ID: 990902820

View in Genome Browser
Species Human (GRCh38)
Location 5:60771538-60771560
Sequence CTCTGATGTCAGACAGACCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1137
Summary {0: 1, 1: 5, 2: 37, 3: 212, 4: 882}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990902818_990902820 14 Left 990902818 5:60771501-60771523 CCATGATGATGACAACTTTTTAC 0: 1
1: 0
2: 1
3: 10
4: 170
Right 990902820 5:60771538-60771560 CTCTGATGTCAGACAGACCTGGG 0: 1
1: 5
2: 37
3: 212
4: 882
990902816_990902820 27 Left 990902816 5:60771488-60771510 CCAAAGGTGCCTACCATGATGAT 0: 1
1: 0
2: 2
3: 8
4: 97
Right 990902820 5:60771538-60771560 CTCTGATGTCAGACAGACCTGGG 0: 1
1: 5
2: 37
3: 212
4: 882
990902817_990902820 18 Left 990902817 5:60771497-60771519 CCTACCATGATGATGACAACTTT 0: 1
1: 0
2: 1
3: 16
4: 164
Right 990902820 5:60771538-60771560 CTCTGATGTCAGACAGACCTGGG 0: 1
1: 5
2: 37
3: 212
4: 882

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990902820 Original CRISPR CTCTGATGTCAGACAGACCT GGG Intronic
900272133 1:1796377-1796399 CTCTGAAATCAGAAATACCTGGG + Intronic
900589088 1:3451792-3451814 CTTTGGCGTCAGACAGACCTGGG + Intergenic
901197427 1:7447944-7447966 CTCTGAGGTCAGACCAACCTGGG - Intronic
902190075 1:14756164-14756186 CTCTGGTGTCAGAAATACCTGGG - Intronic
902202875 1:14846911-14846933 CTGTGGTGTCAGCCAGACCCGGG - Intronic
902509674 1:16959390-16959412 CTTTGGAGTCAGACAGACTTAGG - Intronic
902633673 1:17720722-17720744 CCCTGGTGTCAGACAGACTTGGG + Intergenic
902776895 1:18680597-18680619 CAGTGAGGTCAGACGGACCTGGG - Intronic
902820039 1:18938113-18938135 CTTTGACGTCAGGCAGAGCTGGG + Intronic
902839380 1:19065599-19065621 CTTTGGTGTCAGACAGTCCTGGG - Intergenic
902926514 1:19699433-19699455 CTTTGATGCAAGACAGTCCTAGG - Intronic
902983538 1:20141949-20141971 ATCTGGAGTCAGACAGACCTAGG - Intronic
903060602 1:20666129-20666151 TTTTGAAGTCAGACAGGCCTGGG - Intronic
903178953 1:21595970-21595992 CTGTGCTGTCAGGCAGACCTAGG - Intergenic
903334744 1:22617355-22617377 CTCGGAGGTCAGACAGAACTCGG - Intergenic
903414199 1:23170253-23170275 CTCTGATGCCAGAAAACCCTGGG + Intronic
903461995 1:23526718-23526740 CTTTGCAGTCAGACAGGCCTGGG - Intronic
903470072 1:23580679-23580701 CTCTGGGGCCTGACAGACCTGGG + Intergenic
903480072 1:23646620-23646642 CTCTGGACTCAGACAGACTTGGG + Intergenic
903510663 1:23872564-23872586 CTTTGAAGTCAAACAGAACTAGG + Exonic
903616315 1:24660928-24660950 CTCTGAAGGCAGACAGACTTGGG + Intronic
903671903 1:25041015-25041037 CTCTGGAGACAGACAGTCCTGGG - Intergenic
903687449 1:25142357-25142379 CTCTGCAATCAGACAGGCCTGGG - Intergenic
903711440 1:25327876-25327898 CTCTGGAGTCAGACAGATCTGGG + Intronic
903715508 1:25363553-25363575 CTCTGGAGTCAGACAGATCTGGG - Intronic
903975407 1:27146534-27146556 CTCTGAAGTCAGACAAATCTGGG + Intronic
903986539 1:27233503-27233525 CTCTGGTGTCAGGCAGATCTGGG + Intergenic
903993636 1:27290851-27290873 CAGTGAAGTCAGACAGACCTGGG + Intronic
904085856 1:27907472-27907494 CTCTGGAGTTAGACAAACCTGGG - Intronic
904116897 1:28169529-28169551 CTCTGTAGTCAGACAAACCTGGG + Intronic
904199679 1:28811933-28811955 CTTTGGTGTCAGAGGGACCTGGG - Intergenic
904286940 1:29459008-29459030 CTCTGTTCTCTGACAGACCCAGG + Intergenic
904374593 1:30072467-30072489 GTCTGAGGTCAGGCAGATCTGGG - Intergenic
904412535 1:30333080-30333102 ATCTGCGGTCACACAGACCTGGG + Intergenic
904615801 1:31748959-31748981 CTCTGGAGTCAGGCAGGCCTGGG - Intronic
904625957 1:31802454-31802476 CTTTGGAGTCAGACAGAGCTAGG - Intronic
904700912 1:32357605-32357627 CTCTGATGTCAGTCAAACCTTGG - Intronic
904703290 1:32371808-32371830 CTCTGGGGCCAGGCAGACCTGGG + Intronic
904912922 1:33948934-33948956 CTCTGGTGTCCCATAGACCTGGG + Intronic
905139015 1:35826122-35826144 CTCTGGAGTCACACAGACCTGGG + Intronic
905182145 1:36174053-36174075 CTCCTAAGTCAGACAGACTTGGG + Intronic
905234631 1:36537648-36537670 CTCTGAAGGCAGACTAACCTGGG - Intergenic
905269071 1:36774868-36774890 CTTTGGAGTCAGACAGACCTGGG + Intergenic
905307552 1:37029987-37030009 TTTTGATGTCAGAATGACCTAGG - Intronic
905392244 1:37644237-37644259 CTTTGGAGTCAGACAAACCTGGG + Intergenic
905407881 1:37748856-37748878 CTTTGAGGTCAGACAGACCTGGG + Intronic
905452809 1:38068040-38068062 CTTTGGTGTCAAACAGATCTGGG - Intergenic
905489161 1:38329965-38329987 CTCTGGAGTCAGCCAGACCTGGG + Intergenic
905514936 1:38555732-38555754 CTCTGTGGTCAGACAGGCTTGGG - Intergenic
905657952 1:39697954-39697976 CTTTCAAGTCAGACAGATCTTGG + Intronic
905887345 1:41498421-41498443 CTCTGAAGTCAGCCAGCTCTGGG + Intergenic
906247292 1:44285328-44285350 CTTTGGAGTCAGACAGAACTGGG - Intronic
906274335 1:44505179-44505201 CTCTGAAGTCAGGCAGATCTGGG - Intronic
906279651 1:44544314-44544336 CTCTGGAGTCAGACAGACCTGGG + Intronic
906609894 1:47193980-47194002 CTCTGATGTGGGAAAGAGCTTGG - Intergenic
906662766 1:47594132-47594154 CTCTGGAGTCATACAGATCTTGG + Intergenic
906681355 1:47727822-47727844 CTTTGAAGTCAAATAGACCTAGG - Intergenic
906696121 1:47824562-47824584 CTTTGAAGTCAGGCAGACATGGG - Intronic
906842447 1:49154018-49154040 CTTTGAAGTTAAACAGACCTGGG - Intronic
906855517 1:49300247-49300269 CTTTGTAGTCACACAGACCTGGG + Intronic
907159050 1:52358132-52358154 CTCTGGGTTCAGAAAGACCTTGG + Intronic
907170940 1:52463995-52464017 CTCTGGAGTCAGACAGACCTGGG + Intronic
907304771 1:53507387-53507409 CTCTGAAGCCAGATGGACCTGGG - Intronic
907340445 1:53731542-53731564 CTCTGCTGTCAGACAGACCTGGG + Intronic
907357597 1:53889377-53889399 CTCTGGGGTCAGACAGAGCTGGG + Exonic
907365714 1:53957846-53957868 CTTTGTTATCAGGCAGACCTTGG - Intronic
907366286 1:53963424-53963446 CTGTGGAGTCAGAAAGACCTGGG + Intronic
907540476 1:55212382-55212404 CTTTGAAGTCAAAGAGACCTGGG + Intronic
907545266 1:55254273-55254295 CTTTGAAGTCATATAGACCTTGG + Intergenic
907668793 1:56456581-56456603 CTTTGAAGTCAGATAGATCTAGG - Intergenic
907940216 1:59080395-59080417 CTCTGAAATCAGACAAACCTGGG - Intergenic
908115225 1:60934062-60934084 CCCTGCAGTCAGAAAGACCTGGG - Intronic
908162949 1:61429384-61429406 CCTTGCTGTCAGACAGAACTGGG - Intronic
908329417 1:63055998-63056020 CCCTGAAGTCAATCAGACCTGGG + Intergenic
908350038 1:63277604-63277626 TTTTGAAGGCAGACAGACCTGGG + Intergenic
908564676 1:65342172-65342194 CTTTGGAGTGAGACAGACCTAGG + Intronic
908666929 1:66503668-66503690 CTCTGAAGGCAGAGAGAACTGGG + Intergenic
908758640 1:67491970-67491992 CCCTGCAGTCAGACAGCCCTAGG + Intergenic
908842200 1:68291419-68291441 CTCTGAAGCCAGACAGATCCAGG + Intergenic
909146018 1:71932662-71932684 CACTGATGTCAAACATACATTGG - Intronic
909494404 1:76262302-76262324 CACTGGTGTCAGGCAGAGCTGGG - Intronic
909525544 1:76618340-76618362 CTCTAGTGTCAGACTGTCCTCGG + Intronic
909846579 1:80401270-80401292 CCCTGAAGTCAGAAAGACCTGGG + Intergenic
909872439 1:80759632-80759654 TTCTGGAGTCAGCCAGACCTGGG + Intergenic
909896130 1:81071545-81071567 CTTTGAAGAGAGACAGACCTAGG + Intergenic
910516922 1:88072393-88072415 CTCTGGAGTCAGACAGACCTGGG + Intergenic
910918568 1:92318410-92318432 CTTGGATATCAGACAGACCTGGG - Intronic
911269629 1:95785063-95785085 CTTTGAAGTCATACATACCTGGG - Intergenic
911318814 1:96387153-96387175 CTCTGACTTCTGACTGACCTTGG + Intergenic
911327471 1:96485193-96485215 CTCTGCAGTCAGACAGTCCAGGG + Intergenic
911369837 1:96983550-96983572 TTTTGGTGTCAGACATACCTGGG + Intergenic
912865117 1:113249599-113249621 CTCTGGTGTCCAGCAGACCTGGG - Intergenic
913685442 1:121227502-121227524 TGCTAATGTCAGAGAGACCTGGG + Intronic
913700799 1:121372625-121372647 CTTTGGAGTCTGACAGACCTGGG + Intronic
914037289 1:144015106-144015128 TGCTAATGTCAGAGAGACCTGGG + Intergenic
914041348 1:144053087-144053109 CTTTGGAGTCTGACAGACCTGGG + Intergenic
914136736 1:144907399-144907421 CTTTGGAGTCTGACAGACCTGGG - Intronic
914152166 1:145052826-145052848 TGCTAATGTCAGAGAGACCTGGG - Intronic
914340107 1:146753067-146753089 CTCTGGAGTCAGAGAGCCCTGGG - Intergenic
914435353 1:147654606-147654628 TGCTGTTTTCAGACAGACCTGGG - Intronic
914686811 1:149987365-149987387 CTCTGGATTCAGACAGATCTTGG + Intronic
915033516 1:152903890-152903912 CTTTGCTGTCAGACAGGCCTGGG - Intergenic
915076394 1:153311453-153311475 CTCTGGAGTCAGACAGACCTGGG - Intergenic
915224831 1:154404798-154404820 CTTTGCAGTCAGATAGACCTGGG - Intergenic
915260540 1:154673747-154673769 CTCTGATTTAAAACAGACCAAGG + Intergenic
915926175 1:160021370-160021392 TTTTGGAGTCAGACAGACCTAGG + Intergenic
915959663 1:160254855-160254877 CTTTGGTGTCAAACAGACCTGGG + Intronic
916003203 1:160636008-160636030 TTTTGAAGTCAGACAGACCTAGG - Intronic
916657004 1:166885175-166885197 CTCTGGTGTCAGTGAGATCTAGG - Intergenic
917503290 1:175605184-175605206 CTTTGGAGTCAGAAAGACCTTGG + Intronic
917644341 1:177015397-177015419 GTCTGGAGTCAGACAGACATAGG - Intronic
917655466 1:177121404-177121426 CCTTGACATCAGACAGACCTGGG + Intronic
918016883 1:180643697-180643719 ATCTGAAGTAAGGCAGACCTAGG - Intronic
918088250 1:181263672-181263694 GTCTGTAATCAGACAGACCTGGG + Intergenic
918138897 1:181703420-181703442 CTCTGAAGTTGTACAGACCTGGG - Intronic
918444106 1:184599008-184599030 CTTTGGAGTCAGACAGACCTGGG - Intronic
918521213 1:185416848-185416870 CTCTGGAGCCAGACAGACCTTGG + Intergenic
919080945 1:192865366-192865388 TTTTGATGTCAGACAGAGCTGGG + Intergenic
919126012 1:193394702-193394724 CTCTGTAGTCAGACACATCTGGG + Intergenic
919127177 1:193409057-193409079 CCCTCATTTCAGACATACCTAGG - Intergenic
919510130 1:198452337-198452359 CTTTGAAGTCAGACAAACCTGGG - Intergenic
919800988 1:201354512-201354534 CTCTGGCGTCACATAGACCTGGG + Intergenic
919861714 1:201743164-201743186 CTTTAGAGTCAGACAGACCTAGG - Intronic
919955600 1:202411808-202411830 CTTTGGAGTCAGACAGACCAGGG - Intronic
920176783 1:204107056-204107078 CTCTAGGGTCAGACAGACTTGGG - Intronic
920318531 1:205098254-205098276 CTCTGAAGTCAGACTGCCTTGGG - Intronic
920403440 1:205691865-205691887 CTCTGGAGTCAGACAGATTTGGG + Intergenic
920472760 1:206246060-206246082 TGCTAATGTCAGAGAGACCTGGG + Intronic
920488218 1:206391358-206391380 CTTTGGAGTCTGACAGACCTGGG + Intronic
920687743 1:208122330-208122352 CTCTGAGGCCAGACAGACCCTGG + Intronic
920750316 1:208668662-208668684 GTCTGGAGTCAGATAGACCTGGG - Intergenic
921937813 1:220810832-220810854 CTCTGAAGTCAGCCAGGCCTGGG + Intronic
922492472 1:226029147-226029169 CTTTGGAGTCACACAGACCTGGG - Intergenic
922515747 1:226207069-226207091 CTGTGGTATCAGGCAGACCTGGG + Intergenic
922829499 1:228544522-228544544 TTCTGATGACAGAGACACCTGGG - Intergenic
922927565 1:229363056-229363078 CTCTGCAGCCAGACAGAGCTGGG + Intergenic
923143408 1:231180775-231180797 CTCCGCATTCAGACAGACCTTGG - Intronic
923203520 1:231735555-231735577 TTTTGGAGTCAGACAGACCTTGG + Intronic
923264612 1:232302296-232302318 CCCTGAGGCCAGAGAGACCTGGG - Intergenic
923394581 1:233548744-233548766 ATCTGAAGTCAGACAAACCTAGG - Intergenic
923453182 1:234139102-234139124 CACTGAGGTCAGACAGACTGAGG + Intronic
924009588 1:239650015-239650037 CTTTGATCTCAGACAGCCCTCGG + Intronic
924234111 1:241986336-241986358 CTTTGTCATCAGACAGACCTGGG - Intergenic
924644859 1:245868268-245868290 CTTTGGAGCCAGACAGACCTGGG - Intronic
924835374 1:247641756-247641778 CTTTGAAATCAGATAGACCTGGG - Intergenic
1063052818 10:2471477-2471499 TTCTGAGGGCAGACACACCTGGG + Intergenic
1063385457 10:5613707-5613729 CTTTGATGTCACACAGAGCCCGG - Intergenic
1063610509 10:7557893-7557915 CTCTGAGCTCAGATAGCCCTCGG + Intergenic
1064155625 10:12901040-12901062 CCCTGGTGTCAGCCAGTCCTTGG - Intronic
1064225083 10:13475810-13475832 CTTTGGAGTCAGACAGGCCTTGG + Intronic
1064252571 10:13718123-13718145 CGCTGCTGTCTGGCAGACCTTGG + Intronic
1064256955 10:13750535-13750557 CTCTGATGTAAGACTGGCTTTGG + Intronic
1064910809 10:20399867-20399889 CTTTGAAGTCACACAGACCTGGG - Intergenic
1065113358 10:22461265-22461287 ATCTGAAGTCAGACAGACTTGGG - Intergenic
1065136756 10:22678662-22678684 TTCTAATGTCAGACAAATCTTGG + Intronic
1065268825 10:24005516-24005538 CTTTGAAGTCACACTGACCTGGG + Intronic
1065978449 10:30865010-30865032 CTTTGGTGCCAGACAGTCCTGGG - Intronic
1066073249 10:31843779-31843801 CTCTGGTGTTACACAGACCAAGG + Intronic
1066259659 10:33716907-33716929 CTTTCATTTCAGAGAGACCTGGG - Intergenic
1067456285 10:46421515-46421537 CTCTGGAGTCAGTCAGACCTGGG - Intergenic
1067630914 10:47963124-47963146 CTCTGGAGTCAGTCAGACCTGGG + Intergenic
1067900290 10:50233038-50233060 TTCTGAAGTCAGACACAACTGGG - Intronic
1068050048 10:51938675-51938697 CCCTGATGTCACACAATCCTTGG - Intronic
1068778178 10:60890392-60890414 CTCTGATGTCACAAAGCCCCTGG + Intronic
1068874410 10:61981036-61981058 CTTTGGAATCAGACAGACCTGGG + Intronic
1069087921 10:64163221-64163243 CTGTCATGTCAGACAGACCAAGG - Intergenic
1069513861 10:69062077-69062099 CTCTGGAGCCAGACAGCCCTGGG - Intergenic
1069614733 10:69799967-69799989 CTCTGGAGTCAGAGAAACCTGGG - Intergenic
1069772672 10:70909620-70909642 CTGTGATCTCAGAAAGACATGGG - Intergenic
1069836925 10:71315080-71315102 CCCTGGAGCCAGACAGACCTGGG - Intergenic
1069987002 10:72291301-72291323 CTCTGAAGTCAGATACACCTGGG + Intergenic
1070461304 10:76673197-76673219 CTTTGGAGTCAGGCAGACCTGGG + Intergenic
1070641662 10:78174788-78174810 CTCGGATGTCAGAAACATCTTGG - Intergenic
1070670406 10:78373668-78373690 CTTTGCTGTTAGACACACCTGGG - Intergenic
1070794688 10:79209852-79209874 CTCTGAAGACAGGCAGGCCTCGG - Intronic
1071366946 10:84909191-84909213 CTCTGGCGTCAGACAGCCCTGGG - Intergenic
1071760973 10:88606166-88606188 CTTTGGAGTCAGACAGACTTGGG - Intronic
1071951942 10:90713202-90713224 GCATGAGGTCAGACAGACCTGGG - Intergenic
1072138710 10:92571786-92571808 CTCCGATGCCAGATAGACATGGG + Intronic
1072224144 10:93352149-93352171 CTCTGCAGTCAGATACACCTGGG + Intronic
1072255481 10:93616390-93616412 CTGTGGCATCAGACAGACCTGGG + Intronic
1073146950 10:101287412-101287434 CTTTGCTGTCAGACAGACTTGGG - Intergenic
1073221614 10:101879216-101879238 CTTTGTAGTCAGACAGACCTAGG + Intronic
1073467073 10:103700515-103700537 CCATGATGACAGACAGGCCTGGG + Intronic
1074141340 10:110675709-110675731 CTTTCAAGTCAGACAGACCTGGG + Intronic
1074438245 10:113452800-113452822 CTTTGGAGTCAGACTGACCTGGG + Intergenic
1074460500 10:113632531-113632553 CTTTGGTGTCAGAGAGACCTAGG - Intronic
1074871395 10:117578727-117578749 CTCTGCTGTGATACAGAGCTGGG + Intergenic
1075829327 10:125392055-125392077 CTTTGAAGTCAGACAGACTTGGG - Intergenic
1076454472 10:130580157-130580179 CTTTGAAGTCAGACAGCCCAGGG + Intergenic
1076476675 10:130758468-130758490 CTCTTATGTCACAGAGACATAGG + Intergenic
1077725945 11:4675133-4675155 CTGGGAAGTCAGAGAGACCTGGG + Intergenic
1078471415 11:11589977-11589999 ATCTGAGGTTACACAGACCTAGG + Intronic
1078537063 11:12183733-12183755 CTTTGAGGTCAGACCAACCTGGG + Intronic
1078565537 11:12410866-12410888 CTCTGGCATCAGACAGACCTGGG + Intronic
1078667374 11:13337856-13337878 CTTTGGAGTCAGACAGAGCTGGG + Intronic
1078747617 11:14130193-14130215 TTCTGGAGTCAGGCAGACCTGGG - Intronic
1078747707 11:14131223-14131245 TTCTGGAGTCAGGCAGACCTGGG + Intronic
1078869093 11:15327472-15327494 CTTTGGAGTCAGACAGAGCTGGG + Intergenic
1078880680 11:15445915-15445937 CTCTGGATTCAGTCAGACCTGGG - Intergenic
1079004997 11:16785253-16785275 CTCTCCTATCACACAGACCTGGG + Intronic
1079011931 11:16835746-16835768 CTCTGAAATCGGATAGACCTGGG - Intronic
1079160153 11:17984751-17984773 CTTTGAAGTCAGATAGACCAAGG - Intronic
1079373358 11:19870823-19870845 CTCTGAAATCACACAGAACTGGG - Intronic
1079983520 11:27176845-27176867 TCCTGATGTTAGACAGACCTGGG + Intergenic
1080028978 11:27641139-27641161 CCTGGCTGTCAGACAGACCTGGG - Intergenic
1080035933 11:27711088-27711110 CTTTGACATTAGACAGACCTAGG + Intronic
1080404456 11:31966713-31966735 CTCTGGAGTTAAACAGACCTGGG - Intronic
1080847178 11:36036619-36036641 CTCTGGTGTCAGGCAGCCCTGGG - Intronic
1081437967 11:43048808-43048830 TTTTGGAGTCAGACAGACCTAGG - Intergenic
1081579688 11:44343692-44343714 ATCTGAAGTCAAATAGACCTGGG + Intergenic
1081663382 11:44902325-44902347 CTCTGAAGTCAGACACAACTGGG - Intronic
1081701615 11:45156034-45156056 CTCTGGAATCAGACAGACCTAGG - Intronic
1081743092 11:45454501-45454523 CTCTGAAGTCACACAGACTTAGG + Intergenic
1081910196 11:46695491-46695513 CTTTGAAGTCAGAAAGCCCTGGG - Intronic
1082047308 11:47740479-47740501 CTGTGATGGCAGAGAAACCTGGG - Intronic
1082809806 11:57472855-57472877 CTCTGGAGTCAGACAGACCTGGG - Intronic
1082898470 11:58219096-58219118 CTTTGACGTGAGACAGAACTGGG + Intergenic
1082962843 11:58935131-58935153 CTTGGATGTCAGACAGTCTTTGG - Intronic
1083015060 11:59444561-59444583 CTCTGGAGTCAGGAAGACCTTGG - Intergenic
1083226912 11:61291023-61291045 CTCTGAAGGCAAACAGGCCTGGG + Intronic
1083324976 11:61868713-61868735 CTCTGGGGTCAGACAGACCTAGG - Intergenic
1083325669 11:61871859-61871881 CACTCAAGTCAGACAGACTTGGG - Intergenic
1083336573 11:61925219-61925241 CTTTGGAGTCAGACAAACCTGGG - Intergenic
1084075827 11:66775361-66775383 CTCTAAAGTCAGGCAGACTTTGG - Intronic
1084112382 11:67022634-67022656 GTTTGAAGTCACACAGACCTGGG + Intronic
1085126907 11:74008190-74008212 TTCAGATGTCAGACAAACGTGGG - Intronic
1085191676 11:74631259-74631281 CTTTGGAGTCAGGCAGACCTGGG + Intronic
1085252615 11:75153523-75153545 CTCTGGTACCAGGCAGACCTGGG - Intronic
1085306975 11:75492086-75492108 CTCTGCTGTCAGCCTTACCTGGG + Intronic
1085407483 11:76272059-76272081 TCTTGATGTCAGACAGTCCTGGG - Intergenic
1085834810 11:79941668-79941690 CTCTGGAATCAGACAGATCTGGG + Intergenic
1086059794 11:82688940-82688962 CTTTGGTGTCAGATAGACCAGGG - Intergenic
1086329526 11:85739796-85739818 CTTTGGAGTCAGACACACCTGGG - Intronic
1086419589 11:86625494-86625516 CTCTGGAGTCAAAGAGACCTGGG + Intronic
1086495639 11:87402010-87402032 CTCTGGAGTCAGCTAGACCTGGG - Intergenic
1086954132 11:92918014-92918036 CTTTCAAGTCAGATAGACCTAGG + Intergenic
1087038119 11:93773975-93773997 CCCTGATGTGGGGCAGACCTTGG + Intronic
1087049570 11:93871816-93871838 CTTTGAAGTCAGACAGACCCAGG - Intergenic
1087057758 11:93950273-93950295 CTCTGAAGTCCCACAGACCCAGG + Intergenic
1087064072 11:94011061-94011083 CTTTGGAGTCAGAAAGACCTGGG + Intergenic
1087136789 11:94729194-94729216 CTTTGAAGTCAGACAGACCTGGG + Intronic
1087183137 11:95158964-95158986 CTGTGGAGTCAGACACACCTAGG - Intergenic
1087811589 11:102614186-102614208 CTTTGGAGTCAGACAGAACTGGG - Intronic
1088547070 11:110969959-110969981 CTCTGGAGTCAGACAGACACAGG - Intergenic
1088759593 11:112916715-112916737 CTTTGGTGTCAGATAGACATAGG + Intergenic
1088860756 11:113797023-113797045 CTATGAAGTCAGACACACCAAGG + Intergenic
1089067255 11:115671120-115671142 CTCTGGAGTCAGACAGACAGGGG + Intergenic
1089100141 11:115956209-115956231 TTCTGAAGTCAGACAGATTTGGG + Intergenic
1089120497 11:116131146-116131168 TTCTGGAGTCAGAAAGACCTGGG + Intergenic
1089175925 11:116548906-116548928 GGCTGGAGTCAGACAGACCTGGG - Intergenic
1089395499 11:118134135-118134157 CCCTGATGTTAGAGAGGCCTGGG - Exonic
1089405571 11:118194670-118194692 CTGTGGAGTTAGACAGACCTGGG - Intronic
1089480047 11:118797208-118797230 CTCTGGAGTCAGACAGATTTAGG + Intergenic
1089555176 11:119312153-119312175 CTCGGACGTCAGACACATCTGGG + Exonic
1089614601 11:119688064-119688086 CTTTGAATTCAGATAGACCTGGG + Intronic
1090249746 11:125242937-125242959 TTTTGGTGTCAGACAGACTTGGG + Intronic
1090407899 11:126488307-126488329 CTTTGCTCTCAGACAGAGCTGGG + Intronic
1090733789 11:129593744-129593766 CTTTAAAGTTAGACAGACCTGGG + Intergenic
1091390257 12:121949-121971 CTTTGGTGTCAGGGAGACCTGGG - Intronic
1091810011 12:3389291-3389313 CGCTGGTGACAGACAGATCTGGG + Intronic
1092227516 12:6757511-6757533 CTCTAATGTCTCACAGCCCTGGG - Intronic
1092277013 12:7069164-7069186 CTGTGAACTTAGACAGACCTGGG - Intronic
1092347813 12:7730665-7730687 CCTTGATGTCAAATAGACCTAGG + Intronic
1093247170 12:16754040-16754062 CTCTGGAGTCAGACAGCCCTGGG - Intergenic
1093939722 12:25039983-25040005 TTCTGAAGTCAGACAGAACTAGG - Intronic
1093959231 12:25254080-25254102 CTCTACTGTCAGACTGTCCTGGG + Intergenic
1094208860 12:27869475-27869497 CTCTCATGTCAGAAACGCCTAGG - Intergenic
1094526739 12:31236061-31236083 CCCAGTTGTCAGACAGACATGGG - Intergenic
1095738112 12:45580098-45580120 CTTTGAAATCAGACAGACGTAGG + Intergenic
1095790421 12:46161347-46161369 CTCTGGACTCAGACTGACCTTGG - Intergenic
1096473716 12:51895513-51895535 CTTTGGAGTCAGACAGACCTGGG + Intergenic
1096596119 12:52696618-52696640 CTCTGTTGGCCCACAGACCTAGG - Intronic
1097070429 12:56350495-56350517 CTTTGGGATCAGACAGACCTCGG + Intronic
1097894605 12:64811957-64811979 CTTTCAAGTGAGACAGACCTGGG + Intronic
1097969593 12:65618900-65618922 CTTTAATGTAAGACAGACTTTGG + Intergenic
1098290999 12:68956534-68956556 TTTTGGAGTCAGACAGACCTAGG - Intronic
1098414858 12:70221290-70221312 CTTTGAAGTCAGAAAGAACTGGG + Intergenic
1098443130 12:70538612-70538634 CTCTGACATCAAGCAGACCTGGG - Intronic
1098490586 12:71071950-71071972 CTCTGCTGTCAGAGAGATCTGGG - Intronic
1098509697 12:71297283-71297305 TTCTGAAGTTAGATAGACCTGGG - Intronic
1098535443 12:71589231-71589253 CTCAACTGCCAGACAGACCTGGG + Intergenic
1098986698 12:77020121-77020143 CTCTGGTGTCTGACTCACCTGGG + Intergenic
1099378924 12:81931934-81931956 CTTTGAAGTCAGGCAGACCGAGG - Intergenic
1099427020 12:82535910-82535932 CTTTGAAGTTAGACAGACCAGGG + Intergenic
1100568541 12:95823193-95823215 CTCTGAAGTCAGACAGACCTGGG + Exonic
1100865891 12:98856347-98856369 CTTTGATTTGAGGCAGACCTAGG + Intronic
1101523249 12:105504277-105504299 CTCTGAAGTCAGACACACCATGG + Intergenic
1101559168 12:105839362-105839384 TTTTGGAGTCAGACAGACCTGGG + Intergenic
1101654706 12:106709683-106709705 CTTTGGTGTCAGACAGACCTGGG - Intronic
1101789756 12:107915820-107915842 GGCTGAACTCAGACAGACCTAGG + Intergenic
1101814653 12:108136699-108136721 CTTTGAGGTCAGAGAGACGTGGG - Intronic
1101820916 12:108183790-108183812 GTCTGGAGTCAGACAGGCCTGGG + Intronic
1102161136 12:110770020-110770042 CTCTGATGGCTGACGGTCCTGGG + Intergenic
1102169646 12:110832611-110832633 CTCTGGAGTCAGGAAGACCTGGG - Intergenic
1102216980 12:111168572-111168594 CTCTGTTGTCAGGCAGAGCTAGG - Intronic
1102409759 12:112707502-112707524 CTTTGAAGTCAGACTGATCTGGG - Intronic
1102452064 12:113049346-113049368 CTCCGAGGTCAGCCAGACCTGGG + Intergenic
1102534945 12:113574648-113574670 ATCTGAAGTCAGGCAGAGCTGGG - Intergenic
1102580521 12:113883694-113883716 CTCAGAAACCAGACAGACCTGGG - Intronic
1102602575 12:114043250-114043272 GTCTGATTTTAGACAGGCCTGGG - Intergenic
1102631996 12:114288999-114289021 TTTTGAAATCAGACAGACCTGGG - Intergenic
1102642795 12:114381720-114381742 CTTTGGAGTCAGACAAACCTGGG - Intronic
1102748887 12:115274822-115274844 CCTTGATGTCACACAGCCCTAGG - Intergenic
1102880508 12:116481471-116481493 CTCTCAAGCCGGACAGACCTAGG - Intergenic
1103007968 12:117436873-117436895 CTCTGGAGTCACAAAGACCTTGG + Intronic
1103146623 12:118600658-118600680 CTCTAGGGTCAGCCAGACCTGGG - Intergenic
1103242043 12:119421779-119421801 GTTTGCTGTCAGAAAGACCTAGG - Intronic
1103402458 12:120652529-120652551 CTCTGATTTTACACAGACCAGGG - Intronic
1103437964 12:120941559-120941581 ATCTAGTGTCAGACAGAGCTTGG + Intergenic
1104640620 12:130464726-130464748 CTCAGAGGCCAGAGAGACCTGGG - Intronic
1105430458 13:20332732-20332754 CTCCAAAGTGAGACAGACCTGGG - Intergenic
1105643902 13:22295960-22295982 CTCTGGAGTCAGATAGATCTGGG - Intergenic
1106024737 13:25946153-25946175 CTCGGGATTCAGACAGACCTGGG - Intronic
1106407569 13:29487298-29487320 CTTTGGAGTCAGACAGACCTGGG + Intronic
1106511786 13:30419377-30419399 CTGTGGTGGCAGACAGGCCTGGG + Intergenic
1106911014 13:34463751-34463773 CTATGATCACAGAGAGACCTCGG - Intergenic
1107424512 13:40279620-40279642 CTCTGGAATCAGATAGACCTGGG + Intergenic
1107638632 13:42418538-42418560 CTCTGAAGTCAGACAGACCTGGG + Intergenic
1107709049 13:43134535-43134557 ATCTGCTGGCACACAGACCTTGG - Intergenic
1107709505 13:43137901-43137923 GTTAGATGTCAAACAGACCTGGG - Intergenic
1107976580 13:45694076-45694098 CTCTGATGTCAGAGGGAGCGTGG + Intergenic
1108131111 13:47301306-47301328 CTCTGACGTCTGCCAGATCTTGG + Intergenic
1108269924 13:48749372-48749394 TACTGATGTCAGACAGGCCTGGG + Intergenic
1108772930 13:53727323-53727345 CTCTGAAGTTAAGCAGACCTTGG - Intergenic
1109220285 13:59634523-59634545 GTTTGGAGTCAGACAGACCTGGG + Intergenic
1109226429 13:59701462-59701484 CTCTGACCTCAAACTGACCTAGG - Intronic
1110229284 13:73151894-73151916 CTCTGGAAACAGACAGACCTAGG - Intergenic
1110632076 13:77720728-77720750 CTCTGGTTTCAGAGAGACCCTGG - Intronic
1110795394 13:79631233-79631255 CTCCGATGCCAGGCAGACTTGGG - Intergenic
1112275410 13:98013429-98013451 CTTTGGAGTCAGACAGATCTGGG - Intronic
1112599192 13:100838610-100838632 ATCTGCTGGCAGGCAGACCTAGG + Intergenic
1114313225 14:21486546-21486568 GACTGCTGTCAGAGAGACCTGGG - Intronic
1114854001 14:26415632-26415654 CTTTGATGTCAGGAAGAACTTGG - Intergenic
1115098890 14:29674103-29674125 CTTTGTGGTCAGAAAGACCTGGG + Intronic
1115786659 14:36834350-36834372 CTTTGGAGTCAGACAGACCTGGG + Intronic
1116586236 14:46708319-46708341 CTCTGGAGTCAGATAGTCCTGGG - Intergenic
1116950773 14:50876646-50876668 CTATGGGATCAGACAGACCTGGG + Intronic
1117148926 14:52865447-52865469 CTCTGCAGTCAGAGAGACTTGGG + Intronic
1117823060 14:59671631-59671653 CTCTGAAGCCAGGCAAACCTGGG - Intronic
1118648719 14:67867389-67867411 CAGTGATGACAGAGAGACCTAGG + Intronic
1119324015 14:73747912-73747934 CTCTGCTCTCAGCCAGTCCTAGG + Intronic
1119348500 14:73945152-73945174 CTTTAGAGTCAGACAGACCTGGG + Intronic
1119378453 14:74213828-74213850 CTGTGAGGTGACACAGACCTGGG - Intergenic
1119584985 14:75824974-75824996 CTTTAGAGTCAGACAGACCTAGG + Intronic
1119605132 14:76009204-76009226 CTCAGGTATCAGACACACCTGGG + Intronic
1119686664 14:76638060-76638082 CTCTGCAATCAGACAGATCTGGG + Intergenic
1119879757 14:78090932-78090954 CTCTGGTGTCAGACAGAAGTGGG + Intergenic
1119973143 14:78994999-78995021 CTTTTATGTCAGACAAACCTGGG - Intronic
1119992797 14:79218260-79218282 CTATGAATTCAGACAGATCTGGG + Intronic
1120806696 14:88759241-88759263 CTTTGAAGTTAGACAGACATGGG + Intronic
1121248485 14:92482341-92482363 CTTTGAAGACAGACAGCCCTGGG - Intronic
1121314170 14:92951315-92951337 CTTTGGAGTCAGACAGATCTGGG + Intronic
1121419233 14:93800788-93800810 CTCTGGCGTCAAACAGAGCTGGG + Intergenic
1121613464 14:95296898-95296920 CCCTGGAGTCAGACAAACCTAGG - Intronic
1121625431 14:95382386-95382408 CTATGGATTCAGACAGACCTGGG - Intergenic
1121874789 14:97441410-97441432 CTCGGACTTCAGACAGACATGGG - Intergenic
1121992442 14:98572749-98572771 CTCTGATGGCAGGCAGATCTGGG - Intergenic
1122067607 14:99184573-99184595 CTCTGGGGTCAGACGGACCCGGG - Intronic
1122791570 14:104186040-104186062 GTCTGAAGGGAGACAGACCTGGG - Intergenic
1123776485 15:23585501-23585523 ATCTGAGCTCAGACAGACCCAGG + Intronic
1123918965 15:25057290-25057312 CCCAGACCTCAGACAGACCTTGG + Intergenic
1125009447 15:34855057-34855079 CTCTGATAACAAATAGACCTGGG + Exonic
1125325384 15:38531263-38531285 CTCTGGAATCAGACAGACCTTGG - Intronic
1125446753 15:39766592-39766614 CTCTGCAGTCAGACAGATTTGGG - Intronic
1125590199 15:40849683-40849705 CTGTGGAGTCTGACAGACCTTGG + Intronic
1126468317 15:48981025-48981047 CTCTGCAGTCAGGCAGATCTAGG - Intergenic
1126694411 15:51313980-51314002 CTTTGCTGTCAGACAGACTTAGG + Intronic
1127029264 15:54843901-54843923 CTCTGAAGTCAAGCAGACCTGGG - Intergenic
1127551593 15:60044052-60044074 CTTTGAGGTCAGAAAGTCCTAGG - Intronic
1127616258 15:60689046-60689068 CTCTGGAGTCAGAAAGACCCAGG + Intronic
1127661754 15:61106029-61106051 CACTGGTGTCAGGCAGACCCTGG + Intronic
1128366321 15:67006060-67006082 GTTTGATGTCAGACAAACTTGGG + Intergenic
1128670214 15:69569040-69569062 CTCTGAACGCAGACAGAACTGGG - Intergenic
1128981382 15:72189834-72189856 CTAAGCTTTCAGACAGACCTGGG - Intronic
1129078962 15:73022944-73022966 CTTTGGGGTCACACAGACCTGGG + Intergenic
1129407537 15:75329106-75329128 GTCTGATGTAAGACAGGCCTTGG - Intergenic
1129602991 15:77011106-77011128 CTTTCAAGCCAGACAGACCTTGG + Intronic
1129618963 15:77125674-77125696 CTTTTAAGTCAGACAGACCTGGG - Intronic
1129868411 15:78925861-78925883 CTCAGAAGTCACACAGCCCTCGG - Intronic
1129878977 15:78994829-78994851 CTCTGGAGTCAGCCAGACCTGGG + Intronic
1130107327 15:80938678-80938700 CTTTGAAGACAGACAGATCTAGG - Intronic
1130170940 15:81512842-81512864 TTCTGATGTCAAACAGACATTGG + Intergenic
1130519797 15:84653791-84653813 CTCTGGAGTCAGGCAGACGTGGG + Intronic
1130575569 15:85090162-85090184 CTTTGGTGTCAGACGGGCCTGGG + Intronic
1130609494 15:85347988-85348010 CTTTGATGTTAGACAGCCCTGGG - Intergenic
1130890821 15:88132523-88132545 GTCTGAAATCAGACAGACTTAGG - Intronic
1131177702 15:90220281-90220303 CTTTGGGGTCAGACACACCTGGG + Intronic
1131223565 15:90605632-90605654 CGCTGAGATCAGAGAGACCTGGG - Intronic
1131255792 15:90861048-90861070 CCCTGGGGTCAGACAGACATGGG + Intergenic
1131397615 15:92098963-92098985 CTTTGAGGTCAGACAGGCCTGGG - Intronic
1131594257 15:93781046-93781068 CTCCGAGGTCAGTCAGACCAGGG - Intergenic
1131848425 15:96512632-96512654 CTTTGAAAGCAGACAGACCTGGG - Intergenic
1132115950 15:99136780-99136802 TGCTGATGTCCGACAGGCCTGGG + Exonic
1132411580 15:101582340-101582362 CTCTGACTTGAGACAGAACTGGG + Intergenic
1133091927 16:3411443-3411465 CTCTGAACTCAGGCAGACATGGG - Intronic
1133652951 16:7830058-7830080 CTCTGCAGTCAGACAAACCCTGG + Intergenic
1133738030 16:8630446-8630468 CTGTGGCGTCAGACAGACCTAGG - Intronic
1134052779 16:11148611-11148633 CTTTGGTGGCAGACAGACATGGG - Intronic
1134293557 16:12923909-12923931 CTGTGGAGTCGGACAGACCTGGG - Intronic
1134426622 16:14154839-14154861 CTGTCATGTCAGAGAGACCCAGG - Intronic
1134467562 16:14492810-14492832 CTCTGAGGCCACACAGGCCTGGG + Intronic
1135172387 16:20197259-20197281 CGCTGGAGGCAGACAGACCTGGG + Intergenic
1135550664 16:23395833-23395855 TTTTGAGGTCAGACAGACTTGGG + Intronic
1135659958 16:24287562-24287584 CTCTGGAGTCAGAATGACCTGGG + Intronic
1135686905 16:24505114-24505136 CTCTGAGGCCAGACAGGCTTGGG - Intergenic
1135868768 16:26129385-26129407 CTATGGTGTCAGACAGACTTGGG + Intronic
1135966155 16:27036913-27036935 CACTGAAGTCAGACAGATCTGGG + Intergenic
1135967291 16:27046694-27046716 CTCTGGAGTCAGACTGACCTGGG - Intergenic
1136090922 16:27919433-27919455 CTCTGAGGTGAGACCGAGCTTGG - Intronic
1136295078 16:29296985-29297007 CTCTGGAATCAGACAGGCCTGGG + Intergenic
1136687772 16:32005226-32005248 CTCTGGAGTCAGACAGTCCTGGG + Intergenic
1136788375 16:32948777-32948799 CTCTGGAGTCAGACAGTCCTGGG + Intergenic
1136881440 16:33905154-33905176 CTCTGGAGTCAGACAGTCCTGGG - Intergenic
1137289225 16:47040394-47040416 CTCTGGAGGCAGAGAGACCTGGG - Intergenic
1137347088 16:47673939-47673961 CACTGGAGTCAGGCAGACCTGGG - Intronic
1137441627 16:48503297-48503319 ATTTGATGTCAGACTGACTTGGG + Intergenic
1137687606 16:50397412-50397434 CTCTGATGTCAGTTGGATCTGGG + Intergenic
1137693093 16:50442732-50442754 TTTTGGTGTCAGACATACCTAGG + Intergenic
1137910040 16:52368506-52368528 CTTTGAGATCAGACAGACATGGG + Intergenic
1137931835 16:52595904-52595926 CTCTGGAGTTGGACAGACCTGGG + Intergenic
1138208703 16:55144638-55144660 CTCTTGAATCAGACAGACCTGGG - Intergenic
1138223765 16:55275304-55275326 TTCTGAAGTCAGACAGGCCTGGG - Intergenic
1138341861 16:56295258-56295280 CTCTGGGGTCAGACAGTCCTGGG + Intronic
1138562290 16:57808740-57808762 TTCTGAGGCCAGGCAGACCTGGG + Intronic
1138605693 16:58086746-58086768 CCCTGAAGTGAGGCAGACCTGGG + Intergenic
1138717448 16:59040174-59040196 CTCTGGAATCAGATAGACCTAGG - Intergenic
1139199289 16:64956133-64956155 CTTTGGGGTCAAACAGACCTGGG + Intronic
1139342273 16:66275408-66275430 CTTTGCTGTTAGGCAGACCTGGG + Intergenic
1139767892 16:69247604-69247626 CTCTGCAGTCAGACAGACCTTGG + Intronic
1139994181 16:70964341-70964363 CTCTGGAGTCAGAGAGCCCTGGG + Intronic
1140702523 16:77594531-77594553 CTATGGAATCAGACAGACCTGGG + Intergenic
1140730705 16:77853308-77853330 CTCTGATGTCAGCCTCAACTAGG + Intronic
1141230423 16:82162253-82162275 CTCTGAAGTCAGGCAGACCTGGG - Intronic
1141490494 16:84369013-84369035 CTCTGGAGTCAGAGAAACCTAGG - Intronic
1141553339 16:84820707-84820729 CTCTGGAGACAGACAGAGCTGGG - Intronic
1141986781 16:87585422-87585444 CTTGGGAGTCAGACAGACCTGGG - Intergenic
1142100979 16:88270994-88271016 CTCTGGAATCAGACAGGCCTGGG + Intergenic
1203090574 16_KI270728v1_random:1210292-1210314 CTCTGGAGTCAGACAGTCCTGGG + Intergenic
1142751821 17:1993349-1993371 CTCTGGGGCCAGTCAGACCTGGG + Intronic
1142801458 17:2348575-2348597 CTTTGGGGTCACACAGACCTGGG + Intronic
1142863841 17:2778655-2778677 CCCTGCTGTCACTCAGACCTGGG + Intronic
1143409498 17:6700242-6700264 CTTTGATGGCAGCCAGACTTTGG - Intronic
1143869148 17:9945458-9945480 CTTTGGCATCAGACAGACCTGGG - Intronic
1144087258 17:11821993-11822015 CTCTGTTGTCAACCAGACCCTGG - Exonic
1144760207 17:17702880-17702902 CTTTGAAGTCACACAGCCCTGGG - Intronic
1144787051 17:17837725-17837747 ATCTGGGGTCAGACAGCCCTGGG - Intergenic
1144808684 17:17984738-17984760 CTGTGAGGTCAGACAGGCGTGGG - Intronic
1144856549 17:18271591-18271613 ATCTGAGATCAGACAGACCCAGG - Intronic
1145305249 17:21670522-21670544 CTCTGAAGTCAGAAAGACCTGGG + Intergenic
1145757533 17:27403613-27403635 CTCTGAGGTCAGCCCGGCCTGGG - Intergenic
1145786578 17:27597694-27597716 ATGTTATGTCAGACAGACTTGGG - Intronic
1145890820 17:28414379-28414401 CTTTGGAGTCAGACAGACATGGG - Intergenic
1146012293 17:29205641-29205663 CTTTGGAGCCAGACAGACCTGGG + Intergenic
1146102822 17:30001968-30001990 CTTTGAAGTCAGGCTGACCTGGG - Intronic
1146261704 17:31426216-31426238 CTCTGGGGTCAGTAAGACCTGGG + Intronic
1146503552 17:33384964-33384986 CTCTAAAGTCAGACAGACATAGG + Intronic
1146504927 17:33396551-33396573 CTTTGAAGTCACAAAGACCTAGG - Intronic
1146619071 17:34382618-34382640 CTCTCAAGTCAGACATGCCTGGG - Intergenic
1146691636 17:34880593-34880615 CTATGAGGTCAGATAGGCCTGGG + Intergenic
1147148757 17:38500897-38500919 CTCTGCAGTCAGACAGTCCTGGG + Intronic
1147215303 17:38895859-38895881 CTCAGATGTCAGTCAGTCCTGGG + Intronic
1147632278 17:41939816-41939838 CTGTGGAGTCAGGCAGACCTAGG + Intronic
1147699294 17:42382426-42382448 CTCTGAAGTCAAACAGATCTGGG - Intronic
1148027836 17:44600636-44600658 CTTGGATGGCAGACAGACCCGGG + Intergenic
1148138810 17:45313536-45313558 CTGTCAGGTCAGAGAGACCTGGG - Intronic
1148680177 17:49469291-49469313 CTCTGAAGCAAAACAGACCTGGG + Intronic
1148739416 17:49884015-49884037 CTTTGCAGTCAGACAGTCCTGGG - Intergenic
1148772099 17:50073299-50073321 CCCTGCTGTGAGACAGCCCTGGG + Intronic
1149109160 17:53006128-53006150 CTCTCATGTCACATAGACCATGG + Intergenic
1149301527 17:55308626-55308648 CTGTGAAGTGAGTCAGACCTGGG - Intronic
1149361730 17:55902128-55902150 CTCTGGAGCCAGACAGACTTAGG + Intergenic
1149630473 17:58117774-58117796 CTCTGATGTCAGCAAACCCTGGG + Intergenic
1149732604 17:58961400-58961422 CTTTTGAGTCAGACAGACCTAGG + Intronic
1149853004 17:60052520-60052542 CTTTGTTATCAGACAGAACTAGG - Intronic
1150914684 17:69424562-69424584 TTCTGAGGTCAGACAGACCTTGG - Intronic
1151760938 17:76102922-76102944 CTCTAAAGTCAGGCAGATCTGGG - Intronic
1152215479 17:79029319-79029341 CTTTGCTGTCGGACACACCTAGG + Intronic
1153476924 18:5506989-5507011 CACTGATGTCAGACAGACATGGG + Intronic
1153914341 18:9732546-9732568 CTCTGGTGTCAGACAAGCCTGGG - Intronic
1154354539 18:13615033-13615055 CTCTGCGGTCAGCCAGCCCTGGG + Intronic
1155068117 18:22286312-22286334 CACTTAAGTCAGACAGATCTTGG + Intergenic
1156029201 18:32692735-32692757 CTCTGAAATCAGATAGACCTAGG + Intronic
1156284816 18:35681816-35681838 CTTTAAAGTCAGGCAGACCTGGG + Intronic
1156575890 18:38314570-38314592 TTCTGAGGTCAGAAAGATCTAGG - Intergenic
1156671261 18:39472896-39472918 CTTTGAAGTTAGACACACCTAGG - Intergenic
1157057337 18:44246340-44246362 CTCTGGAGTCATACAGACCTAGG + Intergenic
1157288550 18:46393826-46393848 CTCTGGAGTCTGACAGACCTGGG + Intronic
1157663300 18:49464528-49464550 CTTTGGAGTCAGACAGATCTGGG + Intergenic
1157709276 18:49838341-49838363 TTCTGGAGTCAGACAGACTTGGG - Intronic
1157729077 18:49988315-49988337 CTCTGGTGTCAGGCTGTCCTCGG - Intronic
1157799339 18:50606133-50606155 CCCTGGAGTCAGACAGACATGGG + Intronic
1158684711 18:59602866-59602888 GTGTGAGGTCAGACAGACTTGGG + Intronic
1158684864 18:59604328-59604350 GTGTGAAGTCAGACAGACTTGGG - Intronic
1159523761 18:69561263-69561285 CTCTGGAATCAGACAGACATAGG - Intronic
1160122636 18:76144589-76144611 CACTGGAGTCAGACAGAGCTCGG - Intergenic
1160792351 19:928519-928541 CTCTGTGGTCACCCAGACCTGGG + Intronic
1160989375 19:1854281-1854303 CTCTGAGGTCAGGCAGACCCAGG + Exonic
1161485646 19:4534326-4534348 CTCTGAGGTGAGAAAGACCTGGG + Intronic
1161653011 19:5496741-5496763 CTCTGGTAACAGACAGGCCTAGG - Intergenic
1162031612 19:7919976-7919998 CTCTGGGGTCAGACAGGCCTGGG - Intergenic
1162323465 19:9984764-9984786 CTTTGACATCAGACAGACTTGGG - Intronic
1162870817 19:13585400-13585422 CTCTGGATTCTGACAGACCTGGG + Intronic
1163196267 19:15723298-15723320 CTCTGCTTTCAGACACAGCTGGG + Intergenic
1163492049 19:17622931-17622953 CTTTGATGTCAGGTAGACTTGGG - Intronic
1163742218 19:19022410-19022432 TTCTGAAGCCAGACAGACCTGGG - Intronic
1164256456 19:23532605-23532627 CTCTGGTGACACACTGACCTGGG - Intronic
1164381108 19:27737774-27737796 GTCTAATGTTAGAGAGACCTGGG - Intergenic
1164730609 19:30501362-30501384 CTATGATGTCAGACAATGCTGGG - Intronic
1165335673 19:35168107-35168129 CTCTGCTCTCACACAAACCTGGG - Intronic
1165432816 19:35782101-35782123 CTCTGGAGTCAGACAGTCTTGGG + Intronic
1166014532 19:39970336-39970358 CTTTGGGGACAGACAGACCTGGG + Intergenic
1166074953 19:40408564-40408586 CTCTGCTGCCAGACAGGCCTCGG - Intronic
1166093429 19:40524964-40524986 CTCTAATGACAGACAGAACTGGG - Intronic
1166225297 19:41391415-41391437 CTCTGGAGTCAGACTGGCCTGGG + Intronic
1166962521 19:46507119-46507141 CTATGATGTCAGCCAGGCCCTGG - Intronic
1166986413 19:46662267-46662289 CTCATCTCTCAGACAGACCTTGG + Intergenic
1167477899 19:49711583-49711605 CTCTGGGGCCAGACACACCTAGG + Intronic
1167486998 19:49768330-49768352 CTCTGGGGTCAGCCAGACTTGGG + Intronic
1168272326 19:55257001-55257023 ATCTTTTGCCAGACAGACCTAGG - Intronic
925346046 2:3172711-3172733 ATCTGGAGTCAGACAGGCCTGGG - Intergenic
926432056 2:12797684-12797706 CTCTGGTTTCAGACAGACCCTGG - Intergenic
927133974 2:20083327-20083349 CTCTGGTGCCAGTCAGACTTGGG + Intergenic
927149399 2:20187093-20187115 CTTTGAAGTCAGGCAGTCCTGGG + Intergenic
927423130 2:22953741-22953763 CTCTGGAGTCAGAGAGACCATGG + Intergenic
927657110 2:24958509-24958531 CTCTGGAGTCAGACAGATCTGGG + Intronic
927854881 2:26521762-26521784 CTCTGGAGTCAGACAGATGTGGG + Intronic
927864330 2:26579070-26579092 CACAGATGTCAGACAGACCTGGG - Intronic
927944331 2:27125983-27126005 CTCTAGAGTCAGACAGACCTGGG + Intronic
928033432 2:27800346-27800368 TTTGGATTTCAGACAGACCTGGG + Intronic
928259262 2:29752035-29752057 CTTTGATGACAGACAGACTCAGG - Intronic
928283012 2:29965268-29965290 CACTGGAGTCAGACGGACCTGGG - Intergenic
928657437 2:33466886-33466908 GTTTGAAGTCAGACAGACCTGGG + Intronic
929081112 2:38123334-38123356 CTCTAAAGTCAGGCAGACCTGGG + Intergenic
929140468 2:38662393-38662415 ATCTGATAAGAGACAGACCTTGG + Intergenic
929685970 2:44035199-44035221 CTCTGGAATCAGACAGATCTGGG - Intergenic
929790071 2:45015685-45015707 CTTTGGTGTCAGACAGGCCTGGG + Intergenic
930126373 2:47800797-47800819 CTCTTATGTCAGCAAGAGCTTGG - Exonic
930369679 2:50487265-50487287 CTTTGACGTCAGAAAGACCTGGG - Intronic
930680037 2:54247797-54247819 CTCTGGAGTCAGATAGACTTGGG + Intronic
930925228 2:56810039-56810061 CTCTAAAGTCAGACAACCCTTGG - Intergenic
931508069 2:62954164-62954186 ATGTGGAGTCAGACAGACCTGGG - Intronic
931674091 2:64676425-64676447 CTGTGGAGTCAGACAGTCCTGGG + Intronic
932947651 2:76255553-76255575 TTCTGATGCCAGGTAGACCTTGG - Intergenic
934652290 2:96099524-96099546 CTCTGGAGGCAGATAGACCTGGG + Intergenic
935197157 2:100823933-100823955 TTTTGAAGTCAGACAGACCTGGG + Intronic
936396838 2:112138126-112138148 CTTTGAAGTAGGACAGACCTGGG + Intergenic
936656769 2:114497741-114497763 CTTTGTTGTTAAACAGACCTTGG - Intronic
936920006 2:117678161-117678183 CTTTGAAATCAGACAGACGTTGG + Intergenic
937082364 2:119149432-119149454 CTTTGACGTCAGATAGACCTGGG + Intergenic
937082754 2:119151994-119152016 CTCTGGGGTCACACAGACCTTGG + Intergenic
937235617 2:120430361-120430383 CTCTGGAGTCAGACAGACCAAGG - Intergenic
937632192 2:124115550-124115572 TTCTGAAGTCAGATAGACCTGGG + Intronic
937844772 2:126567241-126567263 TTCTGAAGTGAGACAGACCTAGG - Intergenic
937976154 2:127583245-127583267 CTCTCAGATCAGACAGGCCTTGG - Intronic
938085105 2:128394650-128394672 CTCTGATGGAAGAGAGCCCTGGG - Intergenic
938261112 2:129895692-129895714 CTTTGGTGCCAGACAGAGCTGGG + Intergenic
938982479 2:136539772-136539794 CTCTGGAGGCAGACAGGCCTGGG - Intergenic
938985272 2:136569388-136569410 ATCTGATGCCAGGCAGAGCTGGG + Intergenic
939372364 2:141317661-141317683 CTTAGATGTCAGACAGAACAGGG + Intronic
939478879 2:142722324-142722346 GTCTCTTGTCAGACAGACCATGG + Intergenic
939743269 2:145936722-145936744 CTCTGCAGGCAGACATACCTGGG + Intergenic
939887403 2:147696066-147696088 TTTGGAAGTCAGACAGACCTAGG - Intergenic
940438394 2:153683151-153683173 CTCTGATGTCAGAAAAACTTGGG + Intergenic
940863829 2:158797164-158797186 CTTTGGAATCAGACAGACCTGGG + Intronic
941050677 2:160729985-160730007 CTCAGATGTGAGACAGGCTTGGG - Intergenic
941700537 2:168599916-168599938 CTTTGATGTCAGAATCACCTGGG + Intronic
941834284 2:169998835-169998857 CTGTGGAGTCAGACAGACTTGGG + Intronic
942099813 2:172569006-172569028 CTATGGAGTCAGAAAGACCTGGG + Intronic
942545951 2:177063770-177063792 TTCTGAAGTCAGACATACTTTGG + Intergenic
942548216 2:177086943-177086965 CTCTGGAGTCAGAAAGATCTGGG + Intergenic
943223726 2:185142807-185142829 CTCTTATGTCAGGCAGATCCAGG + Intergenic
943361478 2:186923893-186923915 CTTTGTAATCAGACAGACCTAGG - Intergenic
943382347 2:187167103-187167125 CTTTGAAGTCAGACAGACCTTGG - Intergenic
943466261 2:188232973-188232995 TTCTGTCATCAGACAGACCTGGG - Intergenic
944096315 2:195972833-195972855 CTGTGATGAAAGACAGACATGGG + Intronic
944185381 2:196942345-196942367 CTCTAGAGTCAGACAGAACTGGG + Intergenic
944838351 2:203601704-203601726 CTCTGAAGACACACAGCCCTAGG - Intergenic
945000969 2:205350097-205350119 CTGTTATATCAGAAAGACCTGGG + Intronic
945054005 2:205852015-205852037 CTCTGATTCCAGACTCACCTAGG - Intergenic
945588489 2:211697019-211697041 CTTTGAAGTCAGACAGGCATTGG + Intronic
946010027 2:216557236-216557258 CTCTGAAGCCAGACAGTCCTGGG - Intronic
946099012 2:217302814-217302836 CTTTGGGGTCAGACAGGCCTGGG + Intronic
946106299 2:217372930-217372952 CTCTGGAGTCAGACAGCCATCGG - Intronic
947330803 2:229027516-229027538 CTCTGATGTAAGGCAGGCCGTGG + Intronic
947953012 2:234164242-234164264 CTCAGCTGTGAGCCAGACCTGGG + Intergenic
948333059 2:237185390-237185412 CTCTGATGTCAGACGGACTGGGG + Intergenic
1168884470 20:1237321-1237343 CTCTGGAGTCAGAGAGAGCTGGG + Intronic
1168970188 20:1925614-1925636 CTTTGAAGTCAGACAAACCAGGG + Intronic
1169015622 20:2290435-2290457 CTCTGCTGTCAGAAAGAACTGGG + Intergenic
1169149713 20:3279809-3279831 CTGTGGTGCCAAACAGACCTGGG - Intronic
1169874437 20:10281631-10281653 CTCTGAAATCAGGTAGACCTGGG - Intronic
1169908468 20:10626982-10627004 CTCTGATTTCAGAAAGAGCTTGG + Exonic
1170740617 20:19052871-19052893 CTTTGGAATCAGACAGACCTGGG + Intergenic
1171522765 20:25787995-25788017 CTCTGAAGTCAGAAAGACCTGGG + Intronic
1171530508 20:25849964-25849986 CTCTGAAGTCAGAAAGACCTGGG + Intronic
1171554062 20:26067888-26067910 CTCTGAAGTCAGAAAGACCTGGG - Intergenic
1171989687 20:31686275-31686297 CTCTGCAGTCAGACACACCTGGG - Intronic
1172011427 20:31848294-31848316 CTCTGCCGTCCGGCAGACCTGGG + Intronic
1172110639 20:32542839-32542861 CTCTGGTGTCAGGGTGACCTTGG + Intronic
1172171083 20:32933193-32933215 TTCTGGAGTCAGACAGACTTAGG - Intronic
1172227379 20:33314321-33314343 CTCTGCAGCCAGACAGGCCTGGG - Intergenic
1172245999 20:33445264-33445286 CACTGGTGTCAAACAGGCCTGGG - Intergenic
1172356309 20:34282686-34282708 CTTTGAAGCCAGATAGACCTGGG - Intronic
1172450426 20:35018812-35018834 CTCTGCAGTCAGACAGCCCTGGG + Intronic
1172484516 20:35290373-35290395 CTCTGGAGTCAGAAAGAACTGGG + Intronic
1172574259 20:35995161-35995183 CCCTGCTGTCAGACAGGCCAAGG - Intronic
1172593566 20:36134143-36134165 CTTTGGAGACAGACAGACCTGGG - Intronic
1172657771 20:36547530-36547552 CTTTGCTGTCAGACAGGCCTGGG - Intronic
1172739293 20:37152990-37153012 CTCTGATTCTAGACAGCCCTAGG + Intronic
1172745109 20:37200968-37200990 CTTTGGAGTCAGACAGACTTAGG + Intronic
1172821421 20:37738186-37738208 CTCTGAAGTTAGACAGATATTGG + Intronic
1173066577 20:39718844-39718866 CTCTGGAATCAGACAGACTTGGG + Intergenic
1173345959 20:42200185-42200207 CTTTGGTGTCAGACAGACTCAGG + Intronic
1173430672 20:42984759-42984781 CTTTGGTGTCAGACAAGCCTAGG - Intronic
1173564529 20:44029415-44029437 CTTTGGGGTCAGACAGACCTGGG + Intronic
1173679560 20:44868304-44868326 CTCTGAAGTCAGACAGAACTGGG - Intergenic
1173830609 20:46084271-46084293 CTTTGGTGTAAGAAAGACCTGGG - Intronic
1174243761 20:49160208-49160230 CTTTGAAGTCAGACACATCTAGG - Intronic
1174281186 20:49440735-49440757 CTTTGACATCAGACAGACCCTGG - Intronic
1174449016 20:50608666-50608688 GTCAGATGACAGCCAGACCTGGG - Exonic
1174495807 20:50941667-50941689 GATTGATTTCAGACAGACCTGGG - Intronic
1174567731 20:51478841-51478863 CCCTGAGGTCAGAAAGACCTTGG - Intronic
1174651103 20:52126352-52126374 TTCTGAAGTCAGAAAGAACTGGG - Intronic
1174867000 20:54147098-54147120 CTATGAAGTCAGACAGACTGGGG + Intergenic
1175040237 20:56042566-56042588 CTATGAGGTCAGACAGATCTGGG + Intergenic
1175057822 20:56214106-56214128 CTCTGGTCTCAGACACACCAAGG + Intergenic
1175598953 20:60257216-60257238 CTCCAGAGTCAGACAGACCTGGG - Intergenic
1176910938 21:14564525-14564547 CAGTGGTGTCAGACAGGCCTGGG - Intronic
1178557061 21:33601373-33601395 CTTTACTGTCAGACAGGCCTGGG + Intronic
1179240123 21:39582474-39582496 CTCAGAAATCAGACAGGCCTGGG + Intronic
1179542834 21:42094709-42094731 CTCTTTTGTTGGACAGACCTTGG - Intronic
1180885693 22:19241690-19241712 TTGTGATGTCAGGGAGACCTTGG - Intronic
1181725616 22:24808878-24808900 CTCTGACATCAAAAAGACCTGGG - Intronic
1181730417 22:24842267-24842289 CCCTGGAGTCAGACAAACCTGGG + Intronic
1181769548 22:25115360-25115382 CTTTGGAGTCAGACAGACTTAGG + Intronic
1181773930 22:25146269-25146291 GTCTGAGGTCAGACAGACCTGGG - Intronic
1181824521 22:25504251-25504273 CTGTACAGTCAGACAGACCTGGG - Intergenic
1181914972 22:26272824-26272846 GGCTCATATCAGACAGACCTGGG + Intronic
1181959215 22:26610866-26610888 CTTTGAGGTCAGACAAGCCTGGG - Intronic
1182031214 22:27160880-27160902 CTTTGGAGTCAGACAGACCTGGG - Intergenic
1182086367 22:27563821-27563843 CTCTGGAGTCAGACAGGTCTGGG + Intergenic
1182407620 22:30150531-30150553 CTCAGATGACTGGCAGACCTTGG + Intronic
1182447660 22:30398797-30398819 CTCTGGACTCAGACAGACCCGGG + Intronic
1182547937 22:31086284-31086306 CCCTGGAGTCAGAGAGACCTGGG + Intronic
1182763782 22:32743905-32743927 CTCTGGACTCAAACAGACCTAGG + Intronic
1182871588 22:33652279-33652301 CCCAGATATCAGAGAGACCTGGG - Intronic
1182988234 22:34741589-34741611 CTCTGCAGACAGACAGGCCTGGG - Intergenic
1183150575 22:36033999-36034021 CTCTGATGTCAAACTGACATGGG + Intergenic
1183352463 22:37341930-37341952 CCCTCTGGTCAGACAGACCTGGG + Intergenic
1183426595 22:37742983-37743005 CTCTGAGGTCAGCCAGAGCAGGG - Intronic
1183556260 22:38529676-38529698 CTTTGATGTCAAAGATACCTGGG + Intronic
1183711569 22:39507187-39507209 CTGTGATGTCAGTCCGTCCTTGG + Intronic
1183950236 22:41348650-41348672 GCCTGCAGTCAGACAGACCTGGG + Intronic
1184339390 22:43877861-43877883 CTCTGAATTCAGGCTGACCTGGG - Intergenic
1184476959 22:44727178-44727200 CCCTAAAGTCAGGCAGACCTGGG - Intronic
1184496965 22:44847748-44847770 CTCTAATCTCAGACAGACCTAGG - Intronic
1184619622 22:45666381-45666403 CTCTGGAGTCAGACAGACCTGGG - Intergenic
1184631071 22:45780470-45780492 CTCTGGAGTCAGGCAGACCTAGG + Intronic
1184867146 22:47208009-47208031 CTCTGAAATTAGGCAGACCTGGG - Intergenic
1184982622 22:48105186-48105208 CTCTGATGTCAGCGAGAGCAGGG - Intergenic
949211433 3:1507626-1507648 CTTTGAAGTCAGACAGCCCTAGG + Intergenic
949435214 3:4021769-4021791 CTCTGGAGTCAGAGAGACCTAGG + Intronic
949831445 3:8219268-8219290 CTTTGAAATCAGACAGACATTGG - Intergenic
949875871 3:8625706-8625728 CTTTGCAATCAGACAGACCTGGG + Intronic
950029460 3:9842836-9842858 CTTTGGAGTCAGACATACCTAGG - Intronic
950187127 3:10952083-10952105 CTCTGGAGTCACACAGGCCTGGG + Intergenic
950206757 3:11086870-11086892 CTTTGGTGTCAGACAGACCTGGG - Intergenic
950486143 3:13275013-13275035 CCCTGGAGGCAGACAGACCTGGG + Intergenic
950638113 3:14330366-14330388 CATTCATGTCAGACAGATCTGGG - Intergenic
950743617 3:15069165-15069187 TTTTGCAGTCAGACAGACCTAGG + Intergenic
950952041 3:17010696-17010718 CTGTGATGTCGGAGGGACCTCGG - Exonic
951290853 3:20870796-20870818 CTATTATAGCAGACAGACCTCGG - Intergenic
952499334 3:33945314-33945336 CTTTGAAGTCAGACAGACCTGGG - Intergenic
952773205 3:37020860-37020882 CTCTACTGTTGGACAGACCTGGG + Intronic
952955312 3:38553676-38553698 CTCCGAGGTCAAACAGACATGGG + Intronic
953388950 3:42523430-42523452 ATCTGGAGTCAGGCAGACCTTGG + Intronic
953459584 3:43071962-43071984 CTCTGGAGTCAAACAGACCTGGG - Intergenic
953486366 3:43300925-43300947 CTTTGGTGTCAGACAGCCGTGGG + Intronic
953622967 3:44548673-44548695 CTCTGATTTAAGGCAGATCTGGG - Intergenic
954054841 3:48013815-48013837 CTTTGATGTTAGCCAGAACTGGG - Intronic
954795436 3:53159258-53159280 CTTTGGAGCCAGACAGACCTCGG + Intronic
955082447 3:55670547-55670569 CTCTGGAGTCAGACATACCTGGG + Intronic
955083295 3:55677654-55677676 CTCTGGATTCAGATAGACCTAGG - Intronic
955134812 3:56206249-56206271 TCCTGGTGTCAGAGAGACCTGGG - Intronic
955242742 3:57193716-57193738 CTCTGGAGTCAGGCAGAACTTGG + Intergenic
955277288 3:57558378-57558400 CTTTGGAGTCAGGCAGACCTGGG - Intronic
955397539 3:58567597-58567619 CTCTGCAGTCAAACAGGCCTGGG - Intronic
955746238 3:62143020-62143042 GTCTGAAGTCAGGAAGACCTTGG - Intronic
955793845 3:62614745-62614767 CTCTGGAATCAGACACACCTGGG + Intronic
955805473 3:62729500-62729522 CTTTAATATCAGAGAGACCTTGG + Intronic
955904044 3:63788309-63788331 CTCTGGAGTCAGAAAGACTTGGG - Intergenic
956051233 3:65250766-65250788 CTCTGGGGTGAGACAGTCCTGGG - Intergenic
956551640 3:70467464-70467486 TTCAGATGTCAGAAAGACGTGGG - Intergenic
956763132 3:72461192-72461214 CTCTGGATTCAAACAGACCTAGG + Intergenic
956802207 3:72769880-72769902 CTCTGAAGTCACACAGCTCTGGG + Intronic
956963783 3:74434566-74434588 CTGTGGAGTCAGACAAACCTAGG + Intronic
957253550 3:77807136-77807158 CTGTGATGCCTGACAGACGTTGG + Intergenic
957289240 3:78256983-78257005 TTGTGTTGTCAGACACACCTAGG + Intergenic
957837347 3:85613826-85613848 CTCTGAAGTCTGACAGGCCAGGG + Intronic
958660155 3:97056726-97056748 CTCTGGAGTTAAACAGACCTGGG + Intronic
958997433 3:100920868-100920890 CTTTTGAGTCAGACAGACCTGGG - Intronic
959033920 3:101337366-101337388 CTCTCATGGCAAACAGACCCAGG + Intronic
959904084 3:111691718-111691740 CACTGAGGTCTGACAGACCTGGG + Intronic
959941268 3:112084466-112084488 TTCTGAAGGCAGACAGAACTAGG - Intergenic
960320424 3:116228370-116228392 CTCTGAAATCTGACAGACTTAGG + Intronic
960624565 3:119668623-119668645 CTTTGATGTATGACAGACTTAGG - Intronic
960738364 3:120804784-120804806 CTTTAATGTCAGATAGACCAGGG + Intergenic
960962609 3:123082900-123082922 CTCAGGAGTCAGACAGACCTGGG - Intronic
960984140 3:123261809-123261831 CTCTGAAGTCACAAAGATCTGGG - Intronic
961136474 3:124516276-124516298 CTTTGAAGTCACACAAACCTTGG + Intronic
961622784 3:128238010-128238032 TTTTGAAGTCAGACAGCCCTTGG + Intronic
961623857 3:128245547-128245569 CTCTGACTTCAGGTAGACCTAGG - Intronic
962153335 3:132916720-132916742 CTCAGATGTGACACAGACTTTGG - Intergenic
962229101 3:133645072-133645094 CTCTGGAGTTAGACAGACTTTGG - Intronic
962250514 3:133833370-133833392 CTCTGGTGACACACAGACCGTGG + Intronic
962714073 3:138112259-138112281 CTCTGGAGTCAGATAGAACTTGG - Intronic
962752802 3:138446298-138446320 CTCTGTGGTCAGACAGACCCAGG + Intronic
963087210 3:141449152-141449174 CTTTGGAGTCAGGCAGACCTAGG - Exonic
963264779 3:143229081-143229103 CTTTGGGGTCAGACAGCCCTGGG + Intergenic
964019180 3:151986482-151986504 TTCTGAAGTAAGACAGACTTAGG - Intergenic
964384158 3:156129515-156129537 CTCTGATATCAGGCTGACTTAGG + Intronic
964809378 3:160646947-160646969 CTCTGGAGTCAGACAGACCTGGG - Intergenic
964977323 3:162636681-162636703 CTGTGAAGACAGACAGATCTTGG - Intergenic
965146201 3:164907905-164907927 CTTTGTTGCAAGACAGACCTAGG + Intergenic
965707628 3:171524973-171524995 CTCTGATGCCACAGATACCTGGG + Intergenic
966209707 3:177440407-177440429 CTCTGGAGTCAGACGGACTTGGG + Intergenic
966318202 3:178672380-178672402 TTCTGAAGTCTGAAAGACCTAGG - Intronic
966689820 3:182730858-182730880 CTCTAAAGTGAGACAGAGCTGGG + Intergenic
966943783 3:184763339-184763361 CTCTGGGATCAGACAGACCTGGG - Intergenic
967162534 3:186751543-186751565 TTCTGTTGTCAGAGATACCTGGG - Intergenic
967278713 3:187801873-187801895 CTCTGGTCACAGTCAGACCTAGG + Intergenic
967408825 3:189147104-189147126 CTCTGGAGTCAAACAGACCGGGG - Intronic
967467233 3:189822008-189822030 CTTTGTGGTCAGATAGACCTGGG + Intronic
967516698 3:190378021-190378043 CTCTGGAGTCAGTCAAACCTGGG + Intronic
967569036 3:191006035-191006057 CTCTGCTGCCAGACTGAGCTGGG - Intergenic
967926354 3:194651883-194651905 CTGTGGAATCAGACAGACCTAGG - Intronic
969084909 4:4649052-4649074 CTTTGGAGTCAGACAGACCTGGG - Intergenic
969683635 4:8656911-8656933 CTCTGAGATCCCACAGACCTGGG - Intergenic
969759473 4:9171602-9171624 CTCTGCTGACAGACTTACCTTGG + Exonic
970179490 4:13375116-13375138 CATTGGTGTCAGAGAGACCTGGG + Intronic
970686289 4:18571367-18571389 CACTATTGTCAGACAGACCTTGG + Intergenic
971172901 4:24251754-24251776 CTGTGGAGTCAGACAGGCCTGGG - Intergenic
971753521 4:30679900-30679922 CCGTGATGTCAGACAGACAGAGG + Intergenic
971780623 4:31029609-31029631 CTTTGAAGTCAGACATACTTGGG + Intronic
972072414 4:35038357-35038379 CCCTGACGCCAGACAGACCCTGG - Intergenic
972174951 4:36392271-36392293 GTCAGATGTCAGACAAGCCTGGG - Intergenic
972285233 4:37642011-37642033 CCCTGGAGTCAGACAGACCAGGG - Intronic
972319505 4:37960252-37960274 GCCTGAGGTCAGACAAACCTGGG - Intronic
973239649 4:47944027-47944049 TTCTGAAGTCAGACAGACCTAGG + Intronic
973256186 4:48115993-48116015 CTTTGAGGGGAGACAGACCTGGG + Intronic
973610291 4:52629905-52629927 CTTTAATGTAATACAGACCTCGG - Intronic
973925305 4:55730905-55730927 CTCTGGAGTCAGACTGACCTAGG - Intergenic
974088442 4:57285549-57285571 CTTTGGAATCAGACAGACCTGGG + Intergenic
974517625 4:62937370-62937392 CTTTGAAATCAGACAGACCCAGG - Intergenic
974939715 4:68451851-68451873 CTTTGAAGTCAGATAGACCCTGG - Intronic
975468041 4:74732396-74732418 GTTTGGAGTCAGACAGACCTGGG - Intergenic
975576285 4:75865860-75865882 CCTTGAGGTAAGACAGACCTTGG + Intronic
976161796 4:82209438-82209460 CTTTGAAGTGAAACAGACCTAGG + Intergenic
976644989 4:87378019-87378041 CTCTGACGTCAGACAGATCTGGG - Intronic
976770847 4:88651379-88651401 CTTTGATGTCAAACAAGCCTTGG + Intronic
977131496 4:93245647-93245669 CTTTGCTGTTAGACATACCTGGG + Intronic
977852264 4:101844593-101844615 GTTTGGAGTCAGACAGACCTGGG + Intronic
978750007 4:112235695-112235717 CTCTGAATTCAGAGGGACCTGGG - Intronic
978891173 4:113829951-113829973 CTCTGAAGTAAGACACATCTAGG + Intergenic
979911591 4:126373833-126373855 CAATGATGTCAGCCAGACTTTGG - Intergenic
980093359 4:128465069-128465091 CTCTGGTGTAAAAGAGACCTGGG + Intergenic
980101918 4:128550444-128550466 CTTTGGAGTCAGACAGACCGGGG - Intergenic
980862643 4:138517931-138517953 CTCCGAAGTCAGACAGAATTGGG + Intergenic
980952472 4:139395219-139395241 CTTTTAGGTCAGACAGAACTAGG + Intronic
981606954 4:146549610-146549632 TTCTGAAGTCAGGCATACCTTGG - Intergenic
982297464 4:153844349-153844371 CTCTGAGGTAAGACATGCCTGGG + Intergenic
983280859 4:165679381-165679403 CTTTGGAGTCAGACAGACCTGGG + Intergenic
983510722 4:168606867-168606889 CTCTGATCTCAGGAAGGCCTAGG - Intronic
983568996 4:169184422-169184444 CTGTGAAGTCAGTCAGACCCGGG + Intronic
984002453 4:174266653-174266675 TTTTGAAGTCAGACAGACCTGGG + Intronic
984756804 4:183332158-183332180 CTCTGAGATTAGAAAGACCTGGG + Intergenic
984896594 4:184546990-184547012 CTTTGAAGTCAGTCAGACCTGGG + Intergenic
985121487 4:186647421-186647443 CTCTGGAATCAGACAGACTTGGG - Intronic
985474520 5:72078-72100 CTCTTATGTCAGACTCACTTGGG + Intergenic
985852173 5:2396971-2396993 CTTCGATGTGAGCCAGACCTTGG - Intergenic
986045191 5:4030061-4030083 CTCTGGGGTCAGACTCACCTGGG + Intergenic
986352484 5:6893483-6893505 CTCTGGAGTCAGATAGAACTGGG + Intergenic
987342696 5:16952635-16952657 CTTCGGTGTCAGACAGAACTGGG + Intergenic
988133204 5:27134034-27134056 CTTTGATGTGAAACAGTCCTGGG - Intergenic
988406659 5:30832695-30832717 CCCTGAAGTCAGACAGACCTTGG + Intergenic
988571152 5:32367950-32367972 TTTTGATTTCAGAAAGACCTGGG - Intronic
988903878 5:35764381-35764403 CTTTGAAGTCATATAGACCTAGG - Intronic
988959897 5:36359295-36359317 CTCTGAAGTCAGGCAGGACTGGG - Intergenic
989082594 5:37640039-37640061 CTTTGAAATCAGACACACCTGGG - Intronic
989273397 5:39558409-39558431 CTTTGAAGGCAGACAAACCTGGG + Intergenic
989600778 5:43198735-43198757 CCCTGAGGTCAGACAGTCTTGGG + Intronic
990205198 5:53421371-53421393 CTTTGAAGTCAGACAAACCTGGG - Intergenic
990272259 5:54156247-54156269 CTTTGGAGTCAGACAGAACTAGG + Intronic
990284860 5:54291156-54291178 CTTTGAGGTTAGACAAACCTGGG + Intronic
990580676 5:57164677-57164699 CTTTGGAGTTAGACAGACCTAGG - Intergenic
990902820 5:60771538-60771560 CTCTGATGTCAGACAGACCTGGG + Intronic
991313232 5:65269593-65269615 CTCTGAAATTAGAAAGACCTGGG + Intronic
991503038 5:67296318-67296340 CTCTGAAGGCAGGCAGACGTAGG + Intergenic
991642679 5:68770420-68770442 GTCTGGAGTCAGACAGGCCTTGG - Intergenic
991922066 5:71666951-71666973 CTCTGGAGTCAGACAAACTTGGG - Intergenic
992407450 5:76473093-76473115 CTTTGAAGTCAGAAAGACCTAGG - Intronic
992478664 5:77128517-77128539 CTCTGGTGTCAGACAAGCCTTGG + Intergenic
993020672 5:82586741-82586763 TTTTGAGGTCAGACAGACTTTGG - Intergenic
993110769 5:83654784-83654806 CTCTAATGTGACATAGACCTTGG + Intronic
993565673 5:89471972-89471994 CTCTGGAGTGAGGCAGACCTGGG + Intergenic
994154096 5:96482894-96482916 ATTTGAGGTCAGACAGACATGGG + Intergenic
994379264 5:99051989-99052011 CTTTGTAATCAGACAGACCTGGG + Intergenic
994583722 5:101679679-101679701 TTCTAAAGTAAGACAGACCTGGG + Intergenic
994662214 5:102667643-102667665 TTTTGAAGTAAGACAGACCTCGG - Intergenic
995337214 5:111013448-111013470 CTCTAACATCATACAGACCTGGG - Intergenic
995412068 5:111869599-111869621 CTCTACTGTCAGACAGGTCTGGG + Intronic
995538439 5:113160559-113160581 CCCTGGGGTTAGACAGACCTGGG - Intronic
995813891 5:116144492-116144514 CTATGGAGTCAGACAGACCTGGG - Intronic
996028944 5:118683801-118683823 CTATGGAGTCAGACAGACCCAGG + Intergenic
996516011 5:124370040-124370062 GTGTCATGTCAGACAGACTTGGG - Intergenic
996727677 5:126686922-126686944 CTCTGGTCTCAGGCAGGCCTAGG - Intergenic
997379742 5:133427098-133427120 CTCTGGAGTCAGGCAGCCCTGGG + Intronic
997564434 5:134876098-134876120 CTCTGAAGTCAGGCAGACATGGG - Intronic
997743818 5:136280983-136281005 CTTTGATGTCAAACTGGCCTGGG - Intronic
997825440 5:137102664-137102686 CTCTTGAGTCAGACAGACCAGGG + Intronic
997882216 5:137601381-137601403 CTCAGAAGTCAGACAGACCTGGG - Intergenic
997898624 5:137742703-137742725 CTCTTAGGTCAGGCAGACCTGGG - Intergenic
998042643 5:138962366-138962388 CTCTGGAGTCAGAGAGACCTAGG + Intronic
998135458 5:139671877-139671899 CCCTGGAGTCACACAGACCTGGG + Intronic
998389653 5:141779362-141779384 CTTTGAGGTCAGACAGATTTAGG - Intergenic
998556511 5:143130130-143130152 CTCTGCAGTCAGACAAACCTGGG - Intronic
998885033 5:146685214-146685236 CTCTGGAGTCAGACAGACTCTGG + Intronic
998944630 5:147325055-147325077 CTTTGAGGTCAGAGAGATCTAGG - Intronic
999090075 5:148928223-148928245 CTTTGATGCCAGACAGGCCTTGG + Intronic
999190386 5:149742780-149742802 CTCTGAAGTCAGACAAACCTAGG - Intronic
999198199 5:149797166-149797188 CTCTGATCCCAGACACACCAGGG - Intronic
999466077 5:151806455-151806477 CTCTGATGACAGAAAGCACTGGG - Exonic
999481221 5:151949826-151949848 CTTTGCATTCAGACAGACCTAGG + Intergenic
999882351 5:155880086-155880108 CTCTGAAGTTAGCCACACCTTGG + Intronic
1000172702 5:158718691-158718713 CTCTGATGTCTAACAGGCCTGGG - Intronic
1000194022 5:158940548-158940570 CTCTAGAGTCAGACAAACCTAGG - Intronic
1000244225 5:159436168-159436190 GTGTCATGTCAGACAGAACTCGG - Intergenic
1000244458 5:159437907-159437929 CTACAAAGTCAGACAGACCTGGG - Intergenic
1000457189 5:161465086-161465108 CTCTGGGGTCAGACACACCTAGG + Intronic
1001174961 5:169459666-169459688 ATGTGATGACAGACAGAGCTTGG - Intergenic
1001256128 5:170184758-170184780 GTCTGGTGTCCTACAGACCTGGG - Intergenic
1001489528 5:172145640-172145662 CTCTGGAGCCAGACACACCTGGG + Intronic
1001686131 5:173596295-173596317 CTCTGATCTCAGATAGATCAGGG - Intergenic
1001756796 5:174176634-174176656 CTCTGGCGTCAGCCAGATCTGGG - Intronic
1001787563 5:174426759-174426781 TTCTAAAGTCAGACAGACCAAGG - Intergenic
1001892747 5:175352850-175352872 GTTTGAAGTCAGATAGACCTGGG - Intergenic
1001931313 5:175675030-175675052 CTCTGGAGGCTGACAGACCTCGG + Intronic
1001951929 5:175822342-175822364 CTTTGATGTCTAACAGACCAGGG + Intronic
1002310972 5:178313575-178313597 CTCCGAAGTCACACAGACCCGGG - Intronic
1002434818 5:179224803-179224825 CTGAGGTGGCAGACAGACCTGGG - Intronic
1003156000 6:3595075-3595097 CTGTGAGGTCAGACAGGCGTGGG - Intergenic
1003368516 6:5500647-5500669 CTCTGGAGTTAGACAAACCTAGG + Intronic
1003517978 6:6833671-6833693 CTCTGATGTGAGTAAGCCCTGGG - Intergenic
1004237544 6:13887775-13887797 CACTGAGGTCAAGCAGACCTGGG - Intergenic
1004276867 6:14244363-14244385 GTCTGGAGTCAGACAGACCTGGG - Intergenic
1004902879 6:20210279-20210301 CTTAGATGTCAGACTGACCTGGG - Intronic
1005120147 6:22380331-22380353 ATCTGGAGTCACACAGACCTGGG + Intergenic
1005955205 6:30658844-30658866 CTCTGACCTCAAACATACCTTGG + Intronic
1006042512 6:31268036-31268058 CTTTGTTGTCAGCCAGACATAGG - Intergenic
1006099824 6:31679718-31679740 CTGTGAAGTGAGACAGCCCTGGG + Intronic
1006799939 6:36753341-36753363 CTCTGAAGTCAGACACACCCTGG - Intronic
1006907811 6:37544909-37544931 CTCTGTTGCCAGACAGAACTGGG - Intergenic
1007430758 6:41775418-41775440 CGCCGATGTCAGACAGGCCAGGG - Exonic
1007557330 6:42777400-42777422 CTCTGTATTCAGACTGACCTGGG - Intronic
1007665990 6:43513236-43513258 CTCTGATCTCAGCCTCACCTAGG + Intronic
1007689263 6:43688191-43688213 ATCGGATATCAGGCAGACCTGGG + Intergenic
1007749594 6:44063831-44063853 CTTTGGGGTCAGACAGACATGGG + Intergenic
1007814652 6:44512969-44512991 CTCTGGAGTCCAACAGACCTGGG + Intergenic
1008619847 6:53260979-53261001 CTCTGGTGTCAAACTTACCTTGG + Intergenic
1008904039 6:56656657-56656679 CTCTGTAGTCAGACAGACCTGGG - Intronic
1008949214 6:57136942-57136964 CTTTGGTATCAGACAGACCTGGG + Intronic
1008980238 6:57474802-57474824 CTCTGGTGTCTGGCAAACCTGGG - Intronic
1009168337 6:60367742-60367764 CTCTGGTGTCTGGCAAACCTGGG - Intergenic
1009944459 6:70326498-70326520 CTTTGAAGTCAGACAGAACTAGG - Intergenic
1010731862 6:79399565-79399587 ATCTGTGGTCAGATAGACCTAGG - Intergenic
1011811832 6:91141104-91141126 TTTTGATGTCAAACTGACCTGGG - Intergenic
1012394262 6:98777948-98777970 CTCTGAAGTCAGCAACACCTGGG - Intergenic
1012868987 6:104651714-104651736 CTTTGGAGTCAGACAGACCTAGG - Intergenic
1013080098 6:106804991-106805013 CTCTGGAGTCAGACAGATTTGGG - Intergenic
1013179993 6:107709275-107709297 CTCTGGTGCCAGAGAGACCTAGG + Intronic
1013785614 6:113776428-113776450 CTTTGCTGTCAGACAGATTTAGG + Intergenic
1014466860 6:121766428-121766450 CTCTGTAATCAGACAGACCTAGG - Intergenic
1015607159 6:134970073-134970095 CCCTGAAGTCAGACAGACCTGGG + Intronic
1015729072 6:136329906-136329928 CTCTGGAGGCAGACAGACCTGGG + Intergenic
1015865606 6:137723536-137723558 CTCTGGACTCAGACAGACCTGGG + Intergenic
1016051064 6:139530623-139530645 CTTTGAAGTCAGACAGACCCAGG + Intergenic
1016426337 6:143939591-143939613 CCCAGCTGCCAGACAGACCTGGG - Intergenic
1016961688 6:149678744-149678766 CCCTGAAATCAGACAAACCTGGG + Intronic
1017635392 6:156438149-156438171 CTTTGATGTCAGACAGATTTTGG - Intergenic
1017959477 6:159209280-159209302 CTCTGCTGTTAGATAGACTTTGG + Intronic
1018962146 6:168456664-168456686 CTCTGAGATCAGCCTGACCTGGG - Intronic
1019179616 6:170178107-170178129 CTTTGAGCACAGACAGACCTGGG - Intergenic
1019276207 7:177303-177325 CCGTGATGTCAGCCAGGCCTCGG - Intergenic
1019511184 7:1418430-1418452 CTCTGATGTCACACAGAGCCTGG + Intergenic
1019511297 7:1418924-1418946 CTCTGATGTCATCCAGAGCCCGG + Intergenic
1019559258 7:1647830-1647852 CTCTGGGGTCCTACAGACCTGGG + Intergenic
1020185501 7:5956296-5956318 CTCTGGAGTCACACAGACTTGGG + Intronic
1020297413 7:6768453-6768475 CTCTGGAGTCACACAGACTTGGG - Intronic
1020357204 7:7290637-7290659 CTTTGGAGTCAGATAGACCTGGG - Intergenic
1020963445 7:14835437-14835459 ATTTGATGTCAGACAAAACTGGG - Intronic
1021084437 7:16405393-16405415 CTATGAAGTTGGACAGACCTAGG - Intronic
1021800463 7:24300382-24300404 CTAAGATGTCAGAAAGACCTGGG + Intergenic
1021816316 7:24450835-24450857 CCCTAGAGTCAGACAGACCTGGG - Intergenic
1021836726 7:24684055-24684077 CTCTAAAGACAGAAAGACCTAGG - Intronic
1021951096 7:25775912-25775934 TCTTGATATCAGACAGACCTTGG - Intergenic
1022235728 7:28458636-28458658 CTGTGGTTTCAGACAGACCTGGG + Intronic
1022259858 7:28693631-28693653 TTTTGGAGTCAGACAGACCTGGG + Intronic
1022391600 7:29948993-29949015 TTATCATGTCTGACAGACCTTGG + Intronic
1022546616 7:31195079-31195101 CACTGATGTAAGAAAGACTTTGG - Intergenic
1022567083 7:31414322-31414344 CTCTGATGTCTGACAGTTATGGG + Intergenic
1022653881 7:32300505-32300527 CTCTGCTCACAGATAGACCTGGG + Intergenic
1023151839 7:37208811-37208833 CTCTGATGCAAGACTGGCCTGGG + Intronic
1023263849 7:38384695-38384717 GACTGATGCCAGACAAACCTTGG - Exonic
1023303120 7:38794688-38794710 CTTTGAGGCCAGACAGACCTGGG - Intronic
1023455211 7:40331394-40331416 CTTTGGAGTCAGACAGACCTTGG + Intronic
1023534463 7:41193767-41193789 CTGTGATGCCAGAGAGACTTGGG - Intergenic
1023648689 7:42345753-42345775 CTGTCATGTGAGACAGCCCTGGG - Intergenic
1023742703 7:43294719-43294741 TTTTGAAGTCAGACTGACCTGGG - Intronic
1023781553 7:43660614-43660636 CCCTGGAGTCAGGCAGACCTGGG - Intronic
1023813144 7:43927690-43927712 CTTGGGTGTCAGACAGACCTGGG + Intronic
1023949763 7:44833721-44833743 CTCTGGAGTCAGCCAGATCTAGG + Intronic
1024242882 7:47448864-47448886 ATCTGAAATCAGACAGACCTGGG + Intronic
1024303508 7:47906100-47906122 CTCTGAAATCAGACATACCTGGG + Intronic
1024387165 7:48765653-48765675 CTCTCAAGTCAGAATGACCTGGG + Intergenic
1025168199 7:56732384-56732406 CTTTAATGTCACACAGTCCTAGG - Intergenic
1025704192 7:63847540-63847562 CTTTAATGTCACACAGTCCTAGG + Intergenic
1026970635 7:74465405-74465427 CTTTGAAGCCAGACACACCTAGG + Intronic
1027219247 7:76203313-76203335 CTCTGATGTCAGAAAGACATGGG + Intronic
1027821234 7:83047822-83047844 CTTTGAAGTCAAACAAACCTGGG - Intronic
1028246682 7:88487527-88487549 CTATGATCTCTGACAGACTTGGG - Intergenic
1028671106 7:93401048-93401070 CTCTGGGGTCAGACAGAGCATGG - Intergenic
1028978271 7:96938322-96938344 ATTTGATGTCAGAGAAACCTGGG - Intergenic
1029262654 7:99313758-99313780 CTCTGAAGTCAGACAGATACAGG + Intergenic
1029949655 7:104569850-104569872 CTCTGGTGTCAAACAGAGTTGGG - Intronic
1030090062 7:105850580-105850602 CTCTTAAGTCAGAGAGATCTGGG - Intronic
1030148062 7:106376443-106376465 CTCTGAAGTCTGACAGGCTTGGG + Intergenic
1030293576 7:107896496-107896518 ATCTGAAGTAAAACAGACCTGGG - Intronic
1030773473 7:113503971-113503993 CTCTGAAGTGAAACAGAACTGGG - Intergenic
1031078723 7:117238513-117238535 CTATGCTGTCAGAGACACCTAGG - Intergenic
1031786081 7:126034627-126034649 TTCTGATGTCAAAGAGAACTGGG - Intergenic
1031891891 7:127304016-127304038 CTCTGAAATCAGACCAACCTGGG - Intergenic
1031900069 7:127399152-127399174 CTCTGGTCTCAGACAGATTTAGG - Intronic
1032143229 7:129353342-129353364 CCCTGATGTAAGAAAGAACTTGG - Intronic
1032381262 7:131484311-131484333 CTTTGGAGTCAGACAGACATGGG + Intronic
1032485207 7:132281373-132281395 CTCTGATGTCAATCAGCTCTTGG + Intronic
1032610662 7:133408716-133408738 CTTTGGTGTCAGACAAACTTAGG - Intronic
1032643800 7:133798673-133798695 GTCTGAGGTCAGACAGGCCTGGG - Intronic
1032696984 7:134345620-134345642 CTCTGGAGCCAGACAGACCCGGG - Intergenic
1032878028 7:136058697-136058719 CTCTGATTGGAAACAGACCTGGG + Intergenic
1033428261 7:141265088-141265110 CACTAAAGTCAGAAAGACCTGGG - Intronic
1034067049 7:148147109-148147131 CTCTGAAATCTGACAAACCTTGG + Intronic
1034459079 7:151187959-151187981 CCCTGAGGTCATACAGCCCTGGG - Intergenic
1034850725 7:154491045-154491067 CTCTGATGTCAGCCAGAAAGGGG - Intronic
1035750357 8:1991855-1991877 CTTTGGTGTCAGACACACCCAGG - Intronic
1036025190 8:4899855-4899877 CTCTGGTGTCAGACATACCTGGG + Intronic
1036213671 8:6862721-6862743 CTCTCAAGTCAGACAGACCTGGG - Intergenic
1036263049 8:7255314-7255336 CTCTGCTGACAGACTTACCTTGG + Intergenic
1036264353 8:7262937-7262959 CTCTGCTGACAGACTTACCTTGG + Intergenic
1036265648 8:7270559-7270581 CTCTGCTGACAGACTTACCTTGG + Intergenic
1036266950 8:7278181-7278203 CTCTGCTGACAGACTTACCTTGG + Intergenic
1036268256 8:7285803-7285825 CTCTGCTGACAGACTTACCTTGG + Intergenic
1036269560 8:7293425-7293447 CTCTGCTGACAGACTTACCTTGG + Intergenic
1036298334 8:7553630-7553652 CTCTGCTGACAGACTTACCTTGG - Intergenic
1036299639 8:7561280-7561302 CTCTGCTGACAGACTTACCTTGG - Intergenic
1036300943 8:7568926-7568948 CTCTGCTGACAGACTTACCTTGG - Intergenic
1036302250 8:7576576-7576598 CTCTGCTGACAGACTTACCTTGG - Intergenic
1036315088 8:7713854-7713876 CTCTGCTGACAGACTTACCTTGG + Intergenic
1036316397 8:7721500-7721522 CTCTGCTGACAGACTTACCTTGG + Intergenic
1036317704 8:7729148-7729170 CTCTGCTGACAGACTTACCTTGG + Intergenic
1036319013 8:7736796-7736818 CTCTGCTGACAGACTTACCTTGG + Intergenic
1036320321 8:7744443-7744465 CTCTGCTGACAGACTTACCTTGG + Intergenic
1036321629 8:7752091-7752113 CTCTGCTGACAGACTTACCTTGG + Intergenic
1036322939 8:7759739-7759761 CTCTGCTGACAGACTTACCTTGG + Intergenic
1036324240 8:7767388-7767410 CTCTGCTGACAGACTTACCTTGG + Intergenic
1036351800 8:8016919-8016941 CTCTGCTGACAGACTTACCTTGG - Intergenic
1036353100 8:8024565-8024587 CTCTGCTGACAGACTTACCTTGG - Intergenic
1036805912 8:11833317-11833339 TTCTGATGTCAGACAGACCTGGG - Intronic
1036828167 8:11996045-11996067 TTTTGATGTCAGCAAGACCTGGG - Intronic
1037035374 8:14159943-14159965 TTCTGTTGTCAAACAGACATGGG + Intronic
1037625681 8:20604818-20604840 CTCTGGAGTCAGACAGACGTGGG - Intergenic
1038547793 8:28439291-28439313 CTTTGCAGTCAGACAGACCTGGG - Intronic
1038858341 8:31357949-31357971 CTTTGACATCAGACAGATCTAGG - Intergenic
1039085274 8:33773681-33773703 TTTTGGAGTCAGACAGACCTAGG + Intergenic
1039180781 8:34863845-34863867 CTCTGGTGTCAGACAGACTGGGG - Intergenic
1039464491 8:37774313-37774335 CTTTGAAATCAGACAGACCTTGG + Intronic
1039914937 8:41852763-41852785 CCTTGAGGTCAGACAGACCTGGG - Intronic
1040034506 8:42856776-42856798 CTTTAAAGTCAGACAGATCTGGG + Intronic
1040049662 8:43000659-43000681 CTCTGGGGTCTGGCAGACCTGGG + Intronic
1040655584 8:49503758-49503780 CTTTAAAGTCAAACAGACCTGGG + Intergenic
1041066682 8:54089473-54089495 CTGTGATTTCAGACATCCCTGGG + Intronic
1041364179 8:57083638-57083660 GTCTGAGCTCAGACATACCTAGG + Intergenic
1041874844 8:62676216-62676238 CTTTGGAGTCAGACAGATCTGGG - Intronic
1042012584 8:64264335-64264357 CTTTGAGGTCAGACAGACGTGGG - Intergenic
1042735662 8:71984993-71985015 CTCTGGTTTCAGACAGATCTTGG + Intronic
1042925361 8:73962319-73962341 CTGTGAAGTCAGACCTACCTAGG - Intronic
1042963300 8:74325193-74325215 CTCTAAAGTCACACAGACCTGGG - Intronic
1044112136 8:88287942-88287964 CTCTGAAGTTTGACTGACCTTGG - Intronic
1044226519 8:89725156-89725178 CTTTGAAGTCAGGCAGACCTGGG - Intergenic
1044252079 8:90015229-90015251 CTCTGAAGTCAGACAGATACTGG + Intronic
1044779146 8:95725235-95725257 TTCTGAAATCAGACAGATCTAGG + Intergenic
1045045515 8:98272194-98272216 CTCTGAAGTCAAATAGACCTGGG - Intronic
1045332863 8:101170706-101170728 CTTTGGAGTCACACAGACCTGGG + Intergenic
1045389553 8:101701763-101701785 GTCTGCTGTCAGAGAGACGTGGG - Intronic
1046039552 8:108885873-108885895 CTTTGGTGTCAGACAAAACTGGG + Intergenic
1046098035 8:109583330-109583352 ATTTGGAGTCAGACAGACCTGGG - Intronic
1046423057 8:114009513-114009535 CTTTGGAGTCAGACAGACCTCGG - Intergenic
1046733228 8:117748486-117748508 CTTTGAAATCAGCCAGACCTAGG - Intergenic
1046895920 8:119473312-119473334 CTCTGTTGTCTGACAGAGCCTGG + Intergenic
1046947637 8:119988897-119988919 CTCTGATCTCAGATAGCCCAGGG - Intronic
1046952721 8:120033476-120033498 CTCTGGAGCCAGACAGACCTGGG - Intronic
1047155808 8:122316721-122316743 CTTGGAGGTCAGACACACCTGGG - Intergenic
1047209232 8:122827582-122827604 TTCTGAAGTCAGACAGATCTGGG - Intronic
1047307494 8:123664749-123664771 ATCTGATACCGGACAGACCTGGG + Intergenic
1047338436 8:123957647-123957669 CTCTGATGTAAGACTCACCTGGG - Intronic
1047355428 8:124117136-124117158 CTTTGGTATCATACAGACCTGGG + Intronic
1047577088 8:126168487-126168509 TTCTGAATTCAGACAGACTTGGG - Intergenic
1047771840 8:128036212-128036234 ATCAGATGACAGACAAACCTGGG - Intergenic
1048005151 8:130413143-130413165 CTTTGTAATCAGACAGACCTAGG - Intronic
1048414878 8:134215423-134215445 CTCTGAAGTCAGGCAAACTTGGG - Intergenic
1048507094 8:135031528-135031550 CTCTGCTGGCAGAAAGAGCTGGG - Intergenic
1048616851 8:136084365-136084387 CTTTGATGCCAGACAGGCCCAGG + Intergenic
1048705247 8:137146511-137146533 CTGTGATGTGAGGCAGACCCAGG - Intergenic
1049001583 8:139828738-139828760 CTCTGGAGCCAGACAGACCTGGG - Intronic
1050602791 9:7269499-7269521 CTCAGATGTAAGACAGACGTTGG - Intergenic
1050812007 9:9759855-9759877 TTATCATTTCAGACAGACCTTGG - Intronic
1051610459 9:18956965-18956987 CTTTGAAATCAGGCAGACCTGGG - Intronic
1051710799 9:19928411-19928433 CTCTGGAGGCAGGCAGACCTGGG + Intergenic
1052411527 9:28127828-28127850 GTTTGATGTCAGAAAGACCTGGG + Intronic
1052456899 9:28710987-28711009 CTCTGCAGACAGACAGATCTGGG + Intergenic
1052993804 9:34538765-34538787 CTCTGGGGTCAGACAAACCTAGG - Intergenic
1052999698 9:34571195-34571217 CTCTGAATTCAGGCAGTCCTGGG - Intronic
1053405373 9:37870683-37870705 CTATGAAGTCAGACAGAACCAGG - Intronic
1053512935 9:38704880-38704902 CTCTGAAGATGGACAGACCTAGG - Intergenic
1054450634 9:65401906-65401928 CTCTGTTGTGAGGCAGATCTCGG - Intergenic
1054783073 9:69184046-69184068 CTCTGAAGTCAAATAAACCTGGG + Intronic
1054997089 9:71404534-71404556 GTCTTATGTCAGACAGACCCTGG + Intronic
1055104944 9:72502460-72502482 CTGTGGAGTCAGACAGATCTAGG - Intergenic
1056417306 9:86389128-86389150 CGTTGAAGTCAGAAAGACCTTGG - Intergenic
1057171285 9:92964800-92964822 CTCTCATGTCACCCAGGCCTGGG + Intronic
1057336529 9:94159985-94160007 CTCTGTGCTAAGACAGACCTGGG + Intergenic
1057405749 9:94769287-94769309 CTGTGATGTCAGACATGCATAGG + Intronic
1057574174 9:96228228-96228250 CTTTGTTTTCAGACAGAGCTGGG + Intergenic
1057699790 9:97355668-97355690 CTCTGGTGTCGGTCAGACCTGGG - Intronic
1057702610 9:97374730-97374752 CTCTGAAGTCAGACAGACCTGGG + Intronic
1057724691 9:97560015-97560037 CCCTGATGTCAGTGTGACCTTGG - Intronic
1057726417 9:97571716-97571738 CTCTGGAGTCACACAGACCTGGG - Intronic
1057791631 9:98128525-98128547 CTCTGGTGCCCGACAGCCCTGGG + Intronic
1058000559 9:99861098-99861120 CCCTGGAGTTAGACAGACCTAGG - Intronic
1058147477 9:101428086-101428108 CTTTGAGGTCAGACACACCTGGG - Intronic
1058501496 9:105623388-105623410 CTCTGAAGTGATACACACCTAGG - Intronic
1058544925 9:106051133-106051155 CTTTGCAATCAGACAGACCTGGG + Intergenic
1058635992 9:107039126-107039148 CTCTGGAGTCAGAAAGACCTGGG + Intergenic
1058863580 9:109140888-109140910 CTTTGGGGTCAGACAGACTTAGG + Intronic
1058987204 9:110219350-110219372 CTTTGATGTCAGAGCCACCTGGG - Intergenic
1058994233 9:110283864-110283886 CTCTGAAGTTGGACAGACCTAGG - Intergenic
1059032151 9:110710211-110710233 CTTTAGTATCAGACAGACCTGGG + Intronic
1059182034 9:112225224-112225246 CTCTGTAGGAAGACAGACCTGGG + Intronic
1059339107 9:113587394-113587416 CTGTGGAGTCAGACAGACCCAGG + Intronic
1059425733 9:114219917-114219939 CTTTAGGGTCAGACAGACCTGGG + Intronic
1059446797 9:114342963-114342985 CTCTGGAGTCACAAAGACCTGGG + Intronic
1059483006 9:114606712-114606734 CTGGGAACTCAGACAGACCTGGG - Intergenic
1059485898 9:114626611-114626633 CCCTGGAGTCAGACAGCCCTGGG - Intronic
1059694034 9:116713887-116713909 CTTGGAAGTCAGACAGCCCTAGG + Intronic
1059727874 9:117027267-117027289 CTGTGGAGTCAGACATACCTAGG - Intronic
1059731473 9:117061223-117061245 CTTTGGAGTCAGACAGATCTGGG + Intronic
1059974701 9:119702947-119702969 CTCTGGAGTCAGAGAGAACTGGG - Intergenic
1060040551 9:120296500-120296522 CTCTGGAGTCAGACAGATCAGGG + Intergenic
1060276412 9:122186324-122186346 CTCTGGTGTCAGAGGGACCTGGG - Intronic
1060403551 9:123361841-123361863 CTTTGAAGTGAAACAGACCTGGG - Intronic
1060551255 9:124486435-124486457 CTTTGGTGTCAGAGAGACTTGGG - Intronic
1060584594 9:124777906-124777928 CTCTGGTGTCAAGCCGACCTGGG + Intronic
1060735393 9:126063629-126063651 TTCTGGAGTCAGACAGATCTTGG + Intergenic
1060788053 9:126465917-126465939 CTTTGGTGTCAGACAGCCCTAGG - Intronic
1061011151 9:127955393-127955415 CTCTGAAGTCATACAGTCCTGGG - Intronic
1061071765 9:128315181-128315203 CTCTGGTGTTGGAGAGACCTAGG + Intronic
1061204882 9:129157090-129157112 ACCTGGTGTCAGACAAACCTGGG - Intergenic
1061414327 9:130438224-130438246 CTCTGGAGTCAGATGGACCTGGG - Intergenic
1061618829 9:131797624-131797646 CTCTGCACTCAGACTGACCTGGG + Intergenic
1061631573 9:131875410-131875432 GGCTGGAGTCAGACAGACCTGGG - Intronic
1061681748 9:132245942-132245964 CTCTGGAGTCAGGCAGCCCTGGG - Intergenic
1061756542 9:132816565-132816587 GTTTGATGTCACGCAGACCTGGG - Intronic
1062283769 9:135763914-135763936 CTCTGCTGTCAGACACCCCAGGG - Intronic
1062438029 9:136555487-136555509 CTGTGACCTCAGACAGGCCTCGG - Intergenic
1186586460 X:10879015-10879037 GTTTGGAGTCAGACAGACCTGGG - Intergenic
1186794352 X:13030094-13030116 CTTTGGTGTCAGGCAGACCCAGG - Intergenic
1187839501 X:23472233-23472255 ATCTGATCTCTGACAAACCTGGG - Intergenic
1188353076 X:29156172-29156194 CTTTGGAGTCAGACAGACCAGGG - Intronic
1188817373 X:34731676-34731698 CTCTGAAATCACATAGACCTAGG - Intergenic
1189564791 X:42230570-42230592 CTTTGGCGTCAGACAGACCTGGG + Intergenic
1189724351 X:43953755-43953777 CTTTGGTTTCAGATAGACCTTGG - Intronic
1189745376 X:44163058-44163080 CTTTGGAGTCAGACAGAGCTGGG - Intronic
1190275822 X:48898487-48898509 AGCTGATAGCAGACAGACCTAGG - Exonic
1190561675 X:51692387-51692409 TGCTGATGTCAGACACAGCTTGG - Intergenic
1190562616 X:51700918-51700940 TGCTGATGTCAGACACAGCTTGG + Intergenic
1190776201 X:53554105-53554127 CTTTAAAGTCAGACAGATCTGGG + Intronic
1191171423 X:57451241-57451263 ATTTGGAGTCAGACAGACCTGGG - Intronic
1191248814 X:58249077-58249099 CTCTGATGATAGAGACACCTGGG + Intergenic
1191911908 X:66160562-66160584 CTGTGATGTGTGACAGCCCTAGG - Intergenic
1192159099 X:68769492-68769514 CTCTGATGTCTGAGGGATCTGGG - Intergenic
1192184238 X:68935826-68935848 CTCAGAAGTCAGACTGGCCTGGG + Intergenic
1192342244 X:70273595-70273617 CTTTGGAGTCAGACAGGCCTGGG + Intronic
1193792752 X:85835896-85835918 ATTTGAAGTCAGACAGACTTAGG - Intergenic
1194820043 X:98494272-98494294 CTCTAGAGTCAGACAGACCTGGG + Intergenic
1195420263 X:104667606-104667628 CTCTGGGGTCAGACAAATCTGGG - Intronic
1195649055 X:107265524-107265546 CTCTAGAGTAAGACAGACCTAGG + Intergenic
1195717835 X:107834824-107834846 CCCTGGAGTCAGACAGACCTGGG + Intronic
1196020089 X:110982287-110982309 CACTGAAGACAGACAGATCTAGG + Intronic
1196185519 X:112740891-112740913 CCCTGGAGTCAGACAGAGCTGGG - Intergenic
1196199568 X:112870325-112870347 CTTTGGAGTCAGATAGACCTAGG + Intergenic
1196805400 X:119579656-119579678 CTCTGCAGTCAGACAGGTCTGGG - Intronic
1196972145 X:121121495-121121517 CATTGACGTCAGATAGACCTCGG - Intergenic
1197309669 X:124888949-124888971 CCACGATGTAAGACAGACCTAGG - Intronic
1197523741 X:127534248-127534270 ATTTGAGGTCAGACAGAACTGGG - Intergenic
1197749681 X:129956093-129956115 CTCTGATGGCACACTGCCCTAGG - Intergenic
1197774941 X:130112457-130112479 CTGTAACCTCAGACAGACCTGGG + Intergenic
1197840467 X:130740837-130740859 CTTTGGAGTCAGACAGACCTGGG + Intronic
1197915811 X:131533696-131533718 CTCTGATTTCATTCAGACCCTGG + Intergenic
1197960659 X:132002363-132002385 TTCTGATATCAGGGAGACCTGGG - Intergenic
1198030848 X:132752064-132752086 CTCTGGTTTCAGAGAGACTTGGG - Intronic
1198328455 X:135597861-135597883 CTCTGAAATCTGACAGACCTAGG - Intergenic
1198338005 X:135687195-135687217 CTCTGAAATCTGACAGACCTAGG + Intergenic
1198376773 X:136048516-136048538 CTCTGGAGTGACACAGACCTGGG + Intergenic
1198419694 X:136458234-136458256 CTTTGGAGTCAGAAAGACCTAGG + Intergenic
1198477969 X:137014189-137014211 CTTTGAGGTCAGACAAACCTAGG - Intergenic
1198492201 X:137153077-137153099 CTTTGAAGTCAGACAGATCTGGG - Intergenic
1198848099 X:140935159-140935181 CTCTGGAGTCTGACACACCTGGG - Intergenic
1199473888 X:148224852-148224874 CTCTGCTGACAAACAGACCTAGG - Intergenic
1199761570 X:150908271-150908293 TTCTGCTGTCAGGCAGTCCTTGG + Intergenic
1199769106 X:150962758-150962780 CTTTGGAGTCAGAGAGACCTGGG - Intergenic
1199824791 X:151488351-151488373 CTTTGCAGTCAGACAGACCTTGG + Intergenic
1200362283 X:155621415-155621437 CTCTGGAGTCAGACAAACATAGG + Intronic
1202175576 Y:22095913-22095935 CTCTTACCTCAGACTGACCTCGG + Exonic
1202215785 Y:22490469-22490491 CTCTTACCTCAGACTGACCTCGG - Exonic
1202380622 Y:24274123-24274145 CTTTGATGTTAGACAGCCCTGGG - Intergenic
1202490162 Y:25396002-25396024 CTTTGATGTTAGACAGCCCTGGG + Intergenic
1202579002 Y:26359379-26359401 CTTTGGAGTCAGACAGACCAGGG + Intergenic