ID: 990904446

View in Genome Browser
Species Human (GRCh38)
Location 5:60788817-60788839
Sequence GGAAAGTCTGAATTTTCTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 296
Summary {0: 1, 1: 0, 2: 3, 3: 19, 4: 273}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990904446_990904450 20 Left 990904446 5:60788817-60788839 CCACAAGAAAATTCAGACTTTCC 0: 1
1: 0
2: 3
3: 19
4: 273
Right 990904450 5:60788860-60788882 CATTTTACTTACGTAAGTATAGG 0: 1
1: 0
2: 1
3: 8
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990904446 Original CRISPR GGAAAGTCTGAATTTTCTTG TGG (reversed) Intronic
902909146 1:19582313-19582335 GGAAGGTCTGAGTTGTCTTTTGG + Intergenic
910275002 1:85440279-85440301 GAAAAGTCTGATTTTTTTAGCGG + Intronic
910682352 1:89880277-89880299 GGAAAGTCAAATTTTTCTTTTGG - Intronic
911174911 1:94809066-94809088 GGTAAGTAGGAAATTTCTTGAGG + Intergenic
911357820 1:96843621-96843643 TCAAAATATGAATTTTCTTGGGG + Intergenic
913433219 1:118818727-118818749 GGAAATTGTGAAATTTCTAGAGG + Intergenic
913515508 1:119602280-119602302 GCAAATTCTGCAATTTCTTGGGG - Intergenic
917585551 1:176423658-176423680 GGAAAGTCTGATGTGTCTCGGGG + Intergenic
918028111 1:180773890-180773912 GTAAAATCTCTATTTTCTTGAGG - Intronic
919352525 1:196476644-196476666 GGAAAGTCTCCATTGTCTTTTGG - Intronic
919468401 1:197949665-197949687 GGAAACGCTGAATTTTGATGTGG - Intergenic
921783770 1:219200899-219200921 GGAATCTCTGGATTTTCTTAAGG + Intronic
922178913 1:223218349-223218371 AGAAAGTTTGAAATTTCTTAAGG + Intergenic
922934642 1:229413501-229413523 GGCAAGTCTCACTTTTCTAGGGG + Intergenic
923950474 1:238945938-238945960 AGACAATCTGAATTTTCTTGTGG - Intergenic
1065604757 10:27406097-27406119 GGATTGCCTGAATTTTCATGAGG + Intronic
1066322521 10:34318517-34318539 GGAAGGACTGAATTTTACTGAGG - Intronic
1067397374 10:45934456-45934478 GAAATGTCTGAATATTCATGAGG - Intergenic
1067865694 10:49903543-49903565 GAAATGTCTGAATATTCATGAGG - Intronic
1068424173 10:56835701-56835723 AGAAATTTTGAATTTGCTTGTGG - Intergenic
1069067633 10:63960527-63960549 TCCAAGTCTGAATTTTCTTCTGG + Intergenic
1069816888 10:71202429-71202451 GGAAATTATGAATATTCATGAGG - Intergenic
1071807905 10:89144302-89144324 GGAAGGTGTGTATTTTCATGTGG - Intergenic
1075298661 10:121300502-121300524 GGAAAGTGTGGGTTTTCTGGGGG - Intergenic
1077454260 11:2668787-2668809 AGAAGGTCTTAATTTTCATGTGG + Intronic
1077800807 11:5534215-5534237 GGAGAGTGTGCATTTTTTTGAGG - Intronic
1078003704 11:7517071-7517093 GCATAGTCTGAATTGTCTGGTGG + Intronic
1078219278 11:9337914-9337936 GTAGAGTGTGATTTTTCTTGAGG - Intergenic
1079758365 11:24295928-24295950 GAAAATCCTGAATTTTCTTTAGG + Intergenic
1080108931 11:28543859-28543881 TGGTTGTCTGAATTTTCTTGTGG + Intergenic
1080907489 11:36561192-36561214 GGAAAAGATGGATTTTCTTGGGG + Intronic
1081069075 11:38586747-38586769 GGGAGGTCTGAATTTTAATGAGG + Intergenic
1086151278 11:83613395-83613417 AGAAATTCTTAATTTTCATGAGG - Intronic
1087794063 11:102437211-102437233 GGAAACACTGAATTTGCCTGTGG - Intronic
1088333676 11:108679441-108679463 GTAAAGTCTGACGTTTCTTGGGG - Exonic
1088689929 11:112317066-112317088 GGAAAGTGTTTATATTCTTGTGG - Intergenic
1089164376 11:116463639-116463661 GGAAAGAATGAATTGTTTTGAGG - Intergenic
1089905216 11:122031377-122031399 GGAGAGTGTGAAGTTTCTTAGGG + Intergenic
1089930498 11:122305673-122305695 TGCAAGTCTGAATTTAATTGCGG - Intergenic
1090245142 11:125210793-125210815 GCAGAGTGTGAATTTTCTTCTGG + Intronic
1091158602 11:133398173-133398195 GGGAGGTCTGAATTTTGTGGTGG - Intronic
1092307452 12:7315969-7315991 GAAAACTATGAAGTTTCTTGAGG + Intronic
1092506057 12:9101311-9101333 TGAAAGTTTGATTTCTCTTGAGG - Intronic
1092691917 12:11121386-11121408 GGAATATTTGAATTTTTTTGAGG + Intronic
1093273479 12:17095407-17095429 GGAAAGTCTAAAATCTCATGGGG + Intergenic
1094357464 12:29593410-29593432 TGATAAACTGAATTTTCTTGAGG - Intronic
1096242738 12:49967983-49968005 GGAGAGTCTGGATTCTCCTGTGG + Intronic
1096560485 12:52432615-52432637 GGGCAATCTGACTTTTCTTGTGG - Intronic
1096913526 12:55008294-55008316 AGAAAGTCTGGATTATTTTGTGG - Intergenic
1097656323 12:62367484-62367506 AAAAAGTCTGAAATTTCTTTGGG - Intronic
1097813114 12:64040150-64040172 GGAAAATCAGCATTTTCTTATGG - Intronic
1099037709 12:77610008-77610030 GGAAAGAATAAATTTTCCTGTGG - Intergenic
1099257039 12:80327277-80327299 GGAAAGTCTCAAATTTCAAGAGG - Intronic
1100512202 12:95286637-95286659 GGACAATCTAAATTTTCTTCAGG + Intronic
1104594310 12:130110070-130110092 GGAAAAGCTGAGTGTTCTTGCGG - Intergenic
1105684727 13:22769531-22769553 TAAAAGTATGAATTTTCCTGAGG + Intergenic
1106529985 13:30581749-30581771 GCAAAGTCAGAATTTTCTGCAGG + Intronic
1107461913 13:40612264-40612286 GGGAAGCCTGGATTTTGTTGGGG - Intronic
1107780361 13:43895197-43895219 TTAAACTCTGTATTTTCTTGTGG + Intergenic
1108566463 13:51703715-51703737 GTAAAGTATGTATTCTCTTGTGG - Intronic
1108851024 13:54729232-54729254 GAAAATTGTGAATTTTTTTGTGG - Intergenic
1109507233 13:63319726-63319748 GGCAAATTTGAATTTTCCTGAGG + Intergenic
1109741764 13:66562976-66562998 TGAAAAACTGAATTTTCTTTGGG - Intronic
1110418978 13:75283626-75283648 GAAAATTTTGTATTTTCTTGTGG + Intergenic
1110995295 13:82100261-82100283 GCATAGTCAAAATTTTCTTGGGG + Intergenic
1114280012 14:21185050-21185072 TGAAAGCCTAAAATTTCTTGAGG - Intergenic
1115716615 14:36112457-36112479 TGAAAGTTTCAATTATCTTGAGG - Intergenic
1116386138 14:44332525-44332547 GCAGAGTGTGAATTTTTTTGGGG - Intergenic
1117530975 14:56660429-56660451 GGAAAGTTTGAATTTTCCTTGGG - Intronic
1118397477 14:65349675-65349697 GGCAAGTCTGTATTTTATTACGG + Intergenic
1120922069 14:89764330-89764352 TGTGACTCTGAATTTTCTTGGGG + Intergenic
1124907402 15:33883796-33883818 GAAAAAGCTCAATTTTCTTGAGG + Intronic
1125104109 15:35950525-35950547 TGAAAGAATGAATTTGCTTGTGG + Intergenic
1126283013 15:46978821-46978843 GGAAAGTCTGAATCTTCTTAGGG + Intergenic
1126401321 15:48273718-48273740 GGTAAGTCTGAATTTTCATTTGG - Intronic
1126697201 15:51336390-51336412 GGATGGTGTGAAGTTTCTTGGGG + Intronic
1127396793 15:58549722-58549744 GGAATGACAGAAATTTCTTGTGG + Intronic
1127440158 15:58998702-58998724 TGAAAGTTTGAATTTTATTTTGG - Intronic
1127555656 15:60084819-60084841 GGGAAGACTGAATTCTCTTTGGG - Intergenic
1128411962 15:67408374-67408396 GGAAAGTCTGAGTTTTCTCAAGG - Intronic
1130030796 15:80311645-80311667 CAAAAATCTGATTTTTCTTGTGG - Intergenic
1131273793 15:90963605-90963627 GGTAATTCTAAATTTTTTTGAGG + Intergenic
1131350143 15:91692385-91692407 GGAAAGTCTGACTTTCCTCTGGG + Intergenic
1131581875 15:93651342-93651364 GGAAGGTCTGAATTTTGTCCTGG + Intergenic
1131863538 15:96680633-96680655 GGAAAATCTGCTTTTTCTTTAGG - Intergenic
1134844917 16:17431911-17431933 GGAAGCTCTGAATTTTGCTGGGG + Intronic
1135657105 16:24259953-24259975 GGAAAATCTGAGTTTTCTAAAGG + Intronic
1138861087 16:60758505-60758527 GGAAAGTCAGAAAATTCTTTCGG - Intergenic
1140847794 16:78906660-78906682 TGAAAGTTTGCATTTTGTTGTGG + Intronic
1141234349 16:82201607-82201629 TAAAAGTCTGTATTGTCTTGTGG - Intergenic
1141303576 16:82839865-82839887 AGTAAGTCTGATTTTTCTTATGG - Intronic
1141408790 16:83817920-83817942 GGAAAGGCTGATTTCTTTTGAGG - Exonic
1142316560 16:89350663-89350685 GGAAAGGGGGAACTTTCTTGGGG + Intronic
1143988940 17:10940334-10940356 GGAAATGCAAAATTTTCTTGAGG - Intergenic
1144129348 17:12230875-12230897 AAAAAGTCTGAATTTTTTTCTGG - Intergenic
1146371450 17:32267168-32267190 GGAAAGTCTGAATGGGGTTGGGG + Intronic
1151246285 17:72797509-72797531 GGAAAGGCTCTATTTGCTTGGGG + Intronic
1153201555 18:2653069-2653091 GGAAAATCTAAGTTTTCTTCAGG + Intergenic
1156597118 18:38560352-38560374 GGAAAGTGTGGTTTTTATTGGGG - Intergenic
1156701927 18:39836029-39836051 GGAACGTCTGATTTTTCTGTAGG - Intergenic
1157696343 18:49726693-49726715 GGAAAGTGTGATTTTTCTGCAGG - Intergenic
1157738039 18:50068137-50068159 AGAAAGTGAGAATTTTATTGAGG - Intronic
1158066966 18:53422269-53422291 GGAAAGGCGGAGTTTTATTGTGG - Intronic
1158504261 18:58032185-58032207 AGAAAGTCTGATTTTTCTGGAGG - Intergenic
1159291100 18:66421416-66421438 GGAACATTTGAATTTTTTTGGGG + Intergenic
1159503825 18:69308521-69308543 TGTAAATCTGAATTTTCTTTTGG + Intergenic
1159791716 18:72789702-72789724 CCAAGGTCTGTATTTTCTTGAGG + Intronic
1160102113 18:75932217-75932239 GGATTGTGTGAAATTTCTTGTGG - Intergenic
1160493255 18:79355186-79355208 GTAAAGACTGAATTTTCTGAAGG - Intronic
1161529977 19:4782603-4782625 GGAAAGATTGATTTATCTTGAGG - Intergenic
1164238397 19:23359504-23359526 TGATAGTATGAATTTTCTTATGG + Exonic
1168238900 19:55079608-55079630 TGAAAGTCTGATTATTCTGGGGG + Intronic
926497350 2:13606863-13606885 GGGAAGTGTGAATTATTTTGAGG + Intergenic
927422701 2:22949679-22949701 GGAGCCACTGAATTTTCTTGAGG + Intergenic
929162594 2:38847575-38847597 GGACAGTCTGTGTTTTCTTTGGG - Intronic
929686671 2:44041052-44041074 GGAACATCTGTATTTACTTGAGG - Intergenic
929687781 2:44049239-44049261 GGAAAGACTGCAGTTCCTTGAGG - Intergenic
932015274 2:68019537-68019559 GGAAAGTATGATTTTTGATGTGG + Intergenic
932140332 2:69271738-69271760 GGAATGTCTGGGTTTTATTGAGG - Intergenic
935125909 2:100222611-100222633 GGAAAGTCTGAACTTTGCTAAGG - Intergenic
935369819 2:102333465-102333487 GGAGATGCTGAATTTTCTTTGGG + Intronic
935719686 2:105968937-105968959 GCAACGTCTGAATTGTCTGGTGG + Intergenic
937211100 2:120271864-120271886 GGGAAGACTGAATTTTCTAAGGG + Intronic
937705991 2:124921523-124921545 GGAGAGTCTGAAGTTTCACGTGG - Intergenic
938742195 2:134243530-134243552 TCAAGGTCTGAATTTTCTTAGGG - Intronic
939472783 2:142645799-142645821 GTAAAGTCTGAATAGACTTGGGG - Intergenic
940025958 2:149208679-149208701 GGTAAGTATGACTTTTCTAGAGG - Intronic
940640951 2:156343282-156343304 GGAAAGTATTAATATTTTTGTGG + Intergenic
941275694 2:163488047-163488069 GTAAAATTTGAATTTTATTGTGG - Intergenic
941551913 2:166927407-166927429 GGCAAGTCTGCATTTTTTTCTGG + Intronic
941891721 2:170589131-170589153 CTAAACCCTGAATTTTCTTGGGG - Intronic
942102439 2:172598256-172598278 AAAAAGTTTAAATTTTCTTGGGG - Intronic
942951221 2:181724032-181724054 GGAACATCTGGATCTTCTTGAGG + Intergenic
943172833 2:184425657-184425679 GGAAAGGTAGAATTTTCTTTTGG - Intergenic
943917436 2:193654339-193654361 GGAATCACTGAATTTTGTTGTGG + Intergenic
943940340 2:193986251-193986273 GGATAGTCTGAATTATCTGGTGG + Intergenic
945888522 2:215403332-215403354 GAAAAGTTTGTATTTTCTTTGGG + Intronic
946204277 2:218092259-218092281 GGAAGGTCTGAATTTTGTGCTGG - Intergenic
946572067 2:221035250-221035272 TGAAAGTCAGAATTCTCTAGTGG + Intergenic
947049786 2:226029626-226029648 GGGAAGTATGAATTTACTTCTGG + Intergenic
948057145 2:235017091-235017113 GCATAGTCTCAATTTTCTTTGGG - Intronic
1169480282 20:5973993-5974015 GCAGAGGCAGAATTTTCTTGGGG - Intronic
1171045566 20:21806964-21806986 AGAAAGTCTGCATTTGCATGGGG - Intergenic
1174500018 20:50977470-50977492 GTAAAGCCTGGATTTTATTGTGG - Intergenic
1175019431 20:55828645-55828667 TGAAATTCTGAATTTTTTTAAGG + Intergenic
1179321863 21:40300019-40300041 GCAAAGTAAGAATTGTCTTGAGG - Intronic
1183664125 22:39237571-39237593 GGAAAGAATGAACTTGCTTGAGG - Intronic
949624801 3:5853557-5853579 GGAAAGTCTGACTTCTGTTGTGG - Intergenic
950372425 3:12542422-12542444 GGTAAGTATGACTGTTCTTGTGG + Intronic
951529512 3:23685661-23685683 GGACAGTGGGAATTTTATTGTGG - Intergenic
952757120 3:36880507-36880529 GGAGAATCTAAATTTTCTTCAGG + Intronic
953086956 3:39678475-39678497 TGAAAATCTAAATTTTCTTCTGG + Intergenic
953511876 3:43549763-43549785 GGAAAGACTGCATTCACTTGTGG + Exonic
954503766 3:51048469-51048491 AGAAATTCTAAAGTTTCTTGGGG - Intronic
954852070 3:53611076-53611098 GCAAAGTCAGAACTTTCTTTTGG + Intronic
955581587 3:60428800-60428822 GGACAGTTAGAATTTTCTTACGG + Intronic
956618420 3:71196466-71196488 GGAAATTCTGATTTTTTTTGAGG - Intronic
957008723 3:74981113-74981135 GAAAAGTCTAGATTTTCATGGGG + Intergenic
957204001 3:77171076-77171098 GGACAATATGAATTTTCTAGAGG + Intronic
957385113 3:79486514-79486536 GAAAAGTAGGCATTTTCTTGGGG - Intronic
957449865 3:80366038-80366060 GAAAAGTCTGAATATTCCAGAGG + Intergenic
958008362 3:87842815-87842837 GGAAAATCTGTTTTTTCCTGGGG - Intergenic
958214259 3:90541892-90541914 GGAATGTTTGGACTTTCTTGAGG - Intergenic
958221115 3:90681195-90681217 GGAATATCTGGACTTTCTTGAGG - Intergenic
960022821 3:112974769-112974791 GGTAAGTTTGAATTCTCTTTGGG - Exonic
960385484 3:117017653-117017675 TGACAGTCTGGATTATCTTGGGG - Intronic
960422777 3:117468087-117468109 GGCAAGGCTGACATTTCTTGAGG - Intergenic
961109312 3:124270603-124270625 GGAACTTCTGACCTTTCTTGGGG + Intronic
963976919 3:151490803-151490825 GGAAAATAAGAAATTTCTTGAGG + Intergenic
965189259 3:165507093-165507115 GGAAAGTTTGAAAATTCTTAGGG - Intergenic
966872705 3:184301706-184301728 GATAATTCAGAATTTTCTTGTGG + Intronic
967662566 3:192130970-192130992 GGAAAATCTCAACTTTCATGGGG + Intergenic
968385775 4:136105-136127 GGAAAGATTAAATTTCCTTGAGG + Intronic
968414942 4:423678-423700 GGGAAGACTGAACTTTCTTCAGG + Intergenic
971435361 4:26616545-26616567 GGAAAGTATGAATATTCATTAGG + Intronic
973614138 4:52662265-52662287 GGAAAGTTTGGAATTTCTTAGGG + Intergenic
974986885 4:69038691-69038713 AGGAAGTCTGAATTTTCTGTAGG + Intronic
975054463 4:69912359-69912381 GGACAGTCTGAATTTCCTAACGG + Intergenic
976208355 4:82642894-82642916 GGAATGTCTGGATTTTGTTCAGG + Intronic
976866620 4:89735794-89735816 GGATACTCTGATTTCTCTTGAGG + Intronic
977021356 4:91764625-91764647 GGAAAGTTTGAACTTCCTAGAGG + Intergenic
977332337 4:95653202-95653224 TGACAGTCTGAATTTTCCTATGG + Intergenic
977810888 4:101354642-101354664 GGAACGACTGAATTTTATTCTGG + Intergenic
978963324 4:114710643-114710665 GGAAAATCAGAATTTACTTTAGG + Intergenic
979200148 4:117967926-117967948 GGCAGGTCTGAATTTTTTTGGGG - Intergenic
980663508 4:135898705-135898727 GGAAAGTTTGGAATTTTTTGAGG + Intergenic
980764067 4:137275752-137275774 GGAAAGCCTGAAACTTCATGTGG - Intergenic
981459997 4:145002251-145002273 GGAACTTCTGAAGTTTCTTTTGG - Intronic
982361277 4:154522066-154522088 GGAAAATGTGAAGTTCCTTGGGG + Intergenic
983078173 4:163351294-163351316 TGAACATCTGAATTTTCTTCAGG - Exonic
983247220 4:165301809-165301831 GGAAAGTCTGAAGATGCTAGAGG - Intronic
983673161 4:170261623-170261645 GGAAAGCCAGAATTTTCTTTAGG - Intergenic
983735797 4:171058358-171058380 GTAAAGTCTTAATTTTCATATGG - Intergenic
983766018 4:171485448-171485470 GGAAAGTATGAATATACTTAAGG - Intergenic
983790575 4:171792805-171792827 GGAAAGGCTGAACTGTGTTGTGG + Intergenic
984455601 4:179963757-179963779 GGAAATTTTAAATTTTGTTGTGG - Intergenic
985616997 5:928781-928803 GGAAAGTTTGGAATTTCTTAGGG + Intergenic
986188868 5:5474665-5474687 TGTAGGTCTTAATTTTCTTGTGG + Intronic
986384327 5:7216833-7216855 GGAAATTCAGAATATTCTGGGGG - Intergenic
987302121 5:16606373-16606395 GGAACGTGTGAAATTTCCTGGGG - Intronic
989792575 5:45423466-45423488 GGAAAGTCTAAGTGTTGTTGGGG - Intronic
990243095 5:53835475-53835497 GGAAAGTTTTATTTTTCTTATGG - Intergenic
990904446 5:60788817-60788839 GGAAAGTCTGAATTTTCTTGTGG - Intronic
991954727 5:71983236-71983258 TGAAAGTCCGAATTTTCTTGAGG - Intergenic
993752956 5:91692803-91692825 GGAAAGTTTGAAACTTCCTGAGG - Intergenic
994479838 5:100320771-100320793 GGAAAGTCAGAATTTTTAGGAGG - Intergenic
994657205 5:102608762-102608784 GAAATATCTGAATTTTCTCGTGG + Intergenic
994717408 5:103338351-103338373 TGAACGTATGAATTTTGTTGGGG - Intergenic
994840760 5:104922547-104922569 AGAAAGTTTGAAATTTCTTAGGG + Intergenic
995277498 5:110293763-110293785 GAAAAGTCTGAATCTTCTTAAGG + Intronic
995808409 5:116079464-116079486 GGAAGCTCTGAATTTTCCAGTGG + Intergenic
997763987 5:136480821-136480843 GGCATGGCTGAAATTTCTTGAGG + Intergenic
998209350 5:140182593-140182615 GGAAACTCAGATCTTTCTTGGGG + Intronic
998437408 5:142123858-142123880 GCTAAGCCTGAATTTTCTTATGG + Intronic
1000446222 5:161325010-161325032 GGATATCCTGAATTTTCATGTGG + Intronic
1000750760 5:165093822-165093844 CAGAAGTCTGCATTTTCTTGAGG - Intergenic
1004346436 6:14853657-14853679 GGAAGGTTTGTATTTTCTTAGGG - Intergenic
1005583452 6:27254017-27254039 GGCAAGGCTGACTTATCTTGAGG - Intronic
1005698978 6:28380790-28380812 GGAGATGCTGAATTTTGTTGGGG - Exonic
1005790791 6:29297657-29297679 GGACAGTCTGAAACTGCTTGTGG - Intergenic
1006432314 6:34005156-34005178 TGAAAGTCTTAGTTTTTTTGTGG + Intergenic
1007140659 6:39570219-39570241 AGAAAGTTAGAAGTTTCTTGTGG - Intronic
1008061004 6:46996897-46996919 GCAAAGTCTTAAGTCTCTTGGGG + Intergenic
1008250546 6:49234124-49234146 GGAAAGTCATAAGTTTCTTCAGG - Intergenic
1008885450 6:56427791-56427813 GTAAAGTCTGAAATTTAGTGGGG - Intergenic
1008990642 6:57597768-57597790 GGCAACTCTGAAGTGTCTTGCGG + Intronic
1009179214 6:60496314-60496336 GGCAACTCTGAAGTGTCTTGTGG + Intergenic
1009335769 6:62489512-62489534 GGAAAGTGTAAATTTTTTTATGG + Intergenic
1009672178 6:66770145-66770167 GGTAGGTCTGAATTTTGTTGGGG + Intergenic
1010777157 6:79900616-79900638 GGAAAATCGGAATTTTTTTCTGG + Intergenic
1011198466 6:84807438-84807460 AGAAATTCTGCATGTTCTTGTGG - Intergenic
1012423404 6:99089024-99089046 GGAAAACCTGACATTTCTTGTGG - Intergenic
1012485579 6:99718574-99718596 GGAAATTTTAAATTTTCTTGAGG - Intergenic
1014008839 6:116453356-116453378 GGACAATCTAAATTTTCTTCAGG + Intergenic
1014600946 6:123411480-123411502 GGAAAGTTTGGAATTTCTGGGGG + Intronic
1016300415 6:142624385-142624407 GGAAAGTGTAGCTTTTCTTGAGG + Intergenic
1016675727 6:146765481-146765503 GGATAGTTTGGATTTTATTGAGG - Intronic
1017798988 6:157875066-157875088 GGAAAAGATCAATTTTCTTGTGG + Exonic
1019065631 6:169294134-169294156 GGCAAATCAGTATTTTCTTGGGG - Intergenic
1019199007 6:170298653-170298675 GGTGAGTCTGAATTTTTTTTAGG + Intronic
1020493511 7:8818901-8818923 GGAAAGTCATAATTTTGTTTTGG + Intergenic
1020541338 7:9463269-9463291 GGCAAGTCTCACTTTTCTGGGGG - Intergenic
1020642674 7:10776116-10776138 GCAAACTCTGATTTTTCTTTTGG - Intergenic
1020997544 7:15281839-15281861 GGAATGGCAGAAGTTTCTTGAGG - Intronic
1021530959 7:21644493-21644515 GGAAAGTTAGAATTTTTTTATGG - Intronic
1021648083 7:22806416-22806438 AGAAAGATTGAAATTTCTTGTGG + Intergenic
1021917921 7:25454418-25454440 GTATAGTCTGAAGTTTCTTCTGG + Intergenic
1021999158 7:26208412-26208434 GGACAATCTAAATTTTCTTCAGG - Exonic
1022606798 7:31823412-31823434 GGAAATTCTGAATTTTCAGCAGG + Intronic
1023095463 7:36655680-36655702 GGAAAGTCAGAATTTCCATCAGG + Intronic
1023182072 7:37494907-37494929 TGCCACTCTGAATTTTCTTGGGG + Intergenic
1023424327 7:40019443-40019465 GGCAAGTCTGAAATTTGTAGGGG + Intronic
1028131540 7:87181232-87181254 TGAAATTCTGATTTTTATTGAGG + Intronic
1028830534 7:95322843-95322865 GGAAACTCAGAAATCTCTTGAGG + Intronic
1030734667 7:113032952-113032974 GAAAAGTTTGAGCTTTCTTGAGG + Intergenic
1030940304 7:115638686-115638708 GGAAAATGTGAACATTCTTGTGG + Intergenic
1031065869 7:117105012-117105034 GGAAAAGAGGAATTTTCTTGAGG + Intronic
1031443969 7:121828313-121828335 GGTAACTCTGAATTATCTGGTGG - Intergenic
1031698275 7:124888717-124888739 GGAAAGTCTGAAGTATTGTGAGG - Intronic
1033910617 7:146259399-146259421 GGAAGGTCAGAATTTCCTAGAGG + Intronic
1034365277 7:150540937-150540959 GGAAAGTTTGAAACTTCTTAGGG - Intergenic
1035430573 7:158817345-158817367 GGAATGTCTGGATTACCTTGTGG - Intronic
1037474594 8:19244275-19244297 GGGAAGCCTGAATTCTCATGGGG - Intergenic
1038130411 8:24724274-24724296 GGACAGGCTGACTTTTGTTGGGG + Intergenic
1039234355 8:35485731-35485753 GCAAAGTGTTAATTTTCCTGAGG + Intronic
1039466834 8:37790557-37790579 GGAATGTCTGAATTATGCTGAGG + Intronic
1040374212 8:46807462-46807484 GAAATTTCTGAAATTTCTTGTGG - Intergenic
1041895990 8:62925339-62925361 GGGAAGTTTAAATTTTCTTAGGG - Intronic
1043276792 8:78407162-78407184 AGAAATTATGACTTTTCTTGTGG - Intergenic
1043370076 8:79581144-79581166 GGAAAGACTGTTTTTTGTTGTGG - Intergenic
1043432206 8:80206000-80206022 GGTAAGTCTGATGTTTCTTCAGG - Intronic
1044496686 8:92895523-92895545 GGAAAGTCTGAATCTTCTTAGGG + Intronic
1045264226 8:100605297-100605319 GGAAGGTAGGAATTTTCTTCTGG + Intronic
1045314416 8:101030615-101030637 GGGAAGTCTGAATTTCCTGGAGG + Intergenic
1045710587 8:104978810-104978832 GGAAAGTCTGGCTTTTCCTATGG + Intronic
1049031307 8:140040063-140040085 GGAGAGTCTCAAATTTCTTAAGG - Intronic
1049133930 8:140876422-140876444 GAAAAGTCTGAATTTTTCTCTGG + Intronic
1055025954 9:71721506-71721528 GGAAAGTCTAGTTTGTCTTGAGG - Intronic
1055989266 9:82088018-82088040 GTAAAGTCTGACGTTTCTTGGGG + Intergenic
1058015498 9:100027815-100027837 GGAAAGTCTTATTGTTCTTCTGG + Intronic
1058331674 9:103769236-103769258 GGAAAGCCTGAAGGTTCCTGAGG + Intergenic
1059117577 9:111613437-111613459 GGAATGAATTAATTTTCTTGTGG + Intergenic
1186498782 X:10033907-10033929 CCAAAGTCTGCATTTTCTTAAGG + Intronic
1187475681 X:19608782-19608804 GTAAAGTATGATTTTTCTTCTGG - Intronic
1187818805 X:23262849-23262871 GAAAAATTTGAATGTTCTTGAGG + Intergenic
1188092977 X:25986230-25986252 GGCAAGTCTGTATTTCCTTCTGG - Intergenic
1191908144 X:66117880-66117902 GAATAGTCTGAATTTTCTCAAGG + Intergenic
1192715529 X:73637840-73637862 GCAATGTCTGAACTTTCTTGTGG + Intronic
1192890481 X:75385255-75385277 GGAGAGTCTGAATTCTGATGAGG + Intronic
1195334449 X:103836627-103836649 GAAAAGGCTGAGTTCTCTTGCGG - Intergenic
1196142952 X:112285434-112285456 GGAAACTCTGAATATTCTAAGGG - Intergenic
1196201184 X:112887479-112887501 GCAAAGTCTGAACTTTCTGCCGG + Intergenic
1197960752 X:132003634-132003656 TGAAAGTTTGAATTTTCTTTAGG + Intergenic
1198849786 X:140954080-140954102 GTAAAGTGTGACTTTTCTTGTGG + Intergenic
1200951743 Y:8904487-8904509 TTAAACTCTGATTTTTCTTGAGG + Intergenic
1201374064 Y:13296846-13296868 GGAAAGTTTGGAGCTTCTTGGGG - Intronic