ID: 990900488

View in Genome Browser
Species Human (GRCh38)
Location 5:60743939-60743961
Sequence CAGCTCAGACAGCTTGGCGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990900479_990900488 11 Left 990900479 5:60743905-60743927 CCATGTCCTGCTTGGTCCACTGC 0: 1
1: 2
2: 17
3: 44
4: 256
Right 990900488 5:60743939-60743961 CAGCTCAGACAGCTTGGCGTTGG No data
990900477_990900488 15 Left 990900477 5:60743901-60743923 CCGCCCATGTCCTGCTTGGTCCA 0: 1
1: 0
2: 1
3: 15
4: 174
Right 990900488 5:60743939-60743961 CAGCTCAGACAGCTTGGCGTTGG No data
990900484_990900488 -5 Left 990900484 5:60743921-60743943 CCACTGCAGGGCGGCCTCCAGCT 0: 12
1: 14
2: 7
3: 33
4: 301
Right 990900488 5:60743939-60743961 CAGCTCAGACAGCTTGGCGTTGG No data
990900478_990900488 12 Left 990900478 5:60743904-60743926 CCCATGTCCTGCTTGGTCCACTG 0: 1
1: 0
2: 2
3: 11
4: 180
Right 990900488 5:60743939-60743961 CAGCTCAGACAGCTTGGCGTTGG No data
990900482_990900488 5 Left 990900482 5:60743911-60743933 CCTGCTTGGTCCACTGCAGGGCG 0: 1
1: 2
2: 9
3: 26
4: 100
Right 990900488 5:60743939-60743961 CAGCTCAGACAGCTTGGCGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990900488 Original CRISPR CAGCTCAGACAGCTTGGCGT TGG Intergenic
No off target data available for this crispr