ID: 990897598

View in Genome Browser
Species Human (GRCh38)
Location 5:60715788-60715810
Sequence TTGGCTTCAGACTGCTATGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990897594_990897598 -3 Left 990897594 5:60715768-60715790 CCAAGCTCAAGCATCCCAGGTTG 0: 38
1: 117
2: 267
3: 420
4: 672
Right 990897598 5:60715788-60715810 TTGGCTTCAGACTGCTATGCTGG No data
990897589_990897598 7 Left 990897589 5:60715758-60715780 CCTCCTCCCACCAAGCTCAAGCA No data
Right 990897598 5:60715788-60715810 TTGGCTTCAGACTGCTATGCTGG No data
990897590_990897598 4 Left 990897590 5:60715761-60715783 CCTCCCACCAAGCTCAAGCATCC 0: 28
1: 149
2: 289
3: 419
4: 671
Right 990897598 5:60715788-60715810 TTGGCTTCAGACTGCTATGCTGG No data
990897591_990897598 1 Left 990897591 5:60715764-60715786 CCCACCAAGCTCAAGCATCCCAG 0: 62
1: 195
2: 354
3: 410
4: 523
Right 990897598 5:60715788-60715810 TTGGCTTCAGACTGCTATGCTGG No data
990897587_990897598 9 Left 990897587 5:60715756-60715778 CCCCTCCTCCCACCAAGCTCAAG No data
Right 990897598 5:60715788-60715810 TTGGCTTCAGACTGCTATGCTGG No data
990897586_990897598 27 Left 990897586 5:60715738-60715760 CCTCAGTAATGGTGGACACCCCT 0: 66
1: 250
2: 672
3: 1172
4: 1590
Right 990897598 5:60715788-60715810 TTGGCTTCAGACTGCTATGCTGG No data
990897588_990897598 8 Left 990897588 5:60715757-60715779 CCCTCCTCCCACCAAGCTCAAGC No data
Right 990897598 5:60715788-60715810 TTGGCTTCAGACTGCTATGCTGG No data
990897592_990897598 0 Left 990897592 5:60715765-60715787 CCACCAAGCTCAAGCATCCCAGG 0: 50
1: 173
2: 292
3: 355
4: 638
Right 990897598 5:60715788-60715810 TTGGCTTCAGACTGCTATGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990897598 Original CRISPR TTGGCTTCAGACTGCTATGC TGG Intergenic
No off target data available for this crispr