ID: 990902763

View in Genome Browser
Species Human (GRCh38)
Location 5:60771081-60771103
Sequence ATGGGCCCACTGACCTCTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 5, 3: 19, 4: 178}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990902763_990902772 30 Left 990902763 5:60771081-60771103 CCAGGAGAGGTCAGTGGGCCCAT 0: 1
1: 0
2: 5
3: 19
4: 178
Right 990902772 5:60771134-60771156 AAGCACCAGTTATGCTATAGAGG 0: 1
1: 0
2: 0
3: 19
4: 362

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990902763 Original CRISPR ATGGGCCCACTGACCTCTCC TGG (reversed) Intronic
900287859 1:1910199-1910221 CTGGGACCACTGACCACTCCCGG + Intergenic
900532334 1:3160760-3160782 ATGGGCCCATTTACTTCTCCCGG + Intronic
901024650 1:6272772-6272794 ATGGGCCCAACAACCTTTCCAGG + Intronic
901185048 1:7367610-7367632 CTGGGCCCTCTGCACTCTCCTGG + Intronic
901629815 1:10642625-10642647 ACGGGCCCAGGGTCCTCTCCCGG + Intronic
901941578 1:12666278-12666300 ATCTGGCCATTGACCTCTCCTGG + Exonic
902329285 1:15723189-15723211 ATCTGCCCACTCACCTCTCAGGG + Intronic
902386379 1:16078253-16078275 ATGGGCCCACTTTCAGCTCCAGG + Intergenic
902709594 1:18229688-18229710 CTAGGCCCACTGATCTATCCAGG - Intronic
903331173 1:22597907-22597929 ATGGACCCAGAGGCCTCTCCAGG - Intronic
903335514 1:22621852-22621874 AGGGTCCCAGTGCCCTCTCCAGG + Intergenic
903739134 1:25548141-25548163 ATGGGAACACTGATCTATCCTGG + Intronic
903882661 1:26522142-26522164 GTGTGCACACTGAGCTCTCCTGG + Intergenic
904092640 1:27956008-27956030 TTGGCCCCATTGACCACTCCAGG - Exonic
905169163 1:36099318-36099340 CTGGGCCCCCTGGCTTCTCCCGG - Exonic
907309570 1:53531443-53531465 ATGAGCCCACAGTCCTCTCCAGG - Intronic
913293461 1:117296556-117296578 CTGAGCCCACTGAGCTCTCCAGG + Intergenic
915016123 1:152735828-152735850 ATGTGCCCACTGCCCTCTAGGGG + Intergenic
918243648 1:182640979-182641001 ATGGGGCTCCTGACCCCTCCAGG - Intergenic
920685022 1:208102695-208102717 ATGGGTCCCCTGACAACTCCAGG - Intronic
924645121 1:245870420-245870442 GTGGGCTCGCTTACCTCTCCTGG + Intronic
1065728255 10:28687399-28687421 AATGGCCCGCTGACCTCTCAGGG + Intergenic
1070888350 10:79923858-79923880 ATGGGCCCACTGAACTATAATGG - Intergenic
1072742436 10:97917555-97917577 CTGAGGCCAGTGACCTCTCCCGG - Exonic
1072781493 10:98254830-98254852 ATGGGCCCAGTGTTCTCCCCAGG + Intronic
1073327676 10:102651758-102651780 TCAGGCCCACTGACCTCCCCTGG - Intronic
1073514394 10:104064044-104064066 CTGGACCCACTGTCCACTCCAGG - Intronic
1073566458 10:104539681-104539703 CTGGTCCCATTCACCTCTCCAGG - Intergenic
1074447112 10:113529751-113529773 TTGGGACCACTGACCTGCCCGGG + Intergenic
1077458086 11:2692959-2692981 TGAGGCCCACTGAACTCTCCTGG + Intronic
1078083356 11:8219319-8219341 ATGGTCCCCATGCCCTCTCCAGG + Intergenic
1078083604 11:8220724-8220746 ATGGTCCCCATGCCCTCTCCAGG - Intergenic
1082779061 11:57271963-57271985 TTGCTCCCACTGACATCTCCAGG - Intergenic
1083570782 11:63761399-63761421 ATGAGCACACTGAGCTCTGCAGG - Exonic
1083609222 11:63997273-63997295 GTGGGCCCACTGCACTCCCCCGG - Intronic
1084483878 11:69437055-69437077 ATGAGGCCACTGACCTCTCCAGG + Intergenic
1084568872 11:69947930-69947952 ACGGGACCACTGACCTCTCCGGG - Intergenic
1085028894 11:73257911-73257933 AAGGGCTCCTTGACCTCTCCTGG + Intergenic
1088249162 11:107847886-107847908 ACTGGCCCACTTCCCTCTCCAGG - Intronic
1088965781 11:114719773-114719795 CAGGGCCCACTCACCTCTCAAGG - Intergenic
1089299935 11:117492549-117492571 AGGGGCCCCCTCACCTCTCAGGG - Intronic
1091280501 11:134379258-134379280 AATGGCCCTCAGACCTCTCCTGG + Intronic
1091563231 12:1630074-1630096 CTCGGGCCACTGTCCTCTCCTGG + Intronic
1094573059 12:31659096-31659118 AAGGGCGCCCTGACCTCACCTGG - Intronic
1097240974 12:57575084-57575106 ATGGCCCCACTGATCTCCACTGG - Exonic
1101446764 12:104742396-104742418 ATGGGTCCACTGAGCAGTCCCGG - Intronic
1104430366 12:128711094-128711116 ATGAGCCCACAGACCCATCCAGG - Intergenic
1105449754 13:20488851-20488873 CAGGGACCACTCACCTCTCCAGG + Intronic
1107566614 13:41611562-41611584 ATGGGAGCACTGACCTCTGCTGG + Exonic
1110604751 13:77418970-77418992 ATTGGCCCACAGCCCTCTGCTGG + Intergenic
1111766460 13:92536455-92536477 ATAGGCCCTCTCACCTCTCCTGG + Intronic
1113282092 13:108799680-108799702 CTGGGCCCACTGACCTCTGCAGG - Intronic
1113767004 13:112887967-112887989 AGGGGCCCTCTGTCCCCTCCCGG - Intergenic
1113842456 13:113367932-113367954 ATGGGCCCAGTGACCAGTTCTGG + Intergenic
1118702540 14:68448076-68448098 ATGGGCCAACTGGCTGCTCCAGG - Intronic
1121937066 14:98029712-98029734 ATGGCCACACTGATCTCTCAGGG - Intergenic
1122774339 14:104110604-104110626 ATGGCCTCACTGGCCCCTCCTGG - Intronic
1122823755 14:104359814-104359836 GTGGGTCCACTGTCCCCTCCGGG - Intergenic
1123062221 14:105599528-105599550 ATGGGCACACAGGCCCCTCCAGG - Intergenic
1123086965 14:105721256-105721278 ATGGGCACACAGGCCCCTCCAGG - Intergenic
1129603142 15:77011973-77011995 ATGGCCCCACAGAGATCTCCAGG + Intronic
1130533113 15:84762715-84762737 AAGGGCCCCCTGACCTTGCCAGG + Intronic
1131110219 15:89760269-89760291 CTGGGCCCTCTGACTTCTCTGGG - Intergenic
1131261410 15:90889954-90889976 AGGGGCCCACTCACCGCTCCCGG - Exonic
1131262652 15:90895763-90895785 TTGTGCCCACTGAACACTCCTGG + Exonic
1131952093 15:97692237-97692259 ATCTGTCCACTGACCTCTCAGGG - Intergenic
1132214922 15:100055429-100055451 ATGGTCCCACTGCTCGCTCCCGG + Intronic
1132229029 15:100168173-100168195 ATGGCTCCATTCACCTCTCCTGG + Intronic
1132400314 15:101501184-101501206 ATGAGTCCATTGACCTCTCTGGG + Intronic
1132826231 16:1907072-1907094 ATGGGGTCCCTGGCCTCTCCTGG + Intergenic
1132896534 16:2231996-2232018 AAGGTCCCATTCACCTCTCCAGG - Intronic
1132938149 16:2492542-2492564 ATGGGCCCACTAGCCTCTGGAGG - Intronic
1133466541 16:6032633-6032655 AAGGGCACACTGACATCTGCTGG - Intronic
1137783400 16:51116444-51116466 AGGTGACCACTGATCTCTCCTGG - Intergenic
1138148511 16:54634029-54634051 ATGGGGCCAGTGCCCTCTGCTGG - Intergenic
1138993205 16:62417426-62417448 CTGCTCCCACTGTCCTCTCCTGG - Intergenic
1141353876 16:83324913-83324935 TTGGCCCCACTCACCTCTTCAGG + Intronic
1143724588 17:8836533-8836555 CTGGGGCCACTCACCTCTCCTGG + Exonic
1143853401 17:9830280-9830302 ATGACCCCAGGGACCTCTCCGGG - Intronic
1147909134 17:43844412-43844434 ACGAGCCCAGTGACCTGTCCAGG + Intergenic
1148857448 17:50586474-50586496 ACTGGCCCACTGACCTCAGCCGG + Intronic
1152569888 17:81117022-81117044 ATGGACCTACAGGCCTCTCCAGG - Exonic
1152571508 17:81123168-81123190 AGGGCCCCACTGCCCTGTCCCGG - Intronic
1153724316 18:7939992-7940014 CTGAACACACTGACCTCTCCAGG + Intronic
1155373220 18:25126903-25126925 ATAAGCCATCTGACCTCTCCAGG + Intronic
1159857275 18:73604110-73604132 ATGGATCCACTCAGCTCTCCAGG + Intergenic
1161642454 19:5432788-5432810 ATGGCCCCCCTGAGCTCCCCAGG - Intergenic
1161940838 19:7402740-7402762 ATGGGCACACTGACATCTCCTGG - Intronic
1163695830 19:18762782-18762804 CTGGGCCAACTGGCCTCTCCAGG + Intronic
1163726621 19:18926644-18926666 ATGGGGCCTCTGACATCTCAGGG - Intronic
1163826747 19:19528407-19528429 AGCAGCCCACTTACCTCTCCAGG + Intronic
1163832250 19:19552707-19552729 ATCTCCTCACTGACCTCTCCCGG + Intergenic
1164399865 19:27895067-27895089 AGGGGGCCACCGACCTCCCCAGG - Intergenic
1168124967 19:54278015-54278037 ATGGGCCCTGTGGCCTCCCCAGG + Intronic
927056429 2:19369702-19369724 CTGGGCCAAGTGACCTCTGCTGG - Intergenic
927156192 2:20223151-20223173 ATAGGCACAGGGACCTCTCCTGG + Intronic
930736699 2:54787063-54787085 GTGTGCCCACTGAGGTCTCCAGG + Intronic
932614764 2:73224952-73224974 CTGGTCCCCCTCACCTCTCCTGG - Exonic
932760568 2:74436645-74436667 CTGGGCCCAGTGACCTCCCTAGG - Intronic
932793445 2:74675027-74675049 ATCTGCCCCCTCACCTCTCCAGG - Exonic
933729573 2:85446569-85446591 AGGGGCTGTCTGACCTCTCCCGG - Intergenic
934120965 2:88839120-88839142 ATGGGCCCTCTGACCTCAAGAGG + Intergenic
935832892 2:107019003-107019025 ATGGGGCCACTGACCTTGCAAGG + Intergenic
937203281 2:120219555-120219577 GTGGGACCACTGGCCCCTCCTGG - Intergenic
937346173 2:121126960-121126982 CTGGGCCCCCTGGCCTCTTCAGG - Intergenic
940280840 2:151988305-151988327 CTGGACCCACTGAGCTCTCTAGG + Intronic
940672979 2:156693618-156693640 AGGGGCCCAGTGAACTCTCTGGG - Intergenic
947607446 2:231497081-231497103 CTGGGACCCCTCACCTCTCCAGG + Intergenic
947633024 2:231665948-231665970 ACGAGCCCACAGACCTCTGCAGG - Intergenic
947718926 2:232355985-232356007 AGGGGCACACTGACCTCACATGG + Intergenic
947912986 2:233813752-233813774 ATGGACTCATTGTCCTCTCCTGG - Exonic
1170336361 20:15274849-15274871 AAGGGGCCTCTGACCTATCCTGG + Intronic
1170638920 20:18134510-18134532 AGGCACCCACTGTCCTCTCCAGG + Intergenic
1171041324 20:21766401-21766423 ATGGATCCAATGGCCTCTCCAGG - Intergenic
1173163867 20:40672272-40672294 CTGGGCCAGCTGAGCTCTCCTGG + Intergenic
1173864659 20:46306530-46306552 AAGGGCACACAGACATCTCCAGG + Intronic
1175618955 20:60427113-60427135 CTGGGCTCACTGCCCTCCCCTGG - Intergenic
1175789194 20:61731091-61731113 ATGGGCCCCAGGACATCTCCCGG - Intronic
1178849238 21:36199385-36199407 AGGCGCCCAGTGACGTCTCCTGG - Intronic
1180899761 22:19361708-19361730 ATGGGCCCACTGGCCTCACCTGG + Exonic
1180980082 22:19874258-19874280 ATGTCCCCACTGGCCCCTCCAGG - Intergenic
1181013839 22:20057172-20057194 ATGGGGCCACTCAGCTGTCCTGG - Intronic
1181180958 22:21067993-21068015 ATGGCCCCACTGACATCTTTCGG - Intergenic
1182093255 22:27610017-27610039 CTGGGCCCTCAGACCCCTCCTGG + Intergenic
1183544943 22:38450454-38450476 CAGGTCCCACTGACCTCACCAGG + Intronic
951896031 3:27610515-27610537 TTTGACCCACTCACCTCTCCTGG + Intergenic
953455092 3:43034635-43034657 ATTGGTCCACTCACCTCTGCAGG - Intronic
954409374 3:50363749-50363771 AAGTGCCCCCTCACCTCTCCAGG - Intronic
954431987 3:50475777-50475799 CTGCGTCCACTGACCCCTCCTGG + Intronic
954706511 3:52483605-52483627 ACGTGCCCACTGACCTGCCCTGG - Intronic
957956340 3:87193344-87193366 ATTGGACCACTGACATCTCCTGG + Intergenic
961571804 3:127804595-127804617 ATGTGACTACTGACCACTCCAGG - Intronic
967353965 3:188547081-188547103 AAGCCCCCTCTGACCTCTCCAGG - Intronic
969435939 4:7189440-7189462 ATGGCCGCACTGTCCTCTCCTGG + Intergenic
969489300 4:7490153-7490175 AAGGGCCCAGGGGCCTCTCCCGG + Intronic
969857883 4:10014632-10014654 GAGGCCCCACTGACCTCCCCAGG + Intronic
972438128 4:39054808-39054830 ATGGGCCAACTGAACACTCATGG + Intronic
973238932 4:47936434-47936456 ATGGGCCCACTTTCCGCTCCAGG + Exonic
976730406 4:88255483-88255505 AGAGGCCCACTGTCCTCTGCAGG - Intergenic
981428410 4:144631722-144631744 ATGGGGCCAAAGACCTCTCCAGG + Intergenic
986057392 5:4152224-4152246 ATGGCCTCACTCACCTGTCCAGG - Intergenic
988193029 5:27963985-27964007 TTTGGCCTACTGGCCTCTCCAGG - Intergenic
988641147 5:33041810-33041832 ATGGCACCAGTGGCCTCTCCGGG + Intergenic
990210995 5:53481207-53481229 ATGGGTCGACTGAAATCTCCAGG - Intronic
990902763 5:60771081-60771103 ATGGGCCCACTGACCTCTCCTGG - Intronic
990986065 5:61642036-61642058 CTGCACCCACTGCCCTCTCCAGG - Intronic
992598191 5:78367445-78367467 CTGTGCCCACTGACATCTCCAGG - Intronic
995250622 5:109989135-109989157 ATGGGACCACTGAACAATCCTGG - Intergenic
998410049 5:141902977-141902999 AGGGGGCAACTGACCTCCCCAGG - Intergenic
999185239 5:149702565-149702587 ATGGTCTCACTAAGCTCTCCGGG + Intergenic
999605105 5:153305894-153305916 ATGGGCACACTGCCTCCTCCAGG - Intergenic
1001893466 5:175359110-175359132 TTGGGCTCACTGTCCTCTCTGGG - Intergenic
1002052207 5:176577461-176577483 CTGAGCCCACTGCCCGCTCCGGG - Exonic
1002439703 5:179257977-179257999 CTGGGCCCAGTGATCTCTGCTGG + Intronic
1003414785 6:5898109-5898131 CTGGGCCCATAGACCCCTCCTGG - Intergenic
1003817189 6:9854704-9854726 ATGGGCCCCCAGATCTCTTCTGG - Intronic
1004241994 6:13931933-13931955 AAGGGGCCAATGACCTCTCTGGG - Intronic
1006118856 6:31791956-31791978 ATGGGGCCACTGACATCTGGGGG + Exonic
1007909350 6:45497838-45497860 ATGGGGTCACTGACCTCTTCAGG + Intronic
1008595144 6:53034827-53034849 ATGCTCCCACTGACCACTCAGGG - Intronic
1013232356 6:108169542-108169564 ACGCGCCCTCTGACCGCTCCAGG - Intronic
1016010270 6:139132376-139132398 ACGGACCCACTGCCCTCCCCGGG + Intergenic
1017950081 6:159129011-159129033 ATGAGCCCCCTGCCCTCCCCAGG + Intergenic
1018291142 6:162293538-162293560 ATGGGACAGCTGCCCTCTCCAGG - Intronic
1018655226 6:166027631-166027653 ATGCGTCCCCTTACCTCTCCAGG - Intergenic
1022015480 7:26345412-26345434 ATGGGTCCTCTGACTGCTCCAGG + Intronic
1022546956 7:31198745-31198767 ATGCTCCCACTGACCTGTCTGGG + Intergenic
1023600884 7:41880738-41880760 ATGTGCACACTGACAGCTCCTGG - Intergenic
1024096226 7:45984948-45984970 ATGGGCCCAGTAAACTCTCCTGG + Intergenic
1024282077 7:47726969-47726991 CTGTGCCCACTGGCATCTCCAGG + Intronic
1026591201 7:71697126-71697148 ATGGTCCCACTTACCTTTTCAGG - Intronic
1026833636 7:73624270-73624292 AGGGCCCCACGGACCCCTCCTGG + Exonic
1026870285 7:73846894-73846916 AGGGGCCCACTGATCTCACAAGG + Intergenic
1028748698 7:94357268-94357290 ATGGGACCAGTGAACTATCCTGG - Intergenic
1029364255 7:100107008-100107030 CTGGGCCCATTGCCCCCTCCTGG - Exonic
1029491798 7:100874805-100874827 ACGGGCCTCCTGACCTCACCGGG - Intergenic
1029655774 7:101923449-101923471 CTGGGCCGACTGACGTCACCAGG - Intronic
1032428468 7:131841163-131841185 ATGGCCCCATTGACTTATCCAGG + Intergenic
1033117577 7:138639302-138639324 TTGGACCCACTTACTTCTCCTGG - Intronic
1035707732 8:1689921-1689943 CTGGGCCCACTGATCTCTGCTGG - Intronic
1037683850 8:21120868-21120890 ATCTGCCCATTCACCTCTCCTGG - Intergenic
1037748060 8:21662288-21662310 ATGGGCACAGTGACATCTCAGGG + Intergenic
1037937613 8:22925787-22925809 CTGGCCCAGCTGACCTCTCCTGG + Intronic
1038610194 8:29053869-29053891 CTGTTCCCACTGAGCTCTCCAGG - Intronic
1040481746 8:47833152-47833174 TGGGCCACACTGACCTCTCCAGG + Intronic
1041870469 8:62628219-62628241 GTGGGCCCGCTTTCCTCTCCAGG - Intronic
1045665793 8:104483072-104483094 TTGGGCCCCCTGAACTCTGCAGG + Intergenic
1046651473 8:116840709-116840731 ATGGGCCCACTCAGGTTTCCTGG + Intronic
1049042675 8:140124404-140124426 ATGGGCCCAGTGTCATCACCAGG - Intronic
1049296695 8:141844447-141844469 CTGGGGACACTGCCCTCTCCAGG - Intergenic
1049428626 8:142549136-142549158 CTGGGCCCACCCACCTCCCCAGG + Intergenic
1050102933 9:2137263-2137285 AAGTTCCCACTGACCTCTCTGGG - Intronic
1057264328 9:93604003-93604025 GTGTGCCCATTGGCCTCTCCTGG + Intronic
1060594796 9:124841469-124841491 CTGGGCCCCCTGACCTCTGCAGG - Intergenic
1061626695 9:131844604-131844626 ATGTGGCCACTGACCCCTGCAGG - Intergenic
1062216907 9:135394174-135394196 CAGGTCCCACTGACCTCACCAGG + Intergenic
1062712648 9:137985155-137985177 AGAAGCCCACTGACCTCCCCAGG + Intronic
1189516770 X:41720335-41720357 CTGAGCCCCCTGCCCTCTCCAGG - Intronic
1190875712 X:54458850-54458872 AAGGTCCCACTGCCCTCTCCAGG + Intronic
1193780713 X:85698578-85698600 CTGGGACCTCTGACCTCTACAGG + Intergenic
1197969696 X:132102068-132102090 ATGGACTCTCTGACCTCTCAAGG - Intronic
1198244811 X:134820003-134820025 ATTGGCCCACTGAACTAACCCGG - Intronic
1200411743 Y:2868210-2868232 CTGCTCCCACTGCCCTCTCCTGG - Intronic