ID: 990905177

View in Genome Browser
Species Human (GRCh38)
Location 5:60795614-60795636
Sequence CGGCATTCAGCCCTGGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 219
Summary {0: 1, 1: 0, 2: 5, 3: 25, 4: 188}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990905177_990905182 13 Left 990905177 5:60795614-60795636 CCATCCACCAGGGCTGAATGCCG 0: 1
1: 0
2: 5
3: 25
4: 188
Right 990905182 5:60795650-60795672 GCCACTGACTTCCAACCCTCCGG 0: 1
1: 40
2: 90
3: 107
4: 229
990905177_990905185 23 Left 990905177 5:60795614-60795636 CCATCCACCAGGGCTGAATGCCG 0: 1
1: 0
2: 5
3: 25
4: 188
Right 990905185 5:60795660-60795682 TCCAACCCTCCGGATCCGGCAGG No data
990905177_990905187 24 Left 990905177 5:60795614-60795636 CCATCCACCAGGGCTGAATGCCG 0: 1
1: 0
2: 5
3: 25
4: 188
Right 990905187 5:60795661-60795683 CCAACCCTCCGGATCCGGCAGGG 0: 2
1: 32
2: 135
3: 192
4: 131
990905177_990905184 19 Left 990905177 5:60795614-60795636 CCATCCACCAGGGCTGAATGCCG 0: 1
1: 0
2: 5
3: 25
4: 188
Right 990905184 5:60795656-60795678 GACTTCCAACCCTCCGGATCCGG 0: 1
1: 57
2: 143
3: 84
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990905177 Original CRISPR CGGCATTCAGCCCTGGTGGA TGG (reversed) Intronic
907506075 1:54919145-54919167 CGGCAAACAGCAGTGGTGGACGG + Intergenic
907602277 1:55783545-55783567 CGGCAAACAGCAGTGGTGGATGG + Intergenic
908723227 1:67148228-67148250 CGGCAATCAGCAGTAGTGGACGG + Intronic
915338980 1:155166163-155166185 TGGCTTTCAGCCCTGGGGGTGGG + Intergenic
916197544 1:162238519-162238541 ATGCATTCAGCCCTAATGGAGGG - Intronic
917097538 1:171414075-171414097 CGGCATTCAGCAGTGGTGGACGG + Intergenic
920180844 1:204130958-204130980 CAGCATGAAGCCCAGGTGGAGGG + Intergenic
920639855 1:207741518-207741540 CGGCAAACAGCAGTGGTGGACGG + Intergenic
921350490 1:214229833-214229855 TGGCAGCCAGCCCTGGTGGCGGG + Intergenic
922876304 1:228942512-228942534 CGGCAAACAGCAGTGGTGGACGG - Intergenic
922877767 1:228953890-228953912 CGGCAAACAGCAGTGGTGGATGG - Intergenic
924282464 1:242452049-242452071 TGCCATTCAGCCCTGTTGGGAGG - Intronic
1065624335 10:27615069-27615091 CTGAATGCAGCCCTGGGGGATGG - Intergenic
1065960879 10:30732975-30732997 TGGCATTCAGGACTGGTGGCGGG + Intergenic
1066246839 10:33591964-33591986 CGGCAGACAGCAGTGGTGGACGG + Intergenic
1068791298 10:61034052-61034074 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1068792074 10:61039517-61039539 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1070554147 10:77515192-77515214 CTGCATTCAGCACCGGGGGATGG + Intronic
1071326730 10:84525734-84525756 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1071331542 10:84565570-84565592 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1071556992 10:86612081-86612103 CGGCAAACAGCCGTGGTGGACGG - Intergenic
1071966269 10:90856517-90856539 AGCCATTCAGACCTGGAGGAAGG + Intronic
1072708839 10:97702234-97702256 TGGATTTCAGCCCTGGGGGAAGG + Intergenic
1072741957 10:97915003-97915025 CGGCCTTCAGCACTGCGGGAGGG - Intronic
1074832792 10:117261583-117261605 AGGCATCCAGCCCTGGGGAATGG + Intronic
1074978467 10:118599889-118599911 CGGCAATCAGCAGTGGTGGACGG + Intergenic
1075728122 10:124620978-124621000 CCCCATTCAGGCCTGGTGGCAGG - Exonic
1075740366 10:124692186-124692208 GGGCACTGAGCCCTGGTGCAGGG + Intronic
1076424293 10:130356594-130356616 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1082851178 11:57766236-57766258 CTGCTTTCAGCCCTGGTTGGAGG + Intronic
1083969120 11:66061905-66061927 TGGCAATCAGCCATGGGGGAGGG - Exonic
1084878722 11:72154300-72154322 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1085444269 11:76590107-76590129 CGGCAGTCAGCCCTGGAGCACGG + Intergenic
1085798697 11:79567041-79567063 CGGCCTTCAGCCCCGGAGGCAGG - Intergenic
1087901304 11:103644892-103644914 CGGCGTTCAGCAGTGGTGGACGG + Intergenic
1092074430 12:5661534-5661556 AGGCCTTCAGCCCAGGAGGATGG + Intronic
1095284196 12:40389168-40389190 TGGCATTCAGCAGTGGTTGATGG - Intergenic
1096351238 12:50902861-50902883 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1098848655 12:75568400-75568422 AGACATTCAGCTGTGGTGGAAGG - Intergenic
1102579856 12:113879508-113879530 AGTCATCCAGCCCTGGTGGGAGG - Intronic
1103614286 12:122142321-122142343 CAGCACCCAGCCCTTGTGGATGG + Exonic
1103872345 12:124100842-124100864 CGGCAATCAGCAGTGGTGGATGG + Intronic
1103873182 12:124106016-124106038 CGGCGATCAGCAGTGGTGGAGGG + Intronic
1104396035 12:128434052-128434074 TGGCATCCAGCTCTTGTGGATGG - Intronic
1104851969 12:131880556-131880578 TGGCATTCAGCAGTGGTGGACGG + Intergenic
1104991305 12:132625257-132625279 CGGCGTTCAGGCCTGCAGGATGG - Intronic
1108041039 13:46339509-46339531 CGGAATTCAAACCTGCTGGAAGG - Intergenic
1109523589 13:63545146-63545168 CGGCCAACAGCACTGGTGGATGG + Intergenic
1109680720 13:65748471-65748493 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1110510127 13:76340978-76341000 GGGCTTTCAGACCTTGTGGAGGG - Intergenic
1111820395 13:93206892-93206914 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1119089946 14:71772217-71772239 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1119418533 14:74492874-74492896 CTGTATCCAGCTCTGGTGGAGGG - Intronic
1120163696 14:81171888-81171910 GGGCAGTCAGTCCTGGGGGACGG - Intergenic
1122393684 14:101407821-101407843 CTGCATGCAGGCATGGTGGATGG - Intergenic
1122826636 14:104373935-104373957 CGCCTTCCAGCCCTGGGGGACGG + Intergenic
1123720811 15:23060616-23060638 GGGCTTTCACCCCTGGTGGAAGG + Intergenic
1126728345 15:51655636-51655658 CGGCAAACAGCAATGGTGGACGG + Intergenic
1127535532 15:59886601-59886623 TGGCTTTCAGCCCTGGTGGGAGG + Intergenic
1129229391 15:74188463-74188485 CTGCACTCTGCCCTGCTGGATGG + Intronic
1129305172 15:74655547-74655569 CAGCATTCTGCCATGGTGGAGGG - Intronic
1129685998 15:77686416-77686438 CAGCATGCAGGCCTGGGGGAAGG + Intronic
1129776379 15:78239329-78239351 CGGCAAACAGCAGTGGTGGACGG + Intronic
1131673844 15:94651138-94651160 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1133061161 16:3175297-3175319 GGGCATCCAGCCCCGTTGGAGGG - Intergenic
1134346072 16:13393069-13393091 AGGCTTTCAGGCCTGGGGGAAGG + Intergenic
1142278320 16:89134499-89134521 CGGCAAGCAGCAGTGGTGGACGG + Intronic
1142958517 17:3536744-3536766 AGGTATTCAGCCCTGGCGGTGGG + Intronic
1144585537 17:16485410-16485432 CTGCATTCTGGCATGGTGGAAGG - Intronic
1147758909 17:42785086-42785108 CGGCTTTCTGCCCTGGGGAAGGG - Exonic
1148371996 17:47106761-47106783 CGGCAAACAGCACTGGTGGACGG + Intergenic
1149243112 17:54673775-54673797 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1151745043 17:76007424-76007446 GGGCATCCAGCCCTTCTGGACGG + Exonic
1153402050 18:4692000-4692022 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1157259332 18:46165103-46165125 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1158152293 18:54386967-54386989 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1159953849 18:74505951-74505973 CAGCCTGCAGCCCTGGAGGACGG + Exonic
1160102769 18:75938543-75938565 CGGCAAACAGCAATGGTGGACGG + Intergenic
1160562229 18:79765762-79765784 CTGCCTTCAGCCCTGGTGTTGGG + Intergenic
1161129461 19:2579497-2579519 CGGCACACAGCCCTGGAGGCTGG + Intronic
1168140192 19:54380722-54380744 AGGCTTTCAGTCATGGTGGAAGG - Intergenic
1168147019 19:54425248-54425270 CGGCAAACAGCAGTGGTGGACGG + Intronic
924973622 2:153902-153924 CGACAAACAGCACTGGTGGACGG + Intergenic
924974508 2:160386-160408 CGACAAACAGCCGTGGTGGATGG + Intergenic
925249145 2:2415601-2415623 TGGCAGTCAGCACTGGTGAAAGG + Intergenic
928347674 2:30516323-30516345 CGACGTTCAGCAGTGGTGGACGG - Intronic
928348185 2:30519878-30519900 TGGCATTCAGCAGTGGTGGATGG - Intronic
928440099 2:31285090-31285112 CGGCAATCAGCAGTGGTGGACGG - Intergenic
929288019 2:40157612-40157634 CACCATTCTGCCCTGGTAGAAGG + Intronic
929542353 2:42832094-42832116 CGGCAAACAGCAGTGGTGGACGG - Intergenic
931038980 2:58275750-58275772 CGGCAAACAGCAGTGGTGGACGG - Intergenic
932781229 2:74560006-74560028 CAGGATCCACCCCTGGTGGAGGG - Intronic
932917171 2:75872053-75872075 CGGCAAACAGCAGTGGTGGATGG - Intergenic
934777722 2:96949708-96949730 CTGGATTCAGCCATGGGGGATGG + Intronic
935243055 2:101194589-101194611 CTGCTTTCAGCCCTCATGGAGGG + Intronic
936529423 2:113265465-113265487 CAGCAGTCAGCCCTGAGGGAAGG - Intronic
937594968 2:123661568-123661590 CGGCAAACAGCTGTGGTGGACGG - Intergenic
939134088 2:138273520-138273542 CGGCAAACAGCAGTGGTGGACGG + Intergenic
940885817 2:158988520-158988542 CGGCATTTAGCAAAGGTGGAGGG - Intronic
943019252 2:182552900-182552922 CGGCAAACAGCTGTGGTGGATGG - Intergenic
944172994 2:196799833-196799855 CGTCTTTCAGCCCTCGTTGAAGG + Intergenic
948087529 2:235263983-235264005 TGTCACACAGCCCTGGTGGATGG - Intergenic
1169081115 20:2798275-2798297 CTGCAGTCAGGCCTGGAGGACGG - Exonic
1171500797 20:25591493-25591515 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1172947191 20:38698744-38698766 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1177359363 21:20048656-20048678 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1177895730 21:26854808-26854830 CGGCAAACAGCAGTGGTGGAAGG - Intergenic
1177896702 21:26861644-26861666 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1180747526 22:18100958-18100980 CGGCATTCATTCCTGTTGTATGG - Exonic
1181019097 22:20089079-20089101 CAGCAGTCAGGCCTGGTGGCAGG + Intronic
1184981698 22:48100095-48100117 GGGCATATTGCCCTGGTGGAGGG - Intergenic
950725059 3:14911933-14911955 CCGAGTTCAGCCCTGGAGGAAGG + Intronic
956061743 3:65355370-65355392 AGGCAATGAGCCTTGGTGGAAGG - Intronic
959798534 3:110462287-110462309 CTGCATTCTGACATGGTGGAAGG + Intergenic
959885721 3:111497404-111497426 TGGCGTTCAGCCATGGTGGATGG + Intronic
960006990 3:112790777-112790799 CGGCAAACAGCAGTGGTGGATGG + Intronic
961752612 3:129106025-129106047 CAGCTTTCAGCCCTGCTGCACGG - Intronic
962427028 3:135279304-135279326 TTGCATTATGCCCTGGTGGACGG - Intergenic
962712494 3:138099790-138099812 CTGCTTTCACTCCTGGTGGAAGG - Intronic
963255679 3:143142484-143142506 CGGCGTTCAGCAGTGGTGGATGG - Intergenic
966584804 3:181610542-181610564 CTACAGTCAGCCCTGGTGCAAGG - Intergenic
966994303 3:185265012-185265034 CGGCACTCAGCAGTGGTGGATGG - Intronic
969162615 4:5274794-5274816 CGGCAAACAGCAGTGGTGGACGG - Intronic
969656027 4:8499073-8499095 TGGCCTTCAGCCCAGGAGGAGGG + Intergenic
972766775 4:42158571-42158593 CGGCAAACAGCAGTGGTGGACGG + Intergenic
973723378 4:53748274-53748296 CTGAATTCAGCCTTGGAGGAGGG - Intronic
974563053 4:63546791-63546813 TGGAATTCAGGCCTGGTGGAAGG - Intergenic
975313230 4:72926028-72926050 CGGCAAACAGCAGTGGTGGACGG + Intergenic
976190167 4:82479711-82479733 CAGCAATCAGCAGTGGTGGATGG - Intergenic
977251317 4:94692625-94692647 CGGCAAACAGCAGTGGTGGACGG - Intergenic
977556174 4:98489576-98489598 CGGCAATCAGCAGTGGTGGACGG - Intronic
980625711 4:135372297-135372319 CGGCAAACAGCAGTGGTGGATGG - Intergenic
981033544 4:140150388-140150410 CTGGTTTCCGCCCTGGTGGAGGG - Intronic
983667444 4:170196968-170196990 CGGCAAACAGCAGTGGTGGATGG + Intergenic
984925414 4:184802351-184802373 CGGCAGTCAGCCCGGGGGGGTGG + Intronic
985666976 5:1186437-1186459 CGGCCTCCTGCCCTGGTGGGTGG + Intergenic
987458633 5:18178158-18178180 AGTCATTTAGTCCTGGTGGAGGG + Intergenic
987855123 5:23411299-23411321 CGGCGATCAGCAGTGGTGGACGG - Intergenic
987934919 5:24451359-24451381 CAGCATTCAGCAGTGATGGACGG + Intergenic
988740545 5:34064672-34064694 CGGCAAACAGCAGTGGTGGATGG + Intronic
988957400 5:36332981-36333003 CGGCAAACAGCAGTGGTGGATGG + Intergenic
990905177 5:60795614-60795636 CGGCATTCAGCCCTGGTGGATGG - Intronic
992293493 5:75304574-75304596 CGGCAAACAGCAGTGGTGGATGG - Intergenic
993622826 5:90188273-90188295 CGGCGTTCAGCAGTGGTGGACGG + Intergenic
1002784115 6:388533-388555 CGGGATTCAGCCCAAGTGTAGGG - Intergenic
1005324148 6:24682705-24682727 CGGCAAACAGCAGTGGTGGATGG + Intronic
1006370405 6:33640629-33640651 CTGCATTCAGCCCCAGTGGCTGG + Intronic
1006409048 6:33861705-33861727 CGGCATTCAGCTCTGGATGGAGG + Intergenic
1007407759 6:41644626-41644648 GGGCATGCAGGCCTGGGGGATGG - Intronic
1008582777 6:52921518-52921540 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1009820704 6:68797474-68797496 CGCCATCCAGCCCAGGTGGAGGG + Intronic
1013021753 6:106228254-106228276 CGGCAAACAGCAGTGGTGGATGG - Intronic
1013231210 6:108163912-108163934 CCCCATTCAGCCCTGGCGAAAGG - Intronic
1013752577 6:113424217-113424239 TGGCATATAGGCCTGGTGGAAGG - Intergenic
1014208910 6:118687752-118687774 CGGCAAACAGCAGTGGTGGACGG - Intronic
1019064664 6:169287198-169287220 CGGCATTCCACCCTGCAGGAGGG + Intergenic
1021588477 7:22235773-22235795 CCACATTCAGCCCTGGGAGATGG + Intronic
1021885344 7:25131953-25131975 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1022117652 7:27276465-27276487 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1022766863 7:33423013-33423035 CGGCATTCAGTTCTGATAGAAGG - Intronic
1022989913 7:35696639-35696661 CGGCAGACAGCAGTGGTGGACGG - Intergenic
1023282935 7:38590385-38590407 CGGCATTCAGCAGTGGTGGATGG + Intronic
1026346967 7:69482805-69482827 CGGCAAACAGCGGTGGTGGACGG - Intergenic
1028013983 7:85684105-85684127 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1028587731 7:92468311-92468333 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1028993385 7:97074790-97074812 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1031009694 7:116513005-116513027 CGGCATACAGGGCTGGGGGAGGG - Intergenic
1031250879 7:119378956-119378978 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1031299569 7:120047464-120047486 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1032425796 7:131821204-131821226 CGGCATTCAGCAGTGGTGGAGGG + Intergenic
1034248764 7:149671695-149671717 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1034249490 7:149676815-149676837 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1034280530 7:149850829-149850851 GGGCATTGAGCCATGATGGAGGG + Intronic
1034650848 7:152688867-152688889 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1034965015 7:155385412-155385434 CGGCAAACAGCAGTGGTGGACGG + Intronic
1035672620 8:1431903-1431925 CAGGGTTCAGCCCTGATGGATGG - Intergenic
1035672638 8:1431968-1431990 CAGGATTCAGCCCCGATGGATGG - Intergenic
1036463043 8:8971217-8971239 CGGCATGCAGCCCTGCAGAAGGG - Intergenic
1036654048 8:10664127-10664149 CAGCAATCATCCCTGCTGGATGG + Intronic
1037570601 8:20154834-20154856 CAGCGCTCAGCCGTGGTGGACGG - Intronic
1039604321 8:38868084-38868106 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1044731535 8:95232297-95232319 TGGCATTCAGCCCTTATGGTAGG + Intergenic
1045788640 8:105955560-105955582 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1047282891 8:123461141-123461163 CAGCCTTCAGCCCTGATGGGTGG + Intronic
1049015110 8:139914506-139914528 GGGCATCCAGCCCAGGTGGTGGG - Intronic
1049325453 8:142019254-142019276 AGACATCCGGCCCTGGTGGAAGG + Intergenic
1055336036 9:75234548-75234570 CTGCATTCTGACATGGTGGAAGG - Intergenic
1060307840 9:122432578-122432600 AGGCATACAGTCATGGTGGAAGG + Intergenic
1185560908 X:1060072-1060094 CGGCGTTCAGCAGTGGTGGACGG - Intergenic
1186436787 X:9549975-9549997 CAGCCTTCAGCCCAGGAGGATGG + Intronic
1186701711 X:12097274-12097296 CTGCATTCAGGCCTGCTGAATGG + Intergenic
1187202025 X:17144311-17144333 CAGCATTCTGCCCTGGTGGCAGG + Intronic
1188970563 X:36610309-36610331 TGGGGTTCAGCCCTGGAGGAGGG + Intergenic
1189239930 X:39517140-39517162 TGGCAAGCAGCCCAGGTGGAAGG + Intergenic
1191167488 X:57405562-57405584 CGGCAAACAGCAGTGGTGGATGG + Intronic
1192210338 X:69123771-69123793 AGGTATGCAGCCCTGGTGGAGGG + Intergenic
1195259091 X:103115404-103115426 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1196287281 X:113897473-113897495 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1196709889 X:118751971-118751993 CCGCACTCCTCCCTGGTGGAAGG + Intronic
1197740413 X:129888206-129888228 AGGCATTCAGCCCTCGAGGAGGG + Intergenic
1197999720 X:132420349-132420371 CGGCAAACAGCAGTGGTGGATGG + Intronic
1198605383 X:138331690-138331712 CAGCAATCAGCCTTGGTGAATGG + Intergenic
1198862282 X:141084178-141084200 CGGCCTTCGGCGTTGGTGGACGG - Intergenic
1198862288 X:141084202-141084224 CGGCCTTCGGCGGTGGTGGACGG - Intergenic
1198862295 X:141084226-141084248 CGGCCTTCGGCGGTGGTGGACGG - Intergenic
1198862302 X:141084250-141084272 CGGCCTTCGGCGTTGGTGGACGG - Intergenic
1198862308 X:141084274-141084296 CGGCCTTCGGCGGTGGTGGACGG - Intergenic
1198862326 X:141084345-141084367 CGGCGTTCAGCGGTGGTGGACGG - Intergenic
1198900368 X:141503041-141503063 CGGCGTTCAGCGGTGGTGGACGG + Intergenic
1198900382 X:141503098-141503120 CGGCCTTCGGCGGTGGTGGACGG + Intergenic
1198900388 X:141503122-141503144 CGGCCTTCGGCGTTGGTGGACGG + Intergenic
1198900395 X:141503146-141503168 CGGCCTTCGGCGGTGGTGGACGG + Intergenic
1198900402 X:141503170-141503192 CGGCCTTCGGCGGTGGTGGACGG + Intergenic
1198900408 X:141503194-141503216 CGGCCTTCGGCGTTGGTGGACGG + Intergenic
1199419215 X:147624076-147624098 GAGGATTCAGCCCTAGTGGAAGG - Intergenic
1199536297 X:148906769-148906791 CGGCATTCAGCAGTGGTGGACGG - Intronic
1201255134 Y:12099985-12100007 TGGCATTCTCCCATGGTGGAAGG + Intergenic
1201329227 Y:12800001-12800023 CGGCATTCAGCAGTGGTGGAAGG - Intronic
1201724349 Y:17136736-17136758 TAGCATTCAGCAGTGGTGGATGG + Intergenic