAAGGAGGAAGG - Intergenic
1074003502 10:109395004-109395026 TTGGAATACCAGAAGGAGATGGG + Intergenic
1075531554 10:123234462-123234484 TTGGAATCCCTGGAACAAGATGG + Intergenic
1075632636 10:124010491-124010513 TTGGAAGCACTGAGGGAGGAAGG + Intronic
1075700744 10:124468056-124468078 TTGGAATCCTTCAGGGAGAAGGG + Intronic
1076519617 10:131073505-131073527 TTGGAGGCCCTGATGGAGGCAGG - Intergenic
1076672137 10:132128504-132128526 TTGGAATCCCAGAAAGAGAAAGG - Intronic
1076726008 10:132413666-132413688 CTGGAAGCCCGGAAGGACGATGG - Intronic
1076858149 10:133127511-133127533 TTGGACTCCCTGGGAGAGGAGGG - Intronic
1077353492 11:2103883-2103905 TTCGAAACCCTGAAGGAGTCAGG + Intergenic
1078501815 11:11886618-11886640 TTGGGATACCTGAAGGAGACAGG + Intronic
1078603401 11:12753620-12753642 TTGGAGTTCCTGTAGGATGAAGG + Intronic
1079288460 11:19162908-19162930 TTGGAATCTCTGAATCAAGAGGG + Intronic
1079392751 11:20036486-20036508 GTCTAATCCCTGTAGGAGGATGG + Intronic
1079426220 11:20344200-20344222 TTGGAGTACCTGAAGGAGACGGG + Intergenic
1079869789 11:25782588-25782610 TTGGCATCCCTGAAAGAGCTAGG + Intergenic
1080130741 11:28791929-28791951 TTGGAGTACCTGAAGGAGATGGG - Intergenic
1080969756 11:37258478-37258500 TTGGAAGTGTTGAAGGAGGAGGG + Intergenic
1081567592 11:44269657-44269679 TAGGAATCCCTGGAGGAAAAGGG - Intronic
1081724620 11:45319555-45319577 TTTTCATCCCTGAACGAGGAGGG + Intergenic
1082211074 11:49502124-49502146 TTGGAAAACCTGAATGAAGAAGG + Intergenic
1082914851 11:58422140-58422162 ATGTAATACCTGAATGAGGAAGG - Intergenic
1082974758 11:59060483-59060505 TGGGAATCCGTGAAAGAGTAGGG - Intergenic
1083476211 11:62917283-62917305 CTAGAATCCCTAAAGAAGGAGGG + Intronic
1083593349 11:63907774-63907796 TTTGAATCTCTGTAGGAGGAGGG - Intronic
1083962664 11:66022967-66022989 CCGGAAGCCCTGAATGAGGAAGG + Exonic
1085172554 11:74461680-74461702 TAGCAAGCCTTGAAGGAGGAGGG - Intronic
1085539149 11:77250242-77250264 TTGGGACTACTGAAGGAGGAAGG - Intronic
1085593183 11:77784106-77784128 TTGAGATCCTAGAAGGAGGATGG - Intronic
1085784332 11:79437822-79437844 TGGGAATCCAGGAAGAAGGAGGG - Intronic
1086059406 11:82684899-82684921 TTGCAATCCCTGTATGTGGAGGG + Intergenic
1086189281 11:84059398-84059420 GTGGAAGCCCTGAAGGAAGCAGG - Exonic
1086638570 11:89122916-89122938 TTGGAAAACCTGAATGAAGAAGG - Intergenic
1086839487 11:91667328-91667350 TTGGAATCCCTAGAGCATGAAGG - Intergenic
1086869638 11:92021473-92021495 TTGAAACTCCAGAAGGAGGAGGG - Intergenic
1088765756 11:112974917-112974939 TTAGAAACCCTGAAGGAGATAGG - Intronic
1089323666 11:117643008-117643030 CTGAAATCCCTGCAGGCGGAGGG - Intronic
1089412801 11:118260954-118260976 CTTGACTCCATGAAGGAGGATGG + Intronic
1090467285 11:126945649-126945671 TTAGAAGCCCTCAAGGAGGAGGG - Intronic
1092106877 12:5927570-5927592 TTGGAAGCCCTGATGGTAGATGG - Intronic
1092384979 12:8029316-8029338 GTTAAATGCCTGAAGGAGGAAGG - Intergenic
1092860341 12:12714753-12714775 ATGGAGTCCCTGAAGGAACAGGG - Intergenic
1093012064 12:14117855-14117877 TTGGAGTCCCAGAAGGAGAAGGG + Intergenic
1093413508 12:18894839-18894861 TTGGAGTACCTGAAGGAGACTGG - Intergenic
1093497831 12:19778243-19778265 TTGGCATCCCTGAAAGAGACAGG - Intergenic
1094275483 12:28669960-28669982 TTGGAGTGCCTGAAGGAGACAGG + Intergenic
1095310107 12:40688615-40688637 TTGGAATGTTTGAAGAAGGAGGG + Intergenic
1096699486 12:53372708-53372730 TTGAAGGCCCTGAAGGAGAAAGG - Intergenic
1096704906 12:53414371-53414393 TGGAAATCCCTGAAGGAAGACGG - Intronic
1097620952 12:61938893-61938915 TTGGAGACTCAGAAGGAGGAGGG + Intronic
1098047181 12:66412005-66412027 TTGGGGTACCTGAAGGAGAAGGG + Intronic
1098165788 12:67696140-67696162 TTTGAACACCTCAAGGAGGAAGG + Intergenic
1098831844 12:75373600-75373622 TTGGTATCCCTGAAGGATGCTGG - Intronic
1099143370 12:79008202-79008224 CTGGAATATCTGAAGGAAGAGGG + Intronic
1099394681 12:82122613-82122635 TTGGCATCCCTGAAAGAGATGGG + Intergenic
1099684154 12:85864811-85864833 TTGGAGTAACTGAAGGAGGCAGG - Intergenic
1099877605 12:88428568-88428590 TTGGAGTCCCTCAATGAGAAGGG + Intergenic
1101601991 12:106217971-106217993 TTGGAATCTCTGAAGCAGAGGGG - Intergenic
1101800048 12:108013826-108013848 CTGGAAGACCTGAAGGAGGAAGG - Intergenic
1104244449 12:127024313-127024335 TTAGAGACTCTGAAGGAGGAAGG + Intergenic
1105480160 13:20767743-20767765 TTGGAGTCCCTGAAAGGGAAGGG - Intronic
1105843376 13:24274457-24274479 TGGGAACCACTGAAGGGGGATGG + Intronic
1108424218 13:50282212-50282234 TTGGCATTCTTGAATGAGGAGGG + Intronic
1110538270 13:76678053-76678075 TTGGTATCCGTGATGGAGGAAGG + Intergenic
1110790340 13:79580798-79580820 TTGGAGTACCTGAAGGAGACAGG - Intergenic
1111045331 13:82806590-82806612 TTGGAATACCTGAAAGAGACAGG + Intergenic
1111604668 13:90521481-90521503 TTGGCATCCCTGAAAGATGGGGG + Intergenic
1112412749 13:99178190-99178212 TTGCCAGGCCTGAAGGAGGAGGG - Intergenic
1113184282 13:107669516-107669538 TTGGATTCTCTGAAGAAGCACGG + Intronic
1114134883 14:19835994-19836016 TTGGTGTCCCTGAAGGAGATGGG + Intergenic
1114376531 14:22152573-22152595 TTGGAATCTCTCTGGGAGGAGGG + Intergenic
1114871791 14:26667155-26667177 TAGGAAGACCAGAAGGAGGAAGG - Intergenic
1115958084 14:38804833-38804855 TTGGAATACTTTGAGGAGGACGG - Intergenic
1116394183 14:44428786-44428808 TTGGAATCTCTCTGGGAGGAGGG - Intergenic
1117452383 14:55864297-55864319 TTGGCATCCCTGAAAGAGACAGG - Intergenic
1118052216 14:62041742-62041764 TGGGAAACCCTGAAGGAGAGAGG - Intronic
1118530838 14:66703172-66703194 CTGGAATACCTGAAGGAGATGGG + Intronic
1121682638 14:95806673-95806695 TAGGAATCCCAGAAGGAGAATGG - Intergenic
1126598476 15:50405165-50405187 GTGGAGTCCTTGAAGGAGGAAGG - Intergenic
1126710065 15:51445233-51445255 TTGGAGTCCGTGAGGGAGGAGGG - Intergenic
1127707817 15:61564598-61564620 ACTGAATCCCTGAAGTAGGAAGG + Intergenic
1129381034 15:75166626-75166648 TTGGAATCTCTCTGGGAGGAGGG + Intergenic
1131705235 15:94986861-94986883 TTAGAATCACACAAGGAGGATGG - Intergenic
1131902875 15:97107927-97107949 CTGGAGTCCCTGAAGGAGATGGG + Intergenic
1131939416 15:97544532-97544554 TTGGAGTACCTGAAGGAGATGGG - Intergenic
1133136650 16:3717181-3717203 ATGGGAGCCCTGAAGGAGGCTGG - Intronic
1133504395 16:6397093-6397115 TTGGAGTCCCAGAAAGAGGAAGG + Intronic
1133895523 16:9924645-9924667 TTTGAATCCCTGAAGTAAAAGGG - Intronic
1134763978 16:16739680-16739702 TAGGAAGCTCTGAAGTAGGAAGG + Intergenic
1134982076 16:18619481-18619503 TAGGAAGCTCTGAAGTAGGAAGG - Intergenic
1135218560 16:20593564-20593586 TTGGAGACTCAGAAGGAGGAAGG - Intergenic
1135800233 16:25487752-25487774 TTGGCATCCCTGAAAGATAAGGG - Intergenic
1135805923 16:25542532-25542554 TTGGAATCCTAGAAGGACGAAGG - Intergenic
1135976965 16:27114913-27114935 CTGGAACCCCTGAAGGCAGAGGG + Intergenic
1136481412 16:30544338-30544360 ATTGAATCCATGAAGGAGAAAGG + Intronic
1136732527 16:32429986-32430008 TTGGGATCTCAGAAGGAGGTTGG - Intergenic
1136864782 16:33738380-33738402 TTAGAATCCCTCAAGGACTAGGG - Intergenic
1141011929 16:80409593-80409615 TTGGTATCCCAGAAAGAGAAAGG + Intergenic
1142329833 16:89444702-89444724 TTGGAAAACAGGAAGGAGGATGG + Intronic
1203020554 16_KI270728v1_random:399616-399638 TTGGGATCTCAGAAGGAGGTTGG + Intergenic
1203038889 16_KI270728v1_random:672774-672796 TTGGGATCTCAGAAGGAGGTTGG + Intergenic
1203126279 16_KI270728v1_random:1586516-1586538 TTAGAATCCCTCAAGGACTAGGG - Intergenic
1142911735 17:3099053-3099075 TTGGAGTACCTGAAGGAGACAGG + Intergenic
1143004048 17:3815584-3815606 GTGGAATCCATGGATGAGGAGGG - Intronic
1145359954 17:22203679-22203701 TTGGAATCCCAGTATGAGAATGG + Intronic
1146065292 17:29630308-29630330 TTAGAGTTCCTGAAGGAGGCAGG - Exonic
1146751755 17:35388268-35388290 CTGGAATCCCTGAAAGGGGTGGG - Intergenic
1147319384 17:39636817-39636839 TTGGGATGGCTGAAGGAGGCAGG + Intergenic
1147339567 17:39745589-39745611 GTGGGATCCCTGAAATAGGAGGG + Intronic
1147740301 17:42667615-42667637 CTGGAATCCCTGAGGCTGGAGGG - Intergenic
1148874363 17:50677966-50677988 TGGGAATTCCTGGAGGAGCAGGG - Intronic
1148995753 17:51708072-51708094 TTGTAATCACTGAAGCAGCAAGG - Intronic
1149242016 17:54662116-54662138 TTGGAGTACCTGAAGGAGATGGG - Intergenic
1151404117 17:73875847-73875869 TTGGAAACCCAGAGTGAGGAGGG - Intergenic
1152139259 17:78526673-78526695 TTGGGGTCGCTGAAGGAGAACGG + Exonic
1152477613 17:80528371-80528393 TTGGAAGGCCTGAGAGAGGAGGG + Intergenic
1152703590 17:81831926-81831948 TTGGGTCCCCTGGAGGAGGAAGG - Intronic
1156151237 18:34245890-34245912 TTGGCATCCCTGAAAGAGATGGG - Intergenic
1158729013 18:60002617-60002639 TTGGAATACCTGAAGAAGACAGG - Intergenic
1159155764 18:64579659-64579681 TTGGAGTACCTGAAGGAGACAGG + Intergenic
1159220437 18:65456881-65456903 TTGGCATTCCTGCAGGAGTAAGG + Intergenic
1159959940 18:74547522-74547544 CAGGCATCCCTAAAGGAGGATGG - Intronic
1161486683 19:4539673-4539695 AGGGAAGCCCTGGAGGAGGAGGG - Intronic
1161504683 19:4637497-4637519 ATGGAACCCCAGAGGGAGGAAGG - Intergenic
1162085057 19:8243709-8243731 TTGAAATCCATGAAGATGGATGG - Intronic
1163517239 19:17772443-17772465 TTGGAAGCGCTGAAGCAGGAGGG - Exonic
1163844264 19:19629564-19629586 TTCGAGTCCGTGAAGGAGGCAGG + Exonic
1164590835 19:29505978-29506000 TTGGACTCCCTAAGTGAGGAGGG + Intergenic
1164851482 19:31487905-31487927 TTGCAATAGCTGAAGGTGGAAGG - Intergenic
1164875643 19:31684840-31684862 TTGGAATCACTAAGGGAGAAAGG - Intergenic
1165044474 19:33093873-33093895 TGGGAATCCCTGAAGGTCTAAGG - Intronic
1165116718 19:33533258-33533280 CTGGAAACCAGGAAGGAGGAGGG - Intergenic
1165843276 19:38802223-38802245 TCTGAATCCCTAAAGGAGGAGGG + Intronic
1165854527 19:38871482-38871504 TTGTAGTCCCAGAGGGAGGAGGG - Intronic
926747592 2:16171723-16171745 GTGGAATCACTGAAGAAAGAAGG + Intergenic
928294283 2:30069433-30069455 TCGGAATGACTGAGGGAGGATGG - Intergenic
930453412 2:51574173-51574195 TTGCAATCCCAAAAGGATGAGGG + Intergenic
930545930 2:52767014-52767036 TTGGAGTACCTGAAGGAGATGGG + Intergenic
931263237 2:60638345-60638367 CTGGAGTCCCTGCATGAGGAGGG + Intergenic
932013632 2:68002011-68002033 TTGGAGTACCTGAAGGAGACAGG + Intergenic
932749934 2:74365099-74365121 TAGCAATGCCTGAAGGAGGAGGG + Exonic
933336240 2:80963315-80963337 TTGGTGTCCCTGAAGGAGATGGG - Intergenic
933602377 2:84346666-84346688 TTGGAGTACCTGAAGGAGATGGG - Intergenic
933746857 2:85577940-85577962 TCGGGCTCCCTGGAGGAGGAAGG - Intronic
933904903 2:86882292-86882314 TTGGAGACTCAGAAGGAGGAGGG + Intergenic
934476541 2:94597282-94597304 TTGGAACCTCAGAAGCAGGAGGG + Intronic
935058941 2:99591644-99591666 TTCGAATCCCTGATTGAGAAGGG - Intronic
935081260 2:99797466-99797488 TTGGAGTCCCTACAGGAGAAAGG + Intronic
935796017 2:106642253-106642275 TTCTCATCCCTGCAGGAGGAAGG - Intergenic
936225314 2:110644153-110644175 TGGGAATACCAGAAGGAAGAAGG + Intronic
936367325 2:111869870-111869892 TTGGAGACTCAGAAGGAGGAGGG - Intronic
936740264 2:115497239-115497261 TTTCAACCCCTGAACGAGGAGGG + Intronic
936848930 2:116872820-116872842 TTGGAGTACCTGAAGGAGACAGG - Intergenic
940592738 2:155749769-155749791 TTGGAGTACCTGAAAGAGGCAGG + Intergenic
942924239 2:181412630-181412652 TTGGAATACCAGAAGGAGACAGG + Intergenic
944280917 2:197895805-197895827 TTAGAAGCCTTGAAGGAGAATGG + Intronic
946536956 2:220640937-220640959 CTGGAGTCTCTGAAGGAGTAAGG + Intergenic
947909543 2:233792101-233792123 GTGGGACCCCTGAAGGAGGCTGG + Intronic
947940552 2:234050994-234051016 AGGGCATCCCTTAAGGAGGATGG - Exonic
948182040 2:235989711-235989733 GGGGAATCCCTGGAGGAGGTGGG + Intronic
948917542 2:241043065-241043087 TTGGAGTCTGCGAAGGAGGATGG + Intronic
1169083255 20:2810604-2810626 TTGGAGACTCAGAAGGAGGAGGG - Intergenic
1169472247 20:5896692-5896714 AGGAAATCCCTGAAGGAGGGAGG + Intergenic
1170262999 20:14432733-14432755 TTGGAATACCTGAAGAACAAAGG - Intronic
1170496749 20:16932149-16932171 TTGGAGTACCTGAAGGAGATGGG + Intergenic
1171773019 20:29341109-29341131 TTGGAATTCCTGAAGAAGGTGGG + Intergenic
1171903324 20:30877372-30877394 TTGGAGTTCCTGAAGAAGGTGGG - Intergenic
1172299032 20:33835429-33835451 CTGGAGTCCCCAAAGGAGGAGGG - Intronic
1173819452 20:46011129-46011151 TTGGAACCACTGCAGGAGGAGGG - Exonic
1173933475 20:46841063-46841085 TTTGAAGGACTGAAGGAGGATGG + Intergenic
1174435048 20:50500176-50500198 TTGGAATAACTGAAAGTGGAGGG - Intergenic
1174546742 20:51331435-51331457 GTGGAATCCATGTAGGAGGTTGG + Intergenic
1177511210 21:22090634-22090656 TTGGAGTACCTGAAGGAGACGGG - Intergenic
1177878776 21:26668181-26668203 TTGGAATACCTGAAGGAGATGGG - Intergenic
1178705469 21:34869182-34869204 CGAGAATCCCTGAGGGAGGAGGG - Intronic
1179667135 21:42920684-42920706 TTGGCATCCTTGATGTAGGAAGG + Intergenic
1180318547 22:11299903-11299925 TTGGAGTTCCTGAAGAAGGTTGG + Intergenic
1180336721 22:11583330-11583352 TTGGAGTTCCTGAAGAAGGTGGG - Intergenic
1181947362 22:26528671-26528693 TTGGAATCTCTGAAGGAATAAGG + Intronic
1182758564 22:32701811-32701833 TTGGAATCCCAGAAGAAGAGAGG + Intronic
1182828630 22:33286415-33286437 TTGGAATCCCTGGGGCAGGGGGG + Intronic
1183055729 22:35304404-35304426 TTGAAATCCTTGAAAGAAGAGGG - Intronic
1184187766 22:42876247-42876269 TTGGCATCCGTGGAGGAGAAGGG + Exonic
1184281813 22:43441746-43441768 TTAAAATCCATGAGGGAGGAAGG + Intronic
1184413317 22:44338144-44338166 TTGGACCCCTTGGAGGAGGAAGG - Intergenic
1184868590 22:47218957-47218979 TGGGCATCACTGAAGGAGGCCGG + Intergenic
1185384870 22:50527007-50527029 TAGGAAGCCGTGAAGGAGGGAGG + Intronic
949119765 3:372223-372245 TTGGAGTACCTGAAGGAGATGGG - Intronic
949413900 3:3796778-3796800 TTGGAATTTTTGAAGGAGAACGG - Intronic
949592857 3:5511728-5511750 TTGGAATACCTGAAGGAGACAGG + Intergenic
952634179 3:35506650-35506672 TTGGAGTACCTGAAGGAGACAGG + Intergenic
952925398 3:38316197-38316219 TTGGAATCACACAATGAGGATGG + Intronic
953796868 3:45992678-45992700 TTGCAACCCTTGAAGGAGGTGGG + Intronic
954413638 3:50382240-50382262 TGGGGGTCCCTGAAGGAGGAAGG - Intronic
954804263 3:53206841-53206863 TTGGAATCACTGAAGGAGGAAGG + Intergenic
954852449 3:53615218-53615240 TTTGAACCCCTGAGGAAGGAAGG - Intronic
955057806 3:55471882-55471904 TGTGAATCCCTGGAGGAAGAGGG - Intronic
955534869 3:59912228-59912250 TTGGACTCCTTGAAAGAGGCTGG - Intronic
955717687 3:61847614-61847636 CTGGAATCCCCGAAGGAGGGAGG - Intronic
957629935 3:82706018-82706040 TTGGAGTACCTGAAGGAGATGGG - Intergenic
958481793 3:94653079-94653101 TTGGAATACCTGAAGGAATCAGG - Intergenic
960105788 3:113795162-113795184 TTGGAAATCCTGAAAGAGAAGGG + Exonic
960653506 3:119978279-119978301 TTGGAATCTCTTTGGGAGGAGGG - Intronic
962363522 3:134761382-134761404 TTGGACTCCCTCCAGGAGAAAGG + Intronic
963205910 3:142634213-142634235 TTATGTTCCCTGAAGGAGGAGGG + Intronic
963448404 3:145444147-145444169 TTGGAATACTTTAAGTAGGATGG - Intergenic
964569946 3:158099633-158099655 TGGGAATCCCTGAAGGGGCCTGG - Intronic
964656106 3:159067521-159067543 TTGGAGTCTTTCAAGGAGGAAGG - Intronic
964831372 3:160887235-160887257 TTGGAGTACCTGAAGGAGACGGG + Intronic
965485531 3:169273791-169273813 TTGGAAACCCTTGAAGAGGATGG + Intronic
966250350 3:177859057-177859079 TTGGAATACCAGAAGGAGACAGG - Intergenic
966652204 3:182314249-182314271 TTGGAGTACCTGAAAGAGAAGGG - Intergenic
967789764 3:193534762-193534784 TTGGAATCCTAGAAGGAGAGGGG + Intronic
969284765 4:6196280-6196302 TAGGAAGCCCTGTAGGAGGTGGG - Intronic
969728639 4:8940273-8940295 CTGGAAACCTTGTAGGAGGAAGG + Intergenic
970168142 4:13261800-13261822 TTGGAAGCTCTGAAGCAGGCTGG + Intergenic
971516795 4:27497336-27497358 TTGGAGTACCTGAAGGAGATGGG + Intergenic
971767528 4:30852622-30852644 GAAAAATCCCTGAAGGAGGAAGG + Intronic
972237593 4:37151454-37151476 TTGGTATCCTTGCAGGGGGAAGG + Intergenic
972928239 4:44039217-44039239 TGGGAAGCCCTGGAGGAAGATGG + Intergenic
973221981 4:47737078-47737100 TTGGAACTACTCAAGGAGGAAGG + Intronic
973936175 4:55849184-55849206 CTTGAACCCCTGAAGGAGGAAGG - Intergenic
976769485 4:88635527-88635549 TTGGAATACCTGAAAGAGACAGG + Intronic
978136406 4:105266785-105266807 TTGGAGTACCAGAAGGAGGTGGG + Intronic
978161610 4:105555166-105555188 TTGGATTCTTTGAAGGTGGAAGG + Intronic
978208370 4:106106169-106106191 TTGGCATCCCTGAAAGAGAGGGG + Intronic
979556934 4:122058462-122058484 TTGGAATTCCAGAAGAAGGGAGG - Intergenic
980496986 4:133598821-133598843 TTGGAATCTCTGTGGGAGGAGGG + Intergenic
981143772 4:141301662-141301684 TTGCAATTTCTCAAGGAGGACGG - Intergenic
981203465 4:142011321-142011343 TTGGAATCGTTTAAGTAGGATGG + Intergenic
981641224 4:146945801-146945823 TCGGAATCACTGAGAGAGGAGGG - Exonic
982528384 4:156507119-156507141 TTGGAGTACCTGAAGGAGATGGG + Intergenic
983098720 4:163597981-163598003 TTGGTGTATCTGAAGGAGGAGGG - Intronic
983547892 4:168981647-168981669 TTAGCATCCCTGAAAGAGAAGGG + Intronic
984182199 4:176497662-176497684 TTGAAATCCCAAAAGGAGGCTGG - Intergenic
984201881 4:176732602-176732624 GTGGAATCCGTGAAAGTGGATGG + Intronic
984215904 4:176912185-176912207 TTGGAGTACCTGAAGGAGACGGG + Intergenic
985083348 4:186288633-186288655 TTGGAGTCCCTGAAGGACCCAGG + Exonic
986415810 5:7526825-7526847 CTGGAATCCCTTAATGATGAAGG + Intronic
987016429 5:13824811-13824833 CAGGATTACCTGAAGGAGGAAGG + Intronic
987444636 5:18002460-18002482 CTGGATAGCCTGAAGGAGGAAGG + Intergenic
987701053 5:21398757-21398779 TTGGATGCCCTGGAGGTGGAAGG - Intergenic
987937212 5:24481636-24481658 TTGGAATCTCTCTGGGAGGAGGG + Intergenic
987988426 5:25180070-25180092 TTGGATTATCTGAAGGAGGCAGG - Intergenic
989348057 5:40452529-40452551 TTGGAATACCTGAAAGAGATTGG - Intergenic
990516754 5:56537343-56537365 TTGGAATGCCAGAAGTTGGAGGG + Intronic
990888826 5:60625699-60625721 TTGGAATCCCTGAAGGAGGAGGG - Intronic
991063706 5:62403983-62404005 TTGGAGTCACAGAGGGAGGAAGG + Intronic
991266466 5:64725575-64725597 TCGGAGTCACTAAAGGAGGAAGG - Intronic
993365391 5:87029065-87029087 TTGGAGTACCTGAAGGAGATCGG - Intergenic
993540051 5:89138136-89138158 TTGGAGACTCTGAAGGGGGAAGG - Intergenic
994696470 5:103078662-103078684 TTGGAATACCTGAAAGAGATGGG - Intergenic
995594039 5:113729828-113729850 TTGGAGTACATGAAGGAGAAGGG - Intergenic
995831407 5:116359735-116359757 TTGCAATCACTGGAAGAGGAAGG - Intronic
996287566 5:121812645-121812667 TTGGAGTACCTGAAGGAGATGGG - Intergenic
996965701 5:129305325-129305347 TTGGAGTACCTGAAGGAGGCGGG - Intergenic
998660730 5:144234416-144234438 TTGTAATCCCTGGAATAGGAAGG - Intronic
999368231 5:151036844-151036866 TTGGGAGCCCAGAAGGAGCAGGG - Exonic
999575408 5:152971227-152971249 TTGGAAACTCAGAAGGAGGAGGG + Intergenic
1000293817 5:159895690-159895712 TTGGAATGCCAAAGGGAGGATGG - Intergenic
1000497717 5:162006439-162006461 TTGGAATAGCTGAAGGAAAATGG + Intergenic
1001026592 5:168229617-168229639 TTGGAATCCCTGAGAGTAGAAGG + Intronic
1002409548 5:179062702-179062724 TTTGAAGCCCAGAAGGAGGCAGG + Intronic
1003756726 6:9129006-9129028 TTGGAATTCCCAAAGCAGGAGGG + Intergenic
1006212738 6:32411376-32411398 TTGGATTCCCTGGTGAAGGATGG - Intergenic
1007798411 6:44370221-44370243 TTTGAATCCCAGCAGGAGGGTGG + Intronic
1009904086 6:69847326-69847348 TAGCAAGCCCTGAAGCAGGATGG - Intergenic
1009946313 6:70345794-70345816 TTGGCATCCCTGAAAGAGATGGG - Intergenic
1013287273 6:108692427-108692449 TTGGAATCCCTGAGGGTCAAAGG + Intergenic
1014031560 6:116711395-116711417 TTGTAATTTCTGAAGGTGGAAGG + Intronic
1014752235 6:125268901-125268923 TTGCAACCACTGAAGGAGGGAGG - Intronic
1015933900 6:138389236-138389258 TTTGAATACCTGAAGGAGAAAGG + Intergenic
1015988894 6:138914714-138914736 TTGGAGGCACTGCAGGAGGATGG + Exonic
1017141232 6:151191827-151191849 TTTGAACCCCTGAAGGACAAGGG - Intergenic
1017502809 6:155040969-155040991 TTGTAATGCCTGATGGAGGAGGG + Intronic
1017556211 6:155572983-155573005 TTAGAATCCCAGAAGGAGAAAGG - Intergenic
1018524783 6:164696858-164696880 TTGGAATCATTGGAAGAGGAAGG + Intergenic
1019495430 7:1337301-1337323 TTGGAGTTCCTGAAGGAGAGGGG - Intergenic
1020487802 7:8740140-8740162 TATGAAACCCTGAAGGAGAAAGG - Intronic
1020787711 7:12591261-12591283 ATTGAATCCTGGAAGGAGGAAGG + Intronic
1021355903 7:19652952-19652974 CTGGCATCCCTGAAGGAGATGGG + Intergenic
1021873132 7:25023194-25023216 TTGGAGACTCTGAAGGGGGAGGG - Intergenic
1022634803 7:32121255-32121277 TTGGAATACCTGAAGGAGACAGG + Intronic
1022754461 7:33270736-33270758 TTGGCATCCCTGAAAGAGATGGG + Intronic
1023175166 7:37429173-37429195 GTGGAATCACTGAAGGAGGTGGG - Intronic
1023216923 7:37872304-37872326 TTGGAAACCCTGTAGTTGGAAGG - Intronic
1024063778 7:45716813-45716835 TTGGAATGGCTGAGGGAGGCAGG + Exonic
1024099668 7:46016940-46016962 TTGGAGTACCTGAAGGAGACAGG + Intergenic
1024113627 7:46172302-46172324 TTGGAATGCCTGAGGGGGCAGGG + Intergenic
1024319304 7:48049066-48049088 TTGGAATCTCTCTGGGAGGAGGG - Intronic
1024363014 7:48488380-48488402 TTGGAAGCCCTCAAGTTGGAAGG + Intronic
1024478269 7:49837505-49837527 TTGGAATCCCTGAAGGCCGGGGG + Intronic
1025041855 7:55652528-55652550 TTGGAATACCTGAAAGAGACAGG + Intergenic
1025730884 7:64106414-64106436 TTGAAATCCCTGATGCAAGAGGG + Intronic
1027279374 7:76594776-76594798 TTGGCATCCCTGAAAGAGAGGGG + Intergenic
1028232698 7:88324453-88324475 TGGGCATCCCTGAAAGATGAGGG + Intergenic
1029219739 7:98978791-98978813 TGGGAAGCCCTGACGGAGTACGG + Exonic
1029364295 7:100107296-100107318 TTGGAGTCCCTGGAGCTGGAGGG + Exonic
1029494922 7:100891330-100891352 TTGGGATCCCTGCGGAAGGAAGG + Exonic
1029790116 7:102834019-102834041 TTGGAAACCATGATGAAGGAAGG + Intronic
1029957510 7:104655031-104655053 TTGGACTAGCTGAAGGAAGAAGG - Intronic
1030106773 7:105994097-105994119 TTGAAATGCCTGAAGGAACAAGG - Intronic
1030224396 7:107132699-107132721 TGGGAAAACTTGAAGGAGGAAGG + Intronic
1031239702 7:119221072-119221094 TTGGCATCCCTGAAAGAGATGGG + Intergenic
1031725942 7:125238997-125239019 TTGTAATCCCTAAAGGAAGTTGG - Intergenic
1032358464 7:131231556-131231578 TTGAACTCTCTGCAGGAGGATGG + Intronic
1032444709 7:131972333-131972355 TTGGAATACCTGAAAGGGAAGGG - Intergenic
1033075464 7:138246144-138246166 TTGGAATCCCAGAAGGATAAAGG + Intergenic
1033390824 7:140925243-140925265 TTGAAATCCTAGAGGGAGGAAGG + Intergenic
1033641412 7:143265573-143265595 TTGGAACCCCTGGATGGGGAGGG + Intronic
1033715007 7:143991804-143991826 TTTTCTTCCCTGAAGGAGGATGG + Intergenic
1034306763 7:150049493-150049515 ATGGAAACCCGGAAGGAGCAGGG - Intergenic
1034800081 7:154051149-154051171 ATGGAAACCCGGAAGGAGCAGGG + Intronic
1036948899 8:13122099-13122121 CGGGGATCCTTGAAGGAGGACGG - Intronic
1037524822 8:19714471-19714493 TTGGAATTCCAGAAGGAGACTGG - Intronic
1038998526 8:32953250-32953272 CTGGAATCCCTAACGGAGGTAGG - Intergenic
1039180913 8:34864959-34864981 TTGGAGACCTTGAAGGATGAAGG - Intergenic
1039293688 8:36126559-36126581 TTGGAGTACCAGAAGGAGGTGGG - Intergenic
1039566827 8:38557932-38557954 TAGGAATCCCTCCAGGAGGCAGG - Intergenic
1039846617 8:41330135-41330157 TTGGAAACTCTGAAAGAGCAAGG + Intergenic
1040959927 8:53020634-53020656 TTGGGATACCTGAAGGAGACAGG + Intergenic
1041561944 8:59227800-59227822 TTGGCATCCCTGAAAGGGAAGGG + Intergenic
1042811908 8:72834950-72834972 TTGGAAAACCAGCAGGAGGAAGG + Intronic
1042875627 8:73437993-73438015 CGGGAATCCCTGAGGCAGGAGGG - Intronic
1043233485 8:77831427-77831449 TTGGAATACCTGAAAGAGATGGG + Intergenic
1044135742 8:88583669-88583691 TTGGAATACCTGAAAGAGACGGG - Intergenic
1044940868 8:97342276-97342298 TTGGGATCCCTGGAGGGGCATGG - Intergenic
1045065223 8:98438063-98438085 TTGGAGGCTCAGAAGGAGGATGG + Intronic
1045317772 8:101058186-101058208 TTGGAATCCTTAAAGGAGTTTGG + Intergenic
1045414398 8:101952082-101952104 TTGGAATCCCTGGAAGATGCCGG + Intronic
1046587398 8:116164196-116164218 TTGGAAAGCCTGGAGGATGAGGG - Intergenic
1047152065 8:122274889-122274911 TTGGAATACCTGAATGAGACAGG + Intergenic
1048030155 8:130623507-130623529 TTGGCAAGCCTGAATGAGGAAGG - Intergenic
1048431240 8:134373395-134373417 TTGCAATCCATCAGGGAGGATGG - Intergenic
1048587545 8:135789455-135789477 TTGGAGTACCTGAAGGAGATGGG - Intergenic
1048917217 8:139196792-139196814 TTGGAGTCTGTTAAGGAGGATGG - Intergenic
1049191522 8:141290657-141290679 TTGGCAGCCCTGGAGGAGGGCGG - Intronic
1049350037 8:142159534-142159556 ATGGAATTCCTAAATGAGGAAGG + Intergenic
1049792559 8:144478690-144478712 TTTGAATCCCTGAAAGTTGAAGG - Intronic
1049954564 9:680382-680404 TTGGAGTCCCTCACGGAGGCTGG + Intronic
1050040562 9:1488640-1488662 TTAGAGCCCCTGAAGGAGGTTGG - Intergenic
1050431190 9:5563631-5563653 CTGGAATCTGTGGAGGAGGAAGG + Intronic
1050793026 9:9498066-9498088 TTGGAATCCATGAAGGAGCCAGG + Intronic
1051112711 9:13657464-13657486 GTGGTATCCCTGAAGGGGGGTGG + Intergenic
1052703170 9:31961691-31961713 TTGGCATCCCTGAAAGGGGGAGG + Intergenic
1052851309 9:33380167-33380189 TTGGAATCCCTGGAGCTGAATGG + Intergenic
1053298637 9:36933367-36933389 TTGGCATCCCTGAAGATGCAGGG - Intronic
1053530982 9:38880556-38880578 TTGGCATCCCTGAAAGAGATGGG + Intergenic
1054635156 9:67483376-67483398 TTGGCATCCCTGAAAGAGATGGG - Intergenic
1055340091 9:75272403-75272425 TTGGAAACTCAGAAGGGGGAAGG - Intergenic
1057917853 9:99071475-99071497 TCAGAATCCTTGAAGTAGGAAGG + Intergenic
1058907236 9:109491799-109491821 TTGCAGTCCCTGCAGCAGGAAGG + Intronic
1059095349 9:111407450-111407472 TTTGAATCCCTGAGTGAGGTGGG - Intronic
1059336528 9:113572559-113572581 CTGCAGGCCCTGAAGGAGGAGGG + Intronic
1059366219 9:113788374-113788396 TTTGAATCCCTGGGGAAGGAGGG - Intergenic
1059596445 9:115725350-115725372 TTGGAGTACCTGAAGGAGATGGG + Intergenic
1062567879 9:137171319-137171341 GGGGAGTCCCTGGAGGAGGAGGG - Intronic
1203366779 Un_KI270442v1:265667-265689 TTGGAGTTCCTGAAGAAGGTTGG + Intergenic
1185998128 X:4976639-4976661 TTGGAATCCCAGAAGGAAAGGGG - Intergenic
1186414263 X:9369800-9369822 CTGTCATCCCTGGAGGAGGAGGG + Intergenic
1187644303 X:21329829-21329851 TTGGCATCCCTGAAAGAGATGGG + Intergenic
1188092323 X:25978288-25978310 CTGGAATACCTGAAGGAGACAGG + Intergenic
1188970497 X:36609533-36609555 ATGGAATCAATGAAGGAAGAAGG - Intergenic
1190497993 X:51045517-51045539 TTGGAAGCCTTGAGTGAGGAAGG + Intergenic
1191966930 X:66768911-66768933 TTGGAATCTGTGGTGGAGGATGG - Intergenic
1192481128 X:71487119-71487141 TGGGAGTCCCTGAAGGAAGAGGG - Intronic
1192572816 X:72220654-72220676 TTGGAATCTCTCTGGGAGGAGGG - Intronic
1192917179 X:75665286-75665308 TTGGCATTCCTGAAAGAGAAGGG - Intergenic
1192952080 X:76027631-76027653 TTGGAGTACCTGAAGGAGATGGG + Intergenic
1193788995 X:85796091-85796113 TTGGCATCCCTGAAAGAGAGGGG - Intergenic
1194058051 X:89162603-89162625 TTGGAGTACCTGAAGGAGATGGG - Intergenic
1194365594 X:93010111-93010133 TTGGCATCCCTGAAAGAGAAGGG - Intergenic
1194852124 X:98882333-98882355 TTGGAGTACCTGAAGGAGACGGG + Intergenic
1194903188 X:99540672-99540694 ATGGAGTCCCAGAAGGAGAAAGG + Intergenic
1195519800 X:105818021-105818043 TGGGAATTCCTGGAAGAGGATGG + Intergenic
1195856372 X:109336998-109337020 TTGGCATCACTGAAAGAGAAGGG - Intergenic
1196134126 X:112188650-112188672 TTGGAGTCACTGAAAGTGGAAGG - Intergenic
1197048661 X:122031291-122031313 TTAGAGACCCAGAAGGAGGAGGG - Intergenic
1198758836 X:140010382-140010404 TTGGCATCCCTGAAAGAGATAGG - Intergenic
1198779918 X:140223200-140223222 TTGGCATCCCTGAAAGAGATAGG + Intergenic
1198888571 X:141366854-141366876 TTGGAGTACCTGAAGGAGATGGG + Intergenic
1199857926 X:151775559-151775581 TTTGAATTCATCAAGGAGGAGGG - Intergenic
1199994007 X:153007965-153007987 TTGGAATCCCTCTGGGAGGAGGG + Intergenic
1200427691 Y:3039756-3039778 TTGGAATCTCTCTGGGAGGAGGG - Intergenic
1200673813 Y:6126361-6126383 TTGGCATCCCTGAAAGAGAAGGG - Intergenic
1201071898 Y:10154562-10154584 TTGGAGTTCCTGAAGAAGGTGGG - Intergenic
1201242769 Y:11974757-11974779 TGGGATTCCCAGAAGGAGAATGG - Intergenic
1201355040 Y:13088314-13088336 TTGGAATCTCTCTGGGAGGAGGG - Intergenic
1201356182 Y:13099175-13099197 TTGGAATCTCTCTGGGAGGAGGG + Intergenic
1201614725 Y:15884806-15884828 TTGGAATCTCGGGAGGAGAAAGG + Intergenic