ID: 990892804

View in Genome Browser
Species Human (GRCh38)
Location 5:60666076-60666098
Sequence TGGCAAACAACAGTGGTGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 502
Summary {0: 1, 1: 44, 2: 81, 3: 105, 4: 271}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990892804_990892813 24 Left 990892804 5:60666076-60666098 CCGTCCACCACTGTTGTTTGCCA 0: 1
1: 44
2: 81
3: 105
4: 271
Right 990892813 5:60666123-60666145 CCACCCCTCCAGATCCGGGAGGG No data
990892804_990892817 30 Left 990892804 5:60666076-60666098 CCGTCCACCACTGTTGTTTGCCA 0: 1
1: 44
2: 81
3: 105
4: 271
Right 990892817 5:60666129-60666151 CTCCAGATCCGGGAGGGTGTTGG 0: 1
1: 0
2: 3
3: 11
4: 222
990892804_990892811 23 Left 990892804 5:60666076-60666098 CCGTCCACCACTGTTGTTTGCCA 0: 1
1: 44
2: 81
3: 105
4: 271
Right 990892811 5:60666122-60666144 TCCACCCCTCCAGATCCGGGAGG 0: 1
1: 9
2: 56
3: 135
4: 225
990892804_990892809 19 Left 990892804 5:60666076-60666098 CCGTCCACCACTGTTGTTTGCCA 0: 1
1: 44
2: 81
3: 105
4: 271
Right 990892809 5:60666118-60666140 GACTTCCACCCCTCCAGATCCGG 0: 21
1: 71
2: 95
3: 106
4: 191
990892804_990892810 20 Left 990892804 5:60666076-60666098 CCGTCCACCACTGTTGTTTGCCA 0: 1
1: 44
2: 81
3: 105
4: 271
Right 990892810 5:60666119-60666141 ACTTCCACCCCTCCAGATCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990892804 Original CRISPR TGGCAAACAACAGTGGTGGA CGG (reversed) Intronic
902832947 1:19029481-19029503 TGGGAAACGACAGTGGGGCAGGG - Intergenic
904519225 1:31081612-31081634 TGGTAAACAAGAGTGGTGATTGG - Intergenic
907096539 1:51786502-51786524 TAGAAAACAATAGAGGTGGATGG - Intronic
907159454 1:52359986-52360008 TGGTAATGAACAGTGGTGGCAGG + Intronic
907506075 1:54919145-54919167 CGGCAAACAGCAGTGGTGGACGG + Intergenic
907602277 1:55783545-55783567 CGGCAAACAGCAGTGGTGGATGG + Intergenic
908717659 1:67087517-67087539 CAGCAAACAGAAGTGGTGGACGG - Intergenic
908723227 1:67148228-67148250 CGGCAATCAGCAGTAGTGGACGG + Intronic
908892679 1:68863845-68863867 CGGCCAACAGCAGTGGTGGACGG - Intergenic
910116685 1:83739210-83739232 TGGCAAACAGCAATGGTGGACGG + Intergenic
910173344 1:84401387-84401409 TGGAAAACAACAGTAAAGGAAGG + Intronic
910590511 1:88924646-88924668 CGGCAAACAGCAGTGGTAGACGG - Intergenic
912103654 1:106243427-106243449 TGGCAAAAAGCAGTGTTGGCAGG + Intergenic
913648879 1:120890379-120890401 TTGCAAGCAAATGTGGTGGAGGG - Intergenic
913959126 1:143326188-143326210 TGTTAAACAACAGTGGTGACAGG - Intergenic
914053443 1:144151568-144151590 TGTTAAACAACAGTGGTGACAGG - Intergenic
914077812 1:144373004-144373026 TTGCAAGCAAATGTGGTGGAGGG + Exonic
914101367 1:144593501-144593523 TTGCAAGCAAATGTGGTGGAGGG - Exonic
914125754 1:144814973-144814995 TGTTAAACAACAGTGGTGACAGG + Intergenic
914172721 1:145241544-145241566 TTGCAAGCAAATGTGGTGGAGGG + Intergenic
914297613 1:146344135-146344157 TTGCAAGCAAATGTGGTGGAGGG + Intergenic
914527378 1:148482672-148482694 TTGCAAGCAAATGTGGTGGAGGG + Exonic
914639016 1:149584456-149584478 TTGCAAGCAAATGTGGTGGAGGG - Exonic
917097538 1:171414075-171414097 CGGCATTCAGCAGTGGTGGACGG + Intergenic
917215567 1:172674856-172674878 TGGCAAGCAGCACTGGAGGAGGG - Intergenic
917403535 1:174678931-174678953 TGGCAAACAGCAGTGGTGGATGG + Intronic
917472539 1:175337852-175337874 AGTCTAACAACAGTTGTGGAAGG - Intronic
917724021 1:177812763-177812785 TGGCAAACAGCAGTGGTGGACGG - Intergenic
919082780 1:192886797-192886819 TGGCAAACAGCAGTGGTGGATGG + Intergenic
920029700 1:203029073-203029095 GGGGAAACAGCAGTGGGGGAAGG + Intronic
920639855 1:207741518-207741540 CGGCAAACAGCAGTGGTGGACGG + Intergenic
921562774 1:216678466-216678488 TGGCAAAAAGAAGTGGGGGAAGG - Intronic
922876304 1:228942512-228942534 CGGCAAACAGCAGTGGTGGACGG - Intergenic
922877767 1:228953890-228953912 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1064441124 10:15354492-15354514 TCTCAAAAAAAAGTGGTGGACGG + Intronic
1065199862 10:23302012-23302034 CGGCAAACAGCAGAGGTGGACGG + Intronic
1065222798 10:23513377-23513399 AGGCAAACAGCAGTAGTGGACGG + Intergenic
1066246839 10:33591964-33591986 CGGCAGACAGCAGTGGTGGACGG + Intergenic
1066780757 10:38942735-38942757 TGGCAAAAAGCGGTGGTGGCAGG - Intergenic
1068364279 10:56025284-56025306 TGCCAAACAACATCGGGGGAAGG + Intergenic
1068791298 10:61034052-61034074 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1068792074 10:61039517-61039539 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1068988851 10:63131015-63131037 CAGCAAACAGCGGTGGTGGACGG + Intergenic
1069037966 10:63665000-63665022 CAGCGAACAGCAGTGGTGGATGG + Intergenic
1071082706 10:81831312-81831334 CAGCAAATAGCAGTGGTGGACGG + Intergenic
1071326730 10:84525734-84525756 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1071327418 10:84530674-84530696 TGGCAAATGGCAGTTGTGGATGG + Intergenic
1071331542 10:84565570-84565592 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1071556992 10:86612081-86612103 CGGCAAACAGCCGTGGTGGACGG - Intergenic
1071624766 10:87156534-87156556 TGGGAAACAACAGTGTTTAAAGG + Intronic
1071942678 10:90606955-90606977 TGGGCAACAACAGAGGTGGCTGG + Intergenic
1072378564 10:94841392-94841414 TGGCAAACAGCAGTGGTGGACGG + Intronic
1072472439 10:95724729-95724751 TGGCAAACAGCAGTGGTGGATGG + Intronic
1072650305 10:97290219-97290241 CGGCAAACAGCAGTGGTAGAGGG - Intronic
1074978467 10:118599889-118599911 CGGCAATCAGCAGTGGTGGACGG + Intergenic
1076424293 10:130356594-130356616 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1076813697 10:132903258-132903280 TGGCAGAAAACAGGGATGGAGGG - Intronic
1079678730 11:23265149-23265171 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1080135194 11:28845827-28845849 TTGAAAACCACAGTGGTGGGAGG - Intergenic
1080881486 11:36325361-36325383 TAGCAAACGGCAGTGGTGGACGG + Intronic
1081069741 11:38595865-38595887 CAGCAAATAGCAGTGGTGGATGG + Intergenic
1081070858 11:38606845-38606867 CAGCAAACAGCAGTGGTGGAAGG - Intergenic
1081711009 11:45215367-45215389 TGGCCAAGAACTGTGGAGGATGG - Intronic
1084696423 11:70758339-70758361 CGGTGAACAGCAGTGGTGGATGG - Intronic
1084878722 11:72154300-72154322 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1085601994 11:77863342-77863364 CGGCAAAGAGCAGTGGTGGACGG + Intronic
1085621569 11:78041702-78041724 TGGCAAACAGCAGTGGTGGATGG - Intronic
1085692389 11:78674319-78674341 TGGCCACCCACAGTGGTGGCAGG - Intronic
1088242923 11:107789629-107789651 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1088272397 11:108047933-108047955 TGGCAAAAAAAAGTAGGGGAGGG + Intronic
1088879797 11:113964486-113964508 CGGCAAACAGCAGTGGGGGATGG - Intergenic
1088994316 11:114983162-114983184 TGGCATAAAATAGTGGTGAAGGG + Intergenic
1089440296 11:118510379-118510401 TGGCAAAAAACAAGGCTGGAGGG - Intronic
1089639705 11:119839650-119839672 GGGTAAACGACAGTGATGGATGG + Intergenic
1090263248 11:125337927-125337949 AGACAACCAACAGAGGTGGAAGG - Intronic
1093106666 12:15095461-15095483 TGGCAAACAGCAGTGGTGGACGG + Intergenic
1094640992 12:32275642-32275664 TGGCAAACAGCAGTGGTGGACGG - Intronic
1095284196 12:40389168-40389190 TGGCATTCAGCAGTGGTTGATGG - Intergenic
1095893114 12:47253062-47253084 TGGCAGACAGCAGTGGTGGATGG + Intergenic
1096351238 12:50902861-50902883 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1096352553 12:50912232-50912254 TGGAAAACAGCAGTGATGGACGG + Intergenic
1096860988 12:54527961-54527983 TGGAAAAGAGCAGTGGTTGAGGG + Intronic
1097332736 12:58349901-58349923 TGGCAAAAAAAAGTAGTGGGTGG + Intergenic
1097376748 12:58852228-58852250 CAGCAAACAGCAGTGGTGGGCGG + Intergenic
1097377757 12:58859357-58859379 CAGCAAACAGCAGTGGTGGGCGG + Intergenic
1097658250 12:62396211-62396233 TGTCAAACAACAATGGCAGAAGG + Intronic
1097840840 12:64319958-64319980 CGGCAAACAGGAGTGGTGGACGG - Intronic
1098462787 12:70751324-70751346 TGGCATAGAACAGGGGTGGGTGG - Intronic
1098554358 12:71802013-71802035 TGGAAAAGAACAAAGGTGGAGGG - Intergenic
1098639878 12:72825637-72825659 CAGCAAACAGCAGTGGTAGACGG + Intergenic
1098984869 12:77001448-77001470 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1099292613 12:80790072-80790094 GGCAAAACAGCAGTGGTGGATGG - Intergenic
1100451108 12:94707165-94707187 TGGCAAACGACAATGGTCCAGGG + Intergenic
1101064049 12:101001295-101001317 TAGGAAACAACAGTGGTGAGAGG + Intronic
1101555299 12:105803059-105803081 CGGCAAGTAACAGTGGTGGATGG + Intergenic
1102675402 12:114654735-114654757 TGGCGTACAACAGCAGTGGATGG + Intergenic
1103802552 12:123548793-123548815 TGGTGATCAGCAGTGGTGGATGG - Intergenic
1103872345 12:124100842-124100864 CGGCAATCAGCAGTGGTGGATGG + Intronic
1103873182 12:124106016-124106038 CGGCGATCAGCAGTGGTGGAGGG + Intronic
1104187869 12:126449674-126449696 CGGCCAGCAGCAGTGGTGGACGG + Intergenic
1104850971 12:131873564-131873586 CAGCAAGCAGCAGTGGTGGATGG + Intergenic
1104851969 12:131880556-131880578 TGGCATTCAGCAGTGGTGGACGG + Intergenic
1107156430 13:37172407-37172429 CAGCAAACAGCAGTGGCGGAGGG + Intergenic
1107291912 13:38864152-38864174 TGCCATACAGCAGTGGTGTATGG - Intronic
1108344095 13:49527308-49527330 AGTCAAACAGCATTGGTGGATGG + Intronic
1108557253 13:51606010-51606032 TGGCAAAAGGCAGTGTTGGATGG + Intronic
1108833432 13:54508353-54508375 TGGAAAACAAGAATGCTGGAAGG + Intergenic
1108876192 13:55054003-55054025 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1108877212 13:55061318-55061340 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1109292837 13:60497167-60497189 CGGTGAACAGCAGTGGTGGATGG + Intronic
1109523589 13:63545146-63545168 CGGCCAACAGCACTGGTGGATGG + Intergenic
1109680720 13:65748471-65748493 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1109931290 13:69221993-69222015 CAGCAAACAGTAGTGGTGGACGG - Intergenic
1110660990 13:78059440-78059462 CGGCAAACAGCAGTGGTGCATGG - Intergenic
1110846140 13:80192428-80192450 TGGCAACCAGCAGTGGTGGATGG - Intergenic
1110987077 13:81984444-81984466 TAGCAAACAGCAGTGGTGGATGG + Intergenic
1111021439 13:82457681-82457703 AGGCAAACAGCAGTGGTGGATGG - Intergenic
1111511072 13:89263294-89263316 TTCCAAACAACAGAGGAGGATGG - Intergenic
1111536801 13:89612121-89612143 CGGCAAACGGCAGTGGTGGACGG + Intergenic
1111820395 13:93206892-93206914 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1111910276 13:94303076-94303098 CAGCAAACAGCAGTGGTGGATGG + Intronic
1111975537 13:94963025-94963047 TGGAAACTAACAGTGCTGGAAGG + Intergenic
1112234779 13:97625406-97625428 TGGGAAGCAGCACTGGTGGATGG - Intergenic
1113534720 13:111056598-111056620 TGGCAAATAGCAGCAGTGGATGG - Intergenic
1114355868 14:21907574-21907596 TGGCAAAGAAAAATGGTCGAAGG - Intergenic
1114383847 14:22236732-22236754 TGGCAAACAGCAGTGGTGGATGG - Intergenic
1114384823 14:22243779-22243801 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1115151661 14:30293263-30293285 TGGCGAACAGCAGTGGTGGAAGG - Intergenic
1116118809 14:40694756-40694778 CGCCAAACAGCAGTGGTGGATGG + Intergenic
1116549758 14:46221940-46221962 TTGCAAAAAACAGGGGAGGAAGG + Intergenic
1116740324 14:48746699-48746721 CAACAAACAACAGTGGTGGATGG - Intergenic
1117171807 14:53108124-53108146 TGGCAAACAGCAGTGGTGGATGG - Intronic
1119089946 14:71772217-71772239 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1119708724 14:76805488-76805510 TGGCAAGGCACAATGGTGGAAGG - Intronic
1120107987 14:80517978-80518000 CAGCAAACAGCAGTGGTGGACGG + Intronic
1120250657 14:82058887-82058909 TGGCAAATCAGAGTGGTGGCTGG + Intergenic
1120317318 14:82912174-82912196 TAGCAAACAGCAGTAGTGCAGGG + Intergenic
1120397381 14:83985581-83985603 GCGCAAACAGCAGTGGTGGATGG - Intergenic
1120741931 14:88118104-88118126 TATCAAACAACAGTGGGGAAAGG - Intergenic
1120933405 14:89871169-89871191 TGGCAGACAAGAGTGCAGGAGGG + Intronic
1123125452 14:105942865-105942887 GGGCAAACAGCAGTGGTGGACGG - Intergenic
1202894798 14_GL000194v1_random:744-766 TGGCAGGCACCAGTGCTGGAGGG + Intergenic
1202929293 14_KI270725v1_random:23995-24017 TGTTAAACAACAGTGGTGACAGG + Intergenic
1123423005 15:20147222-20147244 TGTTAAACAACAGTGGTGACAGG - Intergenic
1123532231 15:21153762-21153784 TGTTAAACAACAGTGGTGACAGG - Intergenic
1123987289 15:25657029-25657051 CGGCGAACAGCAGTGGTGGACGG - Intergenic
1124895132 15:33769444-33769466 TGGCAAACCCCACTGGTGGGTGG + Intronic
1126153889 15:45547395-45547417 CAGCGAACAGCAGTGGTGGATGG + Intergenic
1126728345 15:51655636-51655658 CGGCAAACAGCAATGGTGGACGG + Intergenic
1126814204 15:52438858-52438880 TGGCAAACAGCAGTGGTGGACGG - Intronic
1126929057 15:53626463-53626485 CGGCAAAGAACAGTGGTGGACGG + Intronic
1127074522 15:55312237-55312259 CGGCAAACAACAGGGGTGGACGG + Intronic
1128332662 15:66766022-66766044 TGGTTAACTACAGTGGGGGAAGG + Intronic
1128363113 15:66976484-66976506 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1128707603 15:69848913-69848935 AGGCACACAACAGTGCTGCATGG + Intergenic
1128980392 15:72181178-72181200 TGGTAAACAACAAGGCTGGAGGG + Intronic
1129776379 15:78239329-78239351 CGGCAAACAGCAGTGGTGGACGG + Intronic
1131420109 15:92298265-92298287 CAGCAAATAGCAGTGGTGGACGG - Intergenic
1131673844 15:94651138-94651160 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1133737494 16:8627067-8627089 AGGCAAGCAACAGAGGTGGCTGG - Intronic
1135825913 16:25728800-25728822 TGGCAAAACACAGTGGTTCATGG + Intronic
1135937750 16:26795524-26795546 TGCCAAGCAACAGTCGTGCAGGG - Intergenic
1136105489 16:28027079-28027101 GGACACACAGCAGTGGTGGAGGG + Intronic
1136116593 16:28098460-28098482 TGGGAGACATCTGTGGTGGAAGG + Exonic
1136861741 16:33708117-33708139 TGTTAAACAACAGTGGTGACAGG + Intergenic
1136938848 16:34500910-34500932 TGGCAAAAACCCGTGGTGGCAGG + Intergenic
1136960972 16:34847646-34847668 TGGCAAAAACCCGTGGTGGCAGG - Intergenic
1137299955 16:47139379-47139401 AGGAAAATAACAGTGGTGGCAGG - Intronic
1137690353 16:50422442-50422464 TGGCAAACCACAGAGGTGTTGGG + Intergenic
1138097958 16:54228382-54228404 TAGAACACAACAGTGGGGGAAGG - Intergenic
1138154793 16:54693204-54693226 TTGCAAATTGCAGTGGTGGAGGG - Intergenic
1138924200 16:61570600-61570622 TGGCAAAGAACATGGGTGCAGGG + Intergenic
1140359506 16:74332513-74332535 TGGCACCCCACAGTGGGGGAGGG + Intergenic
1140914836 16:79483959-79483981 TGACAAATACCAGTGGTGGTAGG + Intergenic
1141298453 16:82791595-82791617 CAGCAAACAACAGTGGTGGATGG - Intronic
1142148314 16:88501843-88501865 TGGCAAACAGCAGTGGCAGGAGG - Intronic
1142278320 16:89134499-89134521 CGGCAAGCAGCAGTGGTGGACGG + Intronic
1203123240 16_KI270728v1_random:1556301-1556323 TGTTAAACAACAGTGGTGACAGG + Intergenic
1147757748 17:42780006-42780028 TGGCAAACAGAAGGGGAGGAAGG + Intergenic
1148371996 17:47106761-47106783 CGGCAAACAGCACTGGTGGACGG + Intergenic
1148395001 17:47300781-47300803 TGGGAAGCAGAAGTGGTGGATGG - Intronic
1148815564 17:50325589-50325611 AGGGATTCAACAGTGGTGGATGG - Intergenic
1148826730 17:50399327-50399349 CAGCAAACAGCAGTAGTGGACGG + Intergenic
1149243112 17:54673775-54673797 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1150694283 17:67390775-67390797 TTGCAAACCATAGTGGAGGAGGG + Intronic
1151017843 17:70577585-70577607 CGGCGAACAGCAGTGGTGAACGG - Intergenic
1151224445 17:72638348-72638370 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1152866839 17:82729221-82729243 TGGCAAACACCCGTGTTTGAGGG + Intronic
1152975199 18:209600-209622 TGTCAAACCACAGAGGTGGGGGG - Intronic
1153400773 18:4682045-4682067 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1153402050 18:4692000-4692022 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1155141815 18:23050810-23050832 TGGAAATCAACCATGGTGGAAGG - Intergenic
1155749242 18:29399246-29399268 CGGCAAACGGCAGTGGTGGATGG + Intergenic
1156101137 18:33596280-33596302 TGGCTTACTACAGTGGGGGAAGG - Intronic
1157259332 18:46165103-46165125 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1158018220 18:52809650-52809672 CGGCAAACAGCAGTGGGGGACGG + Intronic
1158080884 18:53589350-53589372 AGGAAAACAAGAATGGTGGAAGG - Intergenic
1158152293 18:54386967-54386989 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1158470799 18:57735192-57735214 AGCAAAACAGCAGTGGTGGACGG - Intronic
1158580908 18:58681951-58681973 TGGTCTACAGCAGTGGTGGAGGG + Intronic
1160102769 18:75938543-75938565 CGGCAAACAGCAATGGTGGACGG + Intergenic
1163901126 19:20101075-20101097 CGGCAAACAGCAGTGGTCGACGG - Intronic
1164173170 19:22745520-22745542 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1164866769 19:31610875-31610897 AGGCAGAAAACAGTTGTGGAAGG - Intergenic
1165772002 19:38385573-38385595 TGCCTGACAGCAGTGGTGGAGGG - Exonic
1166287825 19:41843199-41843221 TGGAAAATAACAGTGTAGGAGGG + Intronic
1166419005 19:42620046-42620068 TGAGAAACAAGATTGGTGGAAGG + Intronic
1168147019 19:54425248-54425270 CGGCAAACAGCAGTGGTGGACGG + Intronic
1168367998 19:55805897-55805919 TGGCCAAGAACAGTTCTGGAAGG - Intronic
1202692842 1_KI270712v1_random:103991-104013 TGTTAAACAACAGTGGTGACAGG - Intergenic
924973622 2:153902-153924 CGACAAACAGCACTGGTGGACGG + Intergenic
924974508 2:160386-160408 CGACAAACAGCCGTGGTGGATGG + Intergenic
925023807 2:592583-592605 CAGCAAACAGCAGTGGTGGAGGG - Intergenic
925522491 2:4762307-4762329 AGGTAAACAAAAGTGGTGTATGG - Intergenic
927820330 2:26258604-26258626 TGGCGAACAGCAGTGGTGGAAGG + Intronic
927996553 2:27491133-27491155 TTGCAAACCACTGTGGGGGAAGG - Intergenic
928348185 2:30519878-30519900 TGGCATTCAGCAGTGGTGGATGG - Intronic
928440099 2:31285090-31285112 CGGCAATCAGCAGTGGTGGACGG - Intergenic
928676629 2:33657541-33657563 CGGCAAACAGCAGTGGTAGATGG - Intergenic
929542353 2:42832094-42832116 CGGCAAACAGCAGTGGTGGACGG - Intergenic
931038980 2:58275750-58275772 CGGCAAACAGCAGTGGTGGACGG - Intergenic
932917171 2:75872053-75872075 CGGCAAACAGCAGTGGTGGATGG - Intergenic
932918178 2:75879091-75879113 CGGCAAACAGCAGTGGTAGACGG - Intergenic
933953559 2:87349976-87349998 TGTTAAACAACAGTGGTGACAGG + Intergenic
934237764 2:90246224-90246246 TGTTAAACAACAGTGGTGACAGG + Intergenic
934275437 2:91570507-91570529 TGTTAAACAACAGTGGTGACAGG - Intergenic
934460193 2:94209556-94209578 TGTTAAACAACAGTGGTGACAGG + Intergenic
935748347 2:106209327-106209349 CAGCAAACAGCAGTGGTGGATGG - Intergenic
936868889 2:117109655-117109677 CGGCAAACAGCAGTGTTGGATGG - Intergenic
937594968 2:123661568-123661590 CGGCAAACAGCTGTGGTGGACGG - Intergenic
939134088 2:138273520-138273542 CGGCAAACAGCAGTGGTGGACGG + Intergenic
939494109 2:142907501-142907523 TGGCAAATAGCAGTTGTGGATGG + Intronic
939627200 2:144492386-144492408 TGACAAAGAAGAGTGGAGGAAGG + Intronic
940305428 2:152220934-152220956 TGGAACACAACGGTGGAGGAAGG - Intergenic
940669037 2:156645140-156645162 TGGCAAACAGCAGTGGTGGATGG - Intergenic
941395565 2:164968911-164968933 TGGCGATCAGCAGTGGTGGACGG + Intergenic
942580696 2:177413017-177413039 CGGCAAACAACAGTGGTGGATGG + Intronic
942679484 2:178462535-178462557 TGGCAAACAGCAGTGGTGGACGG - Intergenic
942830304 2:180232054-180232076 TGGCGAATGGCAGTGGTGGATGG - Intergenic
942831223 2:180238913-180238935 TGTTGAACAGCAGTGGTGGACGG - Intergenic
943019252 2:182552900-182552922 CGGCAAACAGCTGTGGTGGATGG - Intergenic
945064768 2:205939542-205939564 TGGCAAATAGCAGTGGTGGACGG - Intergenic
945834118 2:214818945-214818967 TAGCACACACCACTGGTGGATGG - Intergenic
946484449 2:220087799-220087821 GGACAAACTAGAGTGGTGGAGGG + Intergenic
946564110 2:220944161-220944183 TGGCAAACCAGAGAGGTAGAAGG - Intergenic
947063291 2:226191102-226191124 TGGCCAAAAACAATGGTGAAAGG + Intergenic
947394884 2:229676588-229676610 TGGCAGAAAACAGGGATGGATGG - Intronic
1171500797 20:25591493-25591515 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1172947191 20:38698744-38698766 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1173748968 20:45461268-45461290 TGGCAAACATCAGTGTTTGAGGG + Intergenic
1174857642 20:54061877-54061899 TGGCAAAGAACAGCGGTGGCTGG + Intronic
1176591314 21:8652595-8652617 TGTTAAACAACAGTGGTGACGGG + Intergenic
1176614497 21:9016731-9016753 TGGCAGGCACCAGTGCTGGAGGG + Intergenic
1176962123 21:15170892-15170914 TGGCAAAGAACAGTGTTTAAAGG + Intergenic
1177263980 21:18760153-18760175 CAGCAAACAGCAGTGGTGGACGG + Intergenic
1177359363 21:20048656-20048678 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1177763507 21:25430246-25430268 AGGCAACCCACAGTGATGGAGGG - Intergenic
1177797093 21:25790276-25790298 TGGCATACAGCAGCGGGGGAAGG + Intergenic
1177895730 21:26854808-26854830 CGGCAAACAGCAGTGGTGGAAGG - Intergenic
1177896702 21:26861644-26861666 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1178535985 21:33410963-33410985 TGGGAAACACCAGGGCTGGAAGG - Intronic
1179259613 21:39746277-39746299 TGGCAAACAGCAGTGGTGGACGG + Exonic
1180274163 22:10629706-10629728 TGTTAAACAACAGTGGTGACAGG + Intergenic
1181356065 22:22297196-22297218 TGTTAAACAACAGTGGTGACAGG - Intergenic
1181939591 22:26464828-26464850 TGGCAAACAAGAGAGATGTAAGG + Intronic
1182221360 22:28761554-28761576 GGCAAAACAGCAGTGGTGGATGG - Intergenic
1184847805 22:47099910-47099932 TGTCAAACACCAGGGCTGGAAGG - Intronic
949811676 3:8012972-8012994 CAGCAAACAGCAGTGGTGGATGG + Intergenic
950273720 3:11640662-11640684 TTGCAGACAACTATGGTGGAGGG + Intronic
950529317 3:13544040-13544062 TGGCAAACACCAGTGTTCAAAGG + Intergenic
950708731 3:14800356-14800378 GGGCAAACAAGAGTGGTAGGAGG + Intergenic
951016256 3:17735811-17735833 CAGCAAACAGCAGTGGTGGATGG + Intronic
951201178 3:19876492-19876514 TGGCAAACAGCAGTGGTAGACGG + Intergenic
951326078 3:21303135-21303157 CGGAAAACAGCAGTGGTGGATGG + Intergenic
952653742 3:35758631-35758653 TGGCAAACAGCAGGGCTGAAGGG - Intronic
952921717 3:38289782-38289804 CGACAAACAGCAGTGGTGGACGG + Intronic
952922699 3:38296929-38296951 CGACAAACAGCAGTGGTGGACGG + Intronic
953515821 3:43591187-43591209 CGGCGAACAGCAGTGGTGGATGG - Intronic
955381279 3:58440224-58440246 TGGCAAACAGCAGTGGTGGACGG + Intergenic
956188719 3:66587327-66587349 TGGAAAATAACAGTGTTGGTGGG + Intergenic
956593845 3:70945411-70945433 TGACCAACAACAGTGGGGAAGGG - Intergenic
956884241 3:73542924-73542946 TGGCAAACTCCAGTTATGGAAGG - Intronic
957000509 3:74877945-74877967 CAGCAAACAGCAGTGGTGGATGG + Intergenic
957296912 3:78344277-78344299 CGGCAAACCCCAGTGGTGGATGG + Intergenic
957557721 3:81782297-81782319 CAGCAAACAACAATGGTGGATGG - Intergenic
957687039 3:83515284-83515306 CAGCAAACAGCAGTGGTGGACGG - Intergenic
958043330 3:88252213-88252235 TTGCAAATATCAGTGTTGGAGGG - Intergenic
958424501 3:93965270-93965292 CGGCAAACAGCAGTTGTGGACGG - Intronic
958486429 3:94716765-94716787 TGTCAAACAACTGAGGAGGAAGG + Intergenic
959122703 3:102252064-102252086 TGTCAAACAACTTTGTTGGATGG - Intronic
959135065 3:102408170-102408192 AGGAAAACAACATTGGTGTAAGG - Intronic
959161776 3:102732820-102732842 CGGCAAACAACAGTGGTGGATGG + Intergenic
960001888 3:112740816-112740838 TTGCAAACAACAGAGGAGGTGGG + Intergenic
960006990 3:112790777-112790799 CGGCAAACAGCAGTGGTGGATGG + Intronic
961351664 3:126308179-126308201 TGGCAACCCACACTGCTGGAGGG + Intergenic
962595424 3:136937932-136937954 TGTTAAATAAAAGTGGTGGAAGG + Intronic
963024086 3:140901144-140901166 TGGCAAACAGCAGTGGTGGATGG - Intergenic
963492266 3:146016733-146016755 CGCAAAACAGCAGTGGTGGAGGG - Intergenic
963575885 3:147060149-147060171 CGGCAAACAGCAGTGTTGGACGG - Intergenic
965186109 3:165466490-165466512 TGAGAAACAACTGTTGTGGAAGG + Intergenic
965342138 3:167503710-167503732 TGGCCAGCAGCAGTGGTGGAGGG + Intronic
965811000 3:172591896-172591918 TGACAAGCAGCAGGGGTGGATGG + Intergenic
966353265 3:179054718-179054740 CGGCAAGCAGCAGTGTTGGATGG - Intronic
966994303 3:185265012-185265034 CGGCACTCAGCAGTGGTGGATGG - Intronic
967488307 3:190059401-190059423 TGTCATACAACACTGGAGGATGG + Intronic
968390877 4:192146-192168 TGGTGATCAGCAGTGGTGGATGG + Intergenic
969162615 4:5274794-5274816 CGGCAAACAGCAGTGGTGGACGG - Intronic
969834751 4:9831534-9831556 TTACAGACAACAGTGGTGTAGGG - Intronic
970738116 4:19198142-19198164 CCGCAAACAGCAGTGGTGCACGG + Intergenic
971980348 4:33742943-33742965 GGCAAAACATCAGTGGTGGACGG - Intergenic
972766775 4:42158571-42158593 CGGCAAACAGCAGTGGTGGACGG + Intergenic
972853836 4:43082217-43082239 GGGCAAACAGCAGTGGTGGACGG - Intergenic
974190486 4:58496555-58496577 TGGCGATCAGCAGTGGTGGACGG + Intergenic
974487853 4:62526898-62526920 CAGCAAACAGCAGTGGTGGACGG + Intergenic
975313230 4:72926028-72926050 CGGCAAACAGCAGTGGTGGACGG + Intergenic
975418825 4:74138679-74138701 CAGCAAACAGCAGTGGTGGATGG + Intronic
975639995 4:76490853-76490875 TGGGAAAGAACTGTGTTGGAGGG + Intronic
975844566 4:78511403-78511425 TGCCACACACCAGTGGTGGCTGG + Intronic
975886560 4:78973262-78973284 TGGCTAACAATAGAGGAGGAAGG - Intergenic
976190167 4:82479711-82479733 CAGCAATCAGCAGTGGTGGATGG - Intergenic
976515229 4:85956792-85956814 CAGCAAAAAGCAGTGGTGGATGG + Intronic
977251317 4:94692625-94692647 CGGCAAACAGCAGTGGTGGACGG - Intergenic
977342088 4:95771734-95771756 TGACAATCAGCAGTGGTGGATGG - Intergenic
977556174 4:98489576-98489598 CGGCAATCAGCAGTGGTGGACGG - Intronic
977618439 4:99109817-99109839 TGGCAGCAAACAGTGGTGGACGG + Intergenic
978046040 4:104128924-104128946 AGGCAAACAACTGTGGAGGATGG + Intergenic
978587031 4:110284303-110284325 TGGCAAACAGCAGTGGTGGACGG + Intergenic
978909017 4:114044497-114044519 TAGCCAGCAGCAGTGGTGGACGG - Intergenic
979673548 4:123386056-123386078 TGGCAGACAACATTGGTGGTGGG - Intergenic
979910827 4:126363671-126363693 TGGCAAACAGCAGTGGTGGATGG - Intergenic
980190519 4:129519325-129519347 CAGCAAACAGCAGTGGTGGACGG - Intergenic
980386303 4:132090774-132090796 CAGCAAACAGCAGTGATGGATGG + Intergenic
980523646 4:133961712-133961734 CAGCAAACAGCAGTGGTGGACGG - Intergenic
980625711 4:135372297-135372319 CGGCAAACAGCAGTGGTGGATGG - Intergenic
980790429 4:137613267-137613289 CGTCAAGCAGCAGTGGTGGATGG - Intergenic
980871972 4:138622139-138622161 TGGCAAACAGCAGTGGTGCATGG + Intergenic
981334485 4:143554974-143554996 TGGCCAAACACAGTGGTGGCAGG - Exonic
981823740 4:148915589-148915611 TGGAGATCAGCAGTGGTGGATGG - Intergenic
982978783 4:162104067-162104089 TGGCAAACAGCAGTGGTGGACGG - Intronic
983660519 4:170126752-170126774 AGGAAAACATGAGTGGTGGAAGG - Intergenic
983666276 4:170188271-170188293 TGGCAGACAACAGTGGGGGCTGG + Intergenic
983667444 4:170196968-170196990 CGGCAAACAGCAGTGGTGGATGG + Intergenic
986022571 5:3818728-3818750 TGGCAAAGGACAGTGGTGAGTGG + Intergenic
986492622 5:8307849-8307871 TGGTGAACAGCAGTGGTGGATGG + Intergenic
986887348 5:12256134-12256156 TGGAAAAAAGCAGTGGAGGAAGG - Intergenic
987508221 5:18800422-18800444 GGCAAAACAGCAGTGGTGGAGGG - Intergenic
987855123 5:23411299-23411321 CGGCGATCAGCAGTGGTGGACGG - Intergenic
987905347 5:24069366-24069388 TGGCAAACAGCAGTGGTGGACGG - Intronic
988209998 5:28191386-28191408 TGGCACACAACTGTGGAGGTTGG - Intergenic
988740545 5:34064672-34064694 CGGCAAACAGCAGTGGTGGATGG + Intronic
988957400 5:36332981-36333003 CGGCAAACAGCAGTGGTGGATGG + Intergenic
989233459 5:39115461-39115483 TGGAAAACAGCAGTGGATGAGGG + Intronic
989688426 5:44114670-44114692 TGGCAAACAGCAGTGGTGGATGG - Intergenic
989717696 5:44483491-44483513 CAGCAAATAGCAGTGGTGGACGG - Intergenic
989980138 5:50633671-50633693 TTGCAAGCAAATGTGGTGGAGGG - Intergenic
990729014 5:58787889-58787911 TAGCCAACAACAGTGGAGGGAGG - Intronic
990891806 5:60658870-60658892 TGGTAAACAGCAGTGGTGGATGG - Intronic
990892804 5:60666076-60666098 TGGCAAACAACAGTGGTGGACGG - Intronic
992293493 5:75304574-75304596 CGGCAAACAGCAGTGGTGGATGG - Intergenic
993225633 5:85165289-85165311 TGGCAAACAGCAGTGGTGGACGG - Intergenic
993590947 5:89794630-89794652 CGGCCAACAGCAGTGGTGGATGG - Intergenic
993941859 5:94068393-94068415 TGGCAAACAGCAGTGGTGGATGG + Intronic
995125595 5:108574491-108574513 AGCGAAACAGCAGTGGTGGATGG + Intergenic
995465163 5:112444070-112444092 TGGCAAACAGCAGTGGTGGACGG - Intergenic
996128268 5:119751524-119751546 TGGCAAACAGCAGTGGCAGATGG - Intergenic
997905223 5:137809603-137809625 AGGCAAACAGCAGTGATGGCTGG + Intergenic
1000609485 5:163358841-163358863 TGTCAAGCAAAAGTGGGGGAGGG - Intergenic
1001798860 5:174526170-174526192 TTGCAATCAACACTAGTGGAAGG - Intergenic
1002047746 5:176551404-176551426 AGGGAAACAACAGTAGTGGCCGG + Intronic
1003360999 6:5425137-5425159 TGCCAAACACCAGTGGTTAATGG + Intronic
1004236359 6:13878455-13878477 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1004925964 6:20415412-20415434 GGGCAGTTAACAGTGGTGGAGGG + Intronic
1005324148 6:24682705-24682727 CGGCAAACAGCAGTGGTGGATGG + Intronic
1005816651 6:29558585-29558607 TGGCAAACGGCAGTGGTGGATGG - Intronic
1007011949 6:38426521-38426543 GGCAAAACAGCAGTGGTGGATGG - Intronic
1008582777 6:52921518-52921540 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1009544321 6:65005109-65005131 TGGCAAACAGCAGTGGTGGACGG - Intronic
1009702457 6:67201713-67201735 CGGCAAACAGCAGTGTTGGATGG - Intergenic
1009765687 6:68072057-68072079 TGCAAAACACCAGTAGTGGAGGG + Intergenic
1010130619 6:72489159-72489181 TGACACAAAACAGGGGTGGAGGG - Intergenic
1010989943 6:82469487-82469509 TGTTAAATAAAAGTGGTGGAGGG + Intergenic
1011183738 6:84651237-84651259 TGGCTAACAACAGTGGAAGCTGG - Intergenic
1011190324 6:84720755-84720777 CAGCGAACAGCAGTGGTGGATGG + Intronic
1011540395 6:88421360-88421382 CGGCAAACAACAGTGGTGGACGG + Intergenic
1012082328 6:94776098-94776120 TGAAAAACAACAGTGTTGAAAGG - Intergenic
1012734542 6:102921703-102921725 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1013021753 6:106228254-106228276 CGGCAAACAGCAGTGGTGGATGG - Intronic
1013410504 6:109879599-109879621 TGGTGATCAGCAGTGGTGGACGG - Intergenic
1014107103 6:117578435-117578457 TGGCAGAGCACAGTGATGGAAGG + Intronic
1014208910 6:118687752-118687774 CGGCAAACAGCAGTGGTGGACGG - Intronic
1015632764 6:135247944-135247966 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1015634605 6:135263315-135263337 TGGTATACAAATGTGGTGGAAGG + Intergenic
1016108533 6:140192007-140192029 TGGCTAATAGCAGTTGTGGAGGG + Intergenic
1016444928 6:144121424-144121446 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1018166884 6:161106193-161106215 TGGCAAACAAGAGTGTGGAATGG + Intronic
1019872125 7:3774283-3774305 AGGCCTACAACAGTGGGGGAAGG + Intronic
1020075490 7:5255312-5255334 TTAGAAAAAACAGTGGTGGAGGG + Intergenic
1020906203 7:14067210-14067232 CGGCAAACAGCAGTGGTGGGCGG - Intergenic
1021144253 7:17065920-17065942 CAGCGAACAGCAGTGGTGGACGG - Intergenic
1021885344 7:25131953-25131975 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1022117652 7:27276465-27276487 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1022989913 7:35696639-35696661 CGGCAGACAGCAGTGGTGGACGG - Intergenic
1023209167 7:37784565-37784587 TGGCACACAAAAGTCTTGGATGG - Intronic
1023282935 7:38590385-38590407 CGGCATTCAGCAGTGGTGGATGG + Intronic
1024148021 7:46536784-46536806 CAGCAAACAGCAGTGGTGGATGG + Intergenic
1025203586 7:56978250-56978272 TTAGAAAAAACAGTGGTGGAGGG - Intergenic
1025668356 7:63598678-63598700 TTAGAAAAAACAGTGGTGGAGGG + Intergenic
1026346967 7:69482805-69482827 CGGCAAACAGCGGTGGTGGACGG - Intergenic
1027591857 7:80128191-80128213 GGGCAAACAACACTGGGGCAGGG + Intergenic
1028013983 7:85684105-85684127 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1028587731 7:92468311-92468333 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1028589093 7:92477798-92477820 TGGCAAACAGCAGTGGTGGACGG + Intronic
1028993385 7:97074790-97074812 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1030336804 7:108337404-108337426 TGGCAAACAGCAGTGGTGGATGG - Intronic
1030431253 7:109452177-109452199 CGGCAAACTGCAGTGGTGGACGG - Intergenic
1030843985 7:114386161-114386183 TGGCAAACAGCAGTGGTGGATGG + Intronic
1031250879 7:119378956-119378978 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1031299569 7:120047464-120047486 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1032306870 7:130742192-130742214 TGGCAAACAAGAGTGGAAGCAGG + Intergenic
1032425796 7:131821204-131821226 CGGCATTCAGCAGTGGTGGAGGG + Intergenic
1032480068 7:132239150-132239172 TGGAAGAAAACAGGGGTGGATGG - Intronic
1034248764 7:149671695-149671717 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1034249490 7:149676815-149676837 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1034650848 7:152688867-152688889 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1034707081 7:153155210-153155232 CAGCAAACAGCAGTGGTGGATGG + Intergenic
1034965015 7:155385412-155385434 CGGCAAACAGCAGTGGTGGACGG + Intronic
1034985512 7:155511130-155511152 TGGGAAACGAGAGTGGGGGAGGG - Intronic
1037123421 8:15317001-15317023 CGGCAAAGAGCAGTGGTGGATGG + Intergenic
1037648693 8:20817066-20817088 TGACCAGCAGCAGTGGTGGATGG + Intergenic
1039440143 8:37589314-37589336 TTGAAAACATCAGTGCTGGAGGG - Intergenic
1039604321 8:38868084-38868106 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1041945245 8:63433610-63433632 TGCCAAACAGCAGTGTTGAAGGG + Intergenic
1042055652 8:64763075-64763097 TGGCAAACAGCAGTGGTGGACGG - Intronic
1043603544 8:81971329-81971351 TGGCAAACAGCAGTGGGGGTGGG + Intergenic
1043633072 8:82361463-82361485 TGGCAGATAATAGTGGTGGTGGG + Intergenic
1044988295 8:97774203-97774225 CGGCGAACAGCAGTGGTGGACGG + Intergenic
1045445686 8:102260894-102260916 TGGCAAACAAAAGTGTGGAAAGG - Intronic
1045657587 8:104403114-104403136 TGGCAAACAGCAGTGGTGGACGG - Intronic
1045664320 8:104468926-104468948 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1045788640 8:105955560-105955582 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1046576078 8:116030534-116030556 TGTAAAACTAGAGTGGTGGATGG + Intergenic
1047276649 8:123410761-123410783 CAGCAAACAGCAGTGGTGGACGG - Intronic
1048589276 8:135806073-135806095 TGGGAAACAACAGCAGGGGAGGG + Intergenic
1048631490 8:136247645-136247667 CAGCAAACAGCAGTGGTGAATGG - Intergenic
1049133169 8:140867608-140867630 GGACTAACAAGAGTGGTGGATGG + Intronic
1049491281 8:142904457-142904479 TGGCAAAGAACAGTGGGGGTTGG - Intronic
1050067598 9:1777001-1777023 TGGCAACCAGCAGTGGGAGATGG - Intergenic
1050113680 9:2241902-2241924 TTGCACACACCAGGGGTGGAGGG - Intergenic
1050593498 9:7183541-7183563 TAGCAAACAGCAATGGTAGACGG - Intergenic
1051546693 9:18283567-18283589 CTGCAAACCACAGTGGTTGAAGG + Intergenic
1051699196 9:19801422-19801444 CAGCAAACAGCAGTGGTGGACGG + Intergenic
1051909644 9:22138668-22138690 TGGCAAATGACAGTGGAGCAGGG + Intergenic
1051970178 9:22878077-22878099 CAGCCAACAGCAGTGGTGGACGG + Intergenic
1053134339 9:35640685-35640707 TGGCAAACAGCAGTGGTGGACGG + Intronic
1053414324 9:37937498-37937520 TGGCAAACACTCGTGCTGGAAGG + Intronic
1053690690 9:40585242-40585264 TGTTAAACAACAGTGGTGACAGG + Intergenic
1054274115 9:63052249-63052271 TGTTAAACAACAGTGGTGACAGG - Intergenic
1054301948 9:63386213-63386235 TGTTAAACAACAGTGGTGACAGG + Intergenic
1054400725 9:64712719-64712741 TGTTAAACAACAGTGGTGACAGG + Intergenic
1054434333 9:65197036-65197058 TGTTAAACAACAGTGGTGACAGG + Intergenic
1054496057 9:65824645-65824667 TGTTAAACAACAGTGGTGACAGG - Intergenic
1055789844 9:79911963-79911985 CGGTAAACAGCAGTGGTGGACGG + Intergenic
1056705015 9:88944283-88944305 CAGCAAACAGCAGTGGTGGTTGG + Intergenic
1058560648 9:106225543-106225565 TAGCAAACTACATTGGAGGATGG + Intergenic
1059751434 9:117251166-117251188 TGGAAAGCAACAGAGATGGAAGG + Intronic
1061135681 9:128731958-128731980 TGACAACCAACAGTGATGGGTGG - Intronic
1186236202 X:7513619-7513641 TTGCAAGGCACAGTGGTGGAGGG + Intergenic
1186317534 X:8386958-8386980 TGGCAAAAGAAAGGGGTGGAGGG + Intergenic
1188157329 X:26755991-26756013 CGGCAAACAGCAGTGGCGGATGG + Intergenic
1188285579 X:28322485-28322507 CGGCGAACAGCAGTGGTGGACGG - Intergenic
1188897739 X:35689852-35689874 TGGCAAAAAACATGGGTGGGGGG - Intergenic
1189152100 X:38719513-38719535 CGGCGAACAGCAGTGGTGGACGG + Intergenic
1191167488 X:57405562-57405584 CGGCAAACAGCAGTGGTGGATGG + Intronic
1192254874 X:69447982-69448004 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1192571972 X:72213538-72213560 TGGCAAACAGCAGTGGTGGACGG - Intronic
1192801799 X:74472914-74472936 TAGCAAAGCACAGTGGTGGCAGG - Intronic
1192853931 X:74987161-74987183 CAGCAAACAGCAGTGGTGGACGG + Intergenic
1192940372 X:75904933-75904955 TGACAAACAGCAGTGGTGGATGG + Intergenic
1192960997 X:76130737-76130759 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1193172388 X:78350375-78350397 CAGCAAACAGCAGTGGTGGATGG + Intergenic
1193295496 X:79827570-79827592 CTGCAAACAGCAGTGGTGGAAGG + Intergenic
1193306246 X:79956018-79956040 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1193780040 X:85690275-85690297 TGACAAACCACAGTGATGGCTGG + Intergenic
1195137239 X:101921168-101921190 TTGAAAACAACCGTGGTGGAAGG - Intronic
1195146909 X:102027125-102027147 TGGGATCCAGCAGTGGTGGATGG - Intergenic
1195259091 X:103115404-103115426 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1195584602 X:106551389-106551411 CAGCAAACAGCAGTGGTGGTCGG - Intergenic
1196287281 X:113897473-113897495 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1196772529 X:119309158-119309180 CGGCAAACACCAGTGGTGGATGG + Intergenic
1196910368 X:120478740-120478762 AGGCAAACTACAGTAGTAGAAGG - Intergenic
1196993630 X:121356620-121356642 TGGCGATCAGCAGTGGTGGACGG - Intergenic
1197406301 X:126055910-126055932 TGGAAAAGAACAGTGGGGAAAGG - Intergenic
1197999720 X:132420349-132420371 CGGCAAACAGCAGTGGTGGATGG + Intronic
1199368802 X:147020883-147020905 CGGCAAACAGCAGTGGTCGACGG - Intergenic
1199432073 X:147773164-147773186 GGCAAAACAGCAGTGGTGGATGG - Intergenic
1199536297 X:148906769-148906791 CGGCATTCAGCAGTGGTGGACGG - Intronic
1200061617 X:153486297-153486319 TGGCAACCAAGATGGGTGGATGG - Intronic
1201329227 Y:12800001-12800023 CGGCATTCAGCAGTGGTGGAAGG - Intronic
1201421473 Y:13804542-13804564 CAGCAAACAGCAGTAGTGGAGGG - Intergenic
1201724349 Y:17136736-17136758 TAGCATTCAGCAGTGGTGGATGG + Intergenic
1201905226 Y:19080314-19080336 TGGCAAAGAGCATTGCTGGATGG - Intergenic
1202584316 Y:26408347-26408369 TGTTAAACAACAGTGGTGACAGG - Intergenic