ID: 990902836

View in Genome Browser
Species Human (GRCh38)
Location 5:60771773-60771795
Sequence GAAACTGATCTCACTAGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 112}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990902836 Original CRISPR GAAACTGATCTCACTAGAGC AGG (reversed) Intronic
903445624 1:23420894-23420916 GGAACTGATCTCAGGACAGCAGG - Intronic
907113674 1:51949973-51949995 GAAACAGCTCTCAGTAGAGAGGG + Intronic
912089685 1:106055725-106055747 GAAACTGTCCTCTCTACAGCAGG + Intergenic
912869246 1:113288884-113288906 GAAACAGCTTCCACTAGAGCAGG + Intergenic
913585011 1:120266409-120266431 GAACATGAGCTCACTATAGCAGG + Intergenic
913623171 1:120631953-120631975 GAACATGAGCTCACTATAGCAGG - Intergenic
914567015 1:148878266-148878288 GAACATGAGCTCACTATAGCAGG + Intronic
914605809 1:149251976-149251998 GAACATGAGCTCACTATAGCAGG - Intergenic
915935619 1:160088681-160088703 GAAAGTGGGTTCACTAGAGCTGG + Exonic
917371866 1:174301629-174301651 GAAACAGATCTCAGCAGAGAGGG + Intronic
922326253 1:224531153-224531175 GACACTGATGTGACTACAGCTGG - Intronic
923838111 1:237637240-237637262 GAAACTGATTTAACTTAAGCTGG + Intronic
1063076915 10:2726245-2726267 GATGCTGATTTGACTAGAGCAGG - Intergenic
1063330009 10:5148170-5148192 GAAACTGATCTCAGGAGGCCAGG + Intergenic
1067087408 10:43250236-43250258 GACACTGGTTTCACTACAGCTGG + Intronic
1069211153 10:65761355-65761377 TAAACTGATACCACTAGAGTGGG - Intergenic
1073626690 10:105105460-105105482 GGAACTGATGTCAATGGAGCGGG - Exonic
1073912971 10:108368139-108368161 GAAAGTTATATCTCTAGAGCAGG - Intergenic
1076495872 10:130897613-130897635 AAATCAGATCTCATTAGAGCAGG - Intergenic
1080886671 11:36374589-36374611 CAAACTGATCTCCCTGCAGCCGG + Intronic
1081737288 11:45412820-45412842 GAAAGTGATCAGACCAGAGCAGG - Intergenic
1081829448 11:46095583-46095605 GTAACTGCTCTAATTAGAGCTGG + Intronic
1088388684 11:109289890-109289912 GACACTGTTCTCACAAGATCTGG - Intergenic
1097739510 12:63223424-63223446 GAAACTGAAATCACTTGACCTGG - Intergenic
1097746382 12:63308230-63308252 AAAACTGATTTTACAAGAGCCGG - Intergenic
1099972377 12:89513773-89513795 GCTGCTGATCTCACTGGAGCTGG - Intronic
1105203170 13:18195727-18195749 GAAAGAGACCTCGCTAGAGCAGG + Intergenic
1105324531 13:19358125-19358147 GAAACTGAAGTCACAGGAGCAGG + Intergenic
1105868778 13:24485591-24485613 GAAACTGAAGTCACAGGAGCAGG - Intronic
1109933216 13:69244477-69244499 AAAAATGATCTCAGTAGAGGAGG - Intergenic
1112110244 13:96289418-96289440 GAAACAGATCTCACTATATATGG + Intronic
1114308065 14:21441590-21441612 GAAAATGAGCTGCCTAGAGCTGG + Intronic
1117160646 14:52986227-52986249 GACACTGATCTCATTTGAGGAGG + Intergenic
1117634739 14:57729898-57729920 GATTCTCCTCTCACTAGAGCTGG + Intronic
1122760781 14:104023851-104023873 GAGTCTGACCTCACTAGAGCAGG - Intronic
1123770844 15:23526803-23526825 GAAACTGATCTCTTTGGAGTTGG + Intergenic
1124136295 15:27038854-27038876 GAAACTGATCTCCTGAGAGAGGG + Intronic
1125117631 15:36113782-36113804 GCATCTGATCTCACCTGAGCAGG - Intergenic
1128270527 15:66305293-66305315 GAAATAGATTTCACTAGGGCTGG - Intronic
1128304073 15:66586679-66586701 GAAACTGAGGTCACTAGACATGG - Intronic
1128800436 15:70493462-70493484 GAAACTGAAATCACTTGATCAGG - Intergenic
1129428905 15:75483775-75483797 GAAACTGTTCTCATGAAAGCAGG + Intronic
1131338581 15:91573726-91573748 CAAACTGATGACACTAGACCAGG + Intergenic
1131764986 15:95665864-95665886 GAAAGTGATGTTATTAGAGCTGG - Intergenic
1131837577 15:96406624-96406646 GAAACAGATCTCAATACAGCTGG + Intergenic
1133197321 16:4180401-4180423 GAGGGCGATCTCACTAGAGCTGG - Intergenic
1133541022 16:6754242-6754264 GAAATTGATCTGAATAAAGCAGG - Intronic
1135829016 16:25756707-25756729 GAAACAGATGTCACTGGTGCTGG + Intronic
1138247258 16:55477271-55477293 AAAAGTTATCTCACTAAAGCAGG - Intronic
1138870866 16:60882800-60882822 GAAACTTATATCACTAGACATGG - Intergenic
1146130661 17:30271718-30271740 AAAACTGATCTCTTTTGAGCTGG + Intronic
1146227417 17:31078961-31078983 GAAGCTGATCTCAGAAGGGCAGG - Intergenic
1151448659 17:74183531-74183553 GACACTGATTTCCCTAGTGCTGG + Intergenic
1153819167 18:8818175-8818197 GAAACTGAGCTCAGGAGAGTCGG + Intronic
1153851971 18:9103105-9103127 GAAACTGATCTGGCCAGAGCAGG - Intronic
1155991015 18:32279381-32279403 GCCACTGATCTCACAGGAGCTGG - Intronic
1156774169 18:40766953-40766975 GAAGCAGATCTCAAAAGAGCAGG - Intergenic
1158047079 18:53169183-53169205 GGGACTGATCTCAGTAAAGCAGG + Intronic
1158415377 18:57245846-57245868 GAAACTGAGCTCACAGGAGTTGG + Intergenic
1162046582 19:8004630-8004652 GAGAATGATCTGTCTAGAGCAGG - Intronic
1164861776 19:31567347-31567369 AAAACTGTTCTCACTAGACACGG + Intergenic
1166279402 19:41781022-41781044 GAAACTGATCTACCTGGAGTTGG + Intergenic
1168197435 19:54786147-54786169 GAAATTGTTCTCACTAGAATTGG - Intronic
925444738 2:3918246-3918268 GACACTGATCTCAACAGAGCAGG - Intergenic
932360775 2:71103844-71103866 AAAACTGCTCTCAATAGAGAGGG - Intergenic
935380336 2:102445370-102445392 GAAACTGCTTTCACTTGAGAGGG + Intronic
936238011 2:110761786-110761808 GGTACAGATCTCACTAGAGAAGG - Intronic
940522245 2:154765782-154765804 GAAACTGAACTAACTAGAACTGG - Intronic
940658081 2:156513015-156513037 GAAACTGATTTAACTAGACTAGG - Intronic
946730613 2:222705821-222705843 GGAACTGAACTCACAATAGCAGG + Intronic
1174575828 20:51536421-51536443 GAACCTGATCTCACTGGTCCAGG + Intronic
1176714789 21:10342278-10342300 GAAAGAGACCTCGCTAGAGCAGG - Intergenic
1180603558 22:17037660-17037682 GAAAGAGACCTCGCTAGAGCAGG + Intergenic
1181917162 22:26290651-26290673 GAGACGGATCTCACTATGGCTGG - Intronic
1183014540 22:34975044-34975066 GATAGTGATCTCACAAGATCTGG - Intergenic
1183971300 22:41479543-41479565 GAAACTGATCTCTGTGGAGTGGG + Intronic
949618987 3:5788890-5788912 GAAAATGATCTCAAAAGATCAGG - Intergenic
950668799 3:14513050-14513072 GACTCTGGTCTGACTAGAGCAGG - Intronic
950702910 3:14762330-14762352 GAAGATCATCTCACGAGAGCTGG - Intronic
954197286 3:49004271-49004293 GAAGCTGTTCTCACTGGAGCAGG + Intronic
955469570 3:59272504-59272526 GACATTGCTCTCAGTAGAGCAGG - Intergenic
955533481 3:59899280-59899302 GAAAATGATCTCATCTGAGCAGG + Intronic
957977715 3:87469054-87469076 TAAACTGGTCTCACTCAAGCTGG - Intergenic
973681189 4:53321978-53322000 GAAACTGAGCACACTCCAGCAGG + Intronic
973725537 4:53771992-53772014 GAAACAGATCACATTATAGCAGG + Intronic
974077587 4:57181673-57181695 AAAACTGATCTCATTATTGCTGG + Intergenic
980046315 4:127992679-127992701 TAGACTGATGTCACTAGACCTGG + Intronic
980968385 4:139545857-139545879 GAAACTGACTTCACCAAAGCAGG - Intronic
982253433 4:153430161-153430183 GAAACTGATCTAAAAAGAGAGGG - Intergenic
984072961 4:175139297-175139319 GAATCTGATCTCACAAGAGGCGG + Intergenic
990902836 5:60771773-60771795 GAAACTGATCTCACTAGAGCAGG - Intronic
990987627 5:61655554-61655576 GAAACAGAACTCACTGGAGATGG + Intronic
991470398 5:66962733-66962755 GAAACTCATTGCACTATAGCAGG + Intronic
992534311 5:77683068-77683090 GATACTTATCTCACCAGAGCTGG + Intergenic
996656163 5:125939269-125939291 GAAACAGATCTCTCCAGAGATGG - Intergenic
996990116 5:129619609-129619631 TAAATAGATCTCACTGGAGCAGG + Intronic
997439304 5:133898145-133898167 AACACTGATGTCACCAGAGCAGG + Intergenic
1000827492 5:166063940-166063962 AAAACTGTTCTTACTAGAGAAGG - Intergenic
1003585813 6:7388245-7388267 GAGCCTGATCTGAGTAGAGCAGG - Intronic
1005807829 6:29491488-29491510 GAAGCTGAGCTCACTAAAGCAGG + Intergenic
1012336308 6:98062560-98062582 GAAATTTATAGCACTAGAGCAGG - Intergenic
1016799034 6:148149928-148149950 TAAATTGGTCTCACAAGAGCTGG - Intergenic
1019017400 6:168890021-168890043 GAAACTCATCTCACTCCACCAGG - Intergenic
1019763073 7:2828669-2828691 TAAACTGAAGTCACTAGAGCAGG - Intronic
1022749627 7:33210820-33210842 AAAACAAATATCACTAGAGCTGG - Intronic
1027556375 7:79669523-79669545 TAAACTGATATCAGTAGAGTGGG + Intergenic
1030344165 7:108414400-108414422 GAATCTGAGCTCACTTGAGAAGG - Intronic
1034567565 7:151927442-151927464 GAAGCTGGTCTCACCAGAGAGGG - Intergenic
1035738801 8:1909738-1909760 AAAACTGAGCTCACTGGACCGGG - Intronic
1046551247 8:115719924-115719946 TAAACTGAGCACAATAGAGCAGG + Intronic
1048568871 8:135633289-135633311 CAGCCTGGTCTCACTAGAGCAGG + Intronic
1050170381 9:2809765-2809787 GAAACTCAGCTCTCTAGAGAAGG - Intronic
1051346702 9:16157542-16157564 GAAGCTGATTTCACTACAGCTGG - Intergenic
1051369036 9:16342495-16342517 GAAACTGAAGTCAAGAGAGCTGG - Intergenic
1054969869 9:71072741-71072763 CAAACTGCTCTCACGAAAGCAGG + Intronic
1055451217 9:76433051-76433073 GAAACAGCTCTCAGTAGAGAGGG - Intronic
1055638360 9:78298951-78298973 GAAACAGAACAGACTAGAGCAGG - Intronic
1056626390 9:88257131-88257153 GAAAGTGATCTCAGAAGGGCAGG + Intergenic
1057836011 9:98445840-98445862 GAAACTGAGCTCAGGAGATCTGG + Intronic
1062147995 9:135001201-135001223 GATGCTGATCCCACCAGAGCTGG - Intergenic
1190705609 X:53024246-53024268 GGAACAGCTCTCAGTAGAGCGGG - Intergenic
1192204769 X:69088565-69088587 GAAACTGAGGCCACTAGAGAAGG + Intergenic
1194710011 X:97224762-97224784 GAAAATGATCTCAGTAAAGTGGG + Intronic
1198767929 X:140097180-140097202 GCAACTGACCTCACTAGAAAGGG + Intergenic