ID: 990905266

View in Genome Browser
Species Human (GRCh38)
Location 5:60796184-60796206
Sequence AGTGAGAAAACAGATGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 757
Summary {0: 1, 1: 0, 2: 3, 3: 49, 4: 704}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990905266 Original CRISPR AGTGAGAAAACAGATGAGGA AGG (reversed) Intronic
900969496 1:5981961-5981983 ACTCAGAAAATAGAGGAGGAGGG - Intronic
901140653 1:7027136-7027158 GGTGGGAAAACAGTTGAAGAAGG + Intronic
901465852 1:9420592-9420614 AGAGAAGAAACAGATGAAGAAGG - Intergenic
902264407 1:15251644-15251666 AGTGAGAAATCAGAAGAGGGGGG - Intronic
902299726 1:15493444-15493466 AGTGAGGAAACAGATAGGGAAGG - Intronic
902665175 1:17932634-17932656 AGTGAGATAAGAGGTGTGGAAGG - Intergenic
902767423 1:18626680-18626702 AAAGAGAAAACAGAAAAGGAAGG + Intergenic
902767430 1:18626729-18626751 AAAGAGAAAACAGAAAAGGAAGG + Intergenic
903017683 1:20371867-20371889 AGGGAGGGAGCAGATGAGGAGGG + Intergenic
903617017 1:24667209-24667231 AGATAGAAAACAGATTAGGGTGG + Intronic
903731603 1:25500420-25500442 AGGGAGAAAACAAATGAGAATGG - Intergenic
904591772 1:31619004-31619026 AGTGGGAAAAGAGAGAAGGAAGG - Exonic
905868268 1:41388052-41388074 AGTGAGAAATGAAATGTGGATGG + Intergenic
905930459 1:41783258-41783280 AGTGAGAAGCCACAGGAGGAAGG + Intronic
906088420 1:43156457-43156479 TGTGAGAAATCAGATAAAGATGG + Intergenic
906459525 1:46026719-46026741 AGTGAGGGAACAGAAGAGGCTGG + Intronic
906810009 1:48817098-48817120 ACTGGGAAAAAAAATGAGGAGGG + Intronic
906968633 1:50486120-50486142 AGTGGGAAAACAGAAGAACATGG - Intronic
907249261 1:53127272-53127294 AGTGAGAAATCAGATGAAAGGGG + Intronic
907973188 1:59404756-59404778 GGTGAGAAGTTAGATGAGGAGGG + Intronic
908312878 1:62903081-62903103 AGGGAGAAAGCAAATGAAGATGG - Intergenic
908643678 1:66253309-66253331 AGTGAGAAAACAGAGAAAGGTGG + Intronic
908685172 1:66709626-66709648 AGTGAGAATACAGAGGAAAAAGG - Intronic
908731782 1:67233403-67233425 AGTGTGAAAACAGACTAGTACGG + Intronic
909786364 1:79618927-79618949 AGGGAGAAAAGAGAGAAGGATGG - Intergenic
909805636 1:79871464-79871486 AGTAAGGAAACAGAAGAGGAAGG - Intergenic
910470153 1:87544277-87544299 ACTATGAAAACAGATGAAGAAGG - Intergenic
910654132 1:89602964-89602986 AGTGAGAAGAGTGAGGAGGAGGG + Intergenic
911620379 1:100060516-100060538 AGTGAGGTGAGAGATGAGGATGG - Intronic
911669925 1:100596301-100596323 AGTCAGAGAACAGATGAGAAGGG - Intergenic
912193643 1:107371711-107371733 AGCCAGAAAACTGAAGAGGAGGG + Intronic
912708318 1:111931251-111931273 ACTGGGAGAAGAGATGAGGAGGG + Intronic
912781234 1:112550297-112550319 ACTCAGAAAATAAATGAGGAAGG - Intronic
912782306 1:112562542-112562564 AAGGAGACAACAGATGAGCAGGG + Intronic
913546752 1:119876505-119876527 CTTCAGAAAACAGATGAGGAAGG + Intergenic
913593795 1:120354321-120354343 AGTGATAAAACAAGTAAGGATGG + Intergenic
914001762 1:143700271-143700293 AGTGATAAAACAAGTAAGGATGG - Intergenic
914093460 1:144524665-144524687 AGTGATAAAACAAGTAAGGATGG - Intergenic
914305068 1:146409237-146409259 AGTGATAAAACAAGTAAGGATGG + Intergenic
914514041 1:148358470-148358492 AGTGAAAGAACAGATTTGGAAGG - Intergenic
914596990 1:149163585-149163607 AGTGATAAAACAAGTAAGGATGG - Intergenic
915015986 1:152734317-152734339 AGAGAGAAAAGAAAAGAGGAAGG - Intergenic
915274277 1:154777233-154777255 ACCGAGAACACAGATGAGGCAGG - Intronic
915473473 1:156139054-156139076 AGAGAGAAAACAGAGGAGAGAGG - Intronic
915906538 1:159882174-159882196 AGTGAGCAAAGAAATGAGTATGG - Intronic
916206505 1:162320473-162320495 CTTGAGAAAAGAGAAGAGGAAGG + Intronic
916325393 1:163552685-163552707 TTTTAGAAAACAGAAGAGGAGGG - Intergenic
916341509 1:163741433-163741455 TCTGAAAAAACAGAGGAGGAGGG - Intergenic
916519807 1:165553514-165553536 GGAGAGAAAACAAATGAAGAAGG + Intronic
916610864 1:166390180-166390202 GATGAGAAAATGGATGAGGAGGG - Intergenic
916628146 1:166582177-166582199 AGTGGGGAAGCAGATCAGGAAGG - Intergenic
916673342 1:167044749-167044771 GGTGAGAAAGCAGCTGAGGACGG - Intergenic
917147943 1:171912597-171912619 AGGGAGACAAAAGAAGAGGAAGG + Intronic
917186555 1:172362961-172362983 AGTTAAAAAAAAGGTGAGGAGGG - Intronic
918008883 1:180567889-180567911 AGTGAGAAAAAAGTTGGGGGTGG - Intergenic
918202950 1:182284283-182284305 AGTGAAAGAATAGTTGAGGAGGG + Intergenic
918395432 1:184109573-184109595 GGTGAGAAAACAGAGTAGAAGGG + Intergenic
918861265 1:189829578-189829600 TGTCAGAAAACAGATGACTATGG - Intergenic
919799263 1:201343340-201343362 AGTGAGGCAAGAGAGGAGGAAGG + Intergenic
919977344 1:202621259-202621281 AAGGAGAAAACAAATGAGGGGGG + Intronic
920044008 1:203121802-203121824 AGTGGGAACAGAGATGAAGATGG - Intronic
920671198 1:208004775-208004797 AGTGAGAAAAGAGAAATGGAGGG - Intergenic
921290985 1:213657255-213657277 AGTGTAAAAAAAGATAAGGAAGG + Intergenic
921319086 1:213919767-213919789 AGCGAGTAAAGAGATGAAGAGGG + Intergenic
921799053 1:219380848-219380870 AGTGAGAAAACAAATGGGAGAGG + Intergenic
922362948 1:224839758-224839780 AGGGAGAAAGCTGATGAGAAGGG - Intergenic
923211984 1:231811710-231811732 AGTGAGAAAGCACATGGTGAGGG - Intronic
923508449 1:234627442-234627464 AGAGAGAAAACCGAAGAGCAGGG - Intergenic
923611467 1:235499299-235499321 AGTGACAAAACAGAGCATGAAGG + Intronic
924401100 1:243683221-243683243 AATGAGAAAACATATGTGAAAGG + Intronic
924791420 1:247253402-247253424 AGAGAGAAAACAAGTGAGGGAGG - Intergenic
1063359832 10:5443481-5443503 TATGAGAAAACTGAAGAGGATGG + Intronic
1063384674 10:5608669-5608691 AGTGAGTGATCAGCTGAGGAAGG + Intergenic
1064138498 10:12770856-12770878 AGCAAGAAAAAAGATGAGGTTGG + Intronic
1064226775 10:13493159-13493181 TGTGAGAAAACACCTGAGCATGG + Intronic
1064591088 10:16891439-16891461 AGAGAGAAAACCAAGGAGGAAGG + Intronic
1064933796 10:20657274-20657296 TGTGAGAATGCAGATCAGGAAGG + Intergenic
1065038651 10:21666743-21666765 ACTGTGAAAAGAGATAAGGAAGG - Intronic
1065785100 10:29205453-29205475 AGTGAAAAAACAGCTGGGCATGG - Intergenic
1066110289 10:32189518-32189540 AATGACAAAACAGACAAGGAAGG + Intergenic
1066458768 10:35595342-35595364 AGGGAGAAAAGAGGAGAGGAAGG - Intergenic
1067281856 10:44879319-44879341 AGTGACAAGACAGAGGAGAAGGG - Intergenic
1067298607 10:44990444-44990466 AGTGACAAGACAGAGGAGAAGGG + Intronic
1067484248 10:46632144-46632166 AGTGAGAAAAAAAATGAGACAGG - Intergenic
1068485683 10:57655482-57655504 AGTCAGAAAAGATGTGAGGATGG + Intergenic
1069195013 10:65540947-65540969 AGTGAGAGAACAGAAGGTGAGGG - Intergenic
1069272694 10:66549464-66549486 AAATAGAAAACAGATGAGAAAGG - Intronic
1069820403 10:71224057-71224079 AGTGAGCCACCAGCTGAGGATGG - Intronic
1070058331 10:72956284-72956306 GGTGAGAAAACTGATGCAGAGGG + Intergenic
1070260669 10:74851956-74851978 AGTCCCAGAACAGATGAGGAGGG - Intronic
1070607284 10:77907846-77907868 AGTGAGGAAACAGGTAAGGAAGG - Intronic
1070803528 10:79257123-79257145 TGTGAATAAACAGGTGAGGACGG - Intronic
1070998235 10:80805591-80805613 GGTGAGAAAAGAGAGAAGGAGGG - Intergenic
1071455960 10:85851881-85851903 AGGGAGAAAAAAATTGAGGATGG - Intronic
1071625921 10:87169761-87169783 AGTGAGAAAAAAAATGAGACAGG + Intronic
1071951245 10:90704694-90704716 AGTGAGAAAACAGAGAACAAAGG + Intergenic
1072086524 10:92084873-92084895 AGTTAAAATACAGATGAGGCCGG - Intronic
1072318761 10:94228558-94228580 AGTGAGAACCCTCATGAGGATGG - Intronic
1072507452 10:96082894-96082916 AGCCAGAAAACAGATAAAGAGGG - Intergenic
1073059259 10:100723796-100723818 AGAGAGAAAACTGAGGGGGAAGG + Intergenic
1073167656 10:101471614-101471636 TTTTAGAAAACAGAGGAGGATGG - Intronic
1074081264 10:110169836-110169858 AGGGAGAAGGGAGATGAGGAGGG - Intergenic
1074469057 10:113710635-113710657 AGAGAGGAAAAAGAGGAGGATGG + Intronic
1076256312 10:129027943-129027965 AGTGAGGAAACATATGGTGAGGG + Intergenic
1076411901 10:130257614-130257636 AGTGAGGAAACAGAACTGGAAGG + Intergenic
1077372768 11:2191242-2191264 AGGGAGAAAGCAAAGGAGGAAGG + Intergenic
1077802629 11:5556359-5556381 ACTGAGAGAAAAGAAGAGGAAGG + Intronic
1077932704 11:6751084-6751106 AGTGTGAAAACAGAATAGTACGG + Intergenic
1078192121 11:9099805-9099827 AGGGAAAGAACAGATGGGGACGG - Intronic
1078841453 11:15079382-15079404 AGGGGGAAAATAGATGAGGGAGG - Intronic
1079554932 11:21747941-21747963 AAAGAGTAAACAGATAAGGAAGG - Intergenic
1080979959 11:37390313-37390335 AGTGAGAAAAGGGAGGAGGAGGG + Intergenic
1081057942 11:38433892-38433914 AGTAGGAAAAAAGATGAGGGAGG + Intergenic
1081734811 11:45395248-45395270 AGAGAGAGAAGAGAGGAGGAAGG - Intergenic
1082180243 11:49108233-49108255 AAAGAGAAAATAGAGGAGGAAGG - Intergenic
1082716475 11:56620046-56620068 AGTGAGAGGGCAGATGAGGTTGG + Intergenic
1082905018 11:58298324-58298346 AGTGAGCAAGCAGATAAGCAAGG + Intergenic
1082930416 11:58597411-58597433 GTTAAGAAAACAGCTGAGGAAGG - Intronic
1082953373 11:58842257-58842279 AGTCAGAAAAAAAATTAGGATGG + Intronic
1083375464 11:62216669-62216691 AGCAAGAAAACATATGAGCAAGG - Intergenic
1084644421 11:70446556-70446578 AGGGAGAAAAAAGAGGAAGAAGG - Intergenic
1085595647 11:77806779-77806801 AGTGAAAAAACAAGGGAGGAGGG + Intronic
1086181744 11:83960136-83960158 AGAGAGTCAAGAGATGAGGAAGG - Intronic
1086531175 11:87786933-87786955 AGTGAGAAAACAGCAGAAGCAGG - Intergenic
1086560361 11:88161298-88161320 AGTGGGAGTAGAGATGAGGAGGG - Intronic
1086685247 11:89726599-89726621 AAAGAGAAAATAGAGGAGGAAGG + Intergenic
1086919541 11:92570745-92570767 AGTGTGCAAACAGATAGGGATGG - Intronic
1087261473 11:96017369-96017391 AGGGAGAAAAGAGGTGGGGAGGG - Intronic
1087305480 11:96484646-96484668 AGTCAAAAAGCAGAGGAGGAGGG - Intronic
1087430973 11:98054782-98054804 AGTATGAGAACACATGAGGAAGG - Intergenic
1087503878 11:98996182-98996204 AGAGTGGGAACAGATGAGGATGG - Intergenic
1087779719 11:102289452-102289474 TGTGGGAACACAGAGGAGGAAGG + Intergenic
1087937703 11:104054608-104054630 GGGGAGAAAACAAATGAAGATGG + Intronic
1088170442 11:106990285-106990307 AGTGAGACTAGAGATGAAGATGG - Intronic
1088389967 11:109303344-109303366 AGGGAGAACATAGATGAAGAGGG - Intergenic
1088974158 11:114799932-114799954 GGAGAGAAAACGGATGAAGACGG - Intergenic
1089003538 11:115071582-115071604 AGTGAGAAAACAAATGCCCAAGG - Intergenic
1089055321 11:115580324-115580346 AGTGAGAAAACAGGCAACGATGG + Intergenic
1089165457 11:116472648-116472670 ACTGAGAAAACAGCAGAGGCAGG + Intergenic
1089233292 11:116999724-116999746 AGGGAGAAAACAAATGAAAATGG - Intronic
1089402931 11:118175041-118175063 AGGGAGGAAACAGATGACTATGG - Intronic
1089431397 11:118427633-118427655 ACTGAGAAAGCAGCTCAGGAAGG - Intronic
1089481624 11:118810300-118810322 ACATAGAAAACAGAGGAGGATGG + Intergenic
1089628791 11:119770526-119770548 AGGGAGGACACAGAGGAGGAAGG + Intergenic
1089777082 11:120845418-120845440 AGTGAGAAAAAAGAGAGGGAAGG - Intronic
1089872121 11:121684866-121684888 AGGGTGAAGACACATGAGGAAGG + Intergenic
1089917369 11:122171280-122171302 AGTGAGAAAACAGGTCTGCATGG + Intergenic
1090486000 11:127112585-127112607 AGTGAGATCACAAATGTGGAAGG + Intergenic
1090556465 11:127881977-127881999 AGTAAGAAAAGAGATTAAGAAGG - Intergenic
1091008323 11:131974758-131974780 AGTGAGATAACATATGTGCAAGG + Intronic
1091164878 11:133466639-133466661 ACTGAGAAAAAAGATGTGGCTGG - Intronic
1091534683 12:1394655-1394677 AGTGAGAGCACAGGTGAGGGGGG - Intronic
1091744957 12:2985748-2985770 AGTAAAAAAACAGGTGAGGTAGG - Intronic
1092112951 12:5976820-5976842 TGTGGGAAAACAGATGAAAAAGG + Intronic
1092533227 12:9362375-9362397 AGTATGGAAACAAATGAGGAAGG - Intergenic
1092866288 12:12764543-12764565 AGGGTGAAAACAGATGGAGAAGG + Intronic
1093192057 12:16086257-16086279 AGCCAAAAAACAAATGAGGAAGG + Intergenic
1095175700 12:39089828-39089850 AATGAGAAAAGAGATGTTGAAGG - Intergenic
1095190857 12:39256516-39256538 TGTGAGAAAAGAGAAGGGGATGG - Intergenic
1096059515 12:48684870-48684892 AGTGAGAAAAAAGATGAAAACGG + Intergenic
1096455456 12:51781203-51781225 ACTGAGAAAGCAGCTGAGAATGG + Intronic
1096621584 12:52868966-52868988 AGTGAAAGAAGGGATGAGGAGGG + Intergenic
1096821165 12:54235980-54236002 AGAGAGAAAACAGGTGAGTTGGG - Exonic
1097701669 12:62826902-62826924 AGTGATAAGAAAGATAAGGATGG - Intronic
1098358158 12:69630265-69630287 GGTGAGAAAACAGCCCAGGAAGG - Intergenic
1099823198 12:87741810-87741832 AATGAGAAAACAGAAAAGGAAGG + Intergenic
1100162051 12:91871918-91871940 AGAGAAAAAACAGAAGTGGATGG + Intergenic
1100330940 12:93581686-93581708 AGGGAGAAAGCAGGTGAGAAGGG - Intronic
1100774278 12:97957210-97957232 AATGAGAAATCAGATGGAGAGGG + Intergenic
1100990128 12:100243183-100243205 AGTTAGAAAATAGGTGAGTATGG - Intronic
1101688480 12:107050183-107050205 AGAGAGAAAAACAATGAGGAGGG + Intronic
1101782598 12:107849076-107849098 AGTGAGAGAAAAGATGGGGCAGG - Intergenic
1102507675 12:113394025-113394047 AGTGGGAACCCAGAAGAGGATGG + Intronic
1102764792 12:115423205-115423227 AGGGAGGAAAAAGAGGAGGAGGG + Intergenic
1102913606 12:116737308-116737330 AGTAAGGAAAAAGAGGAGGAAGG + Intronic
1103624629 12:122208430-122208452 CGTCAGAAAACACAGGAGGAAGG - Exonic
1103811736 12:123619608-123619630 AGAGAGAAAACAGAAAATGAAGG + Exonic
1104098784 12:125586441-125586463 AGTGAAACCACAGATAAGGAAGG - Intronic
1104814565 12:131638288-131638310 GGTGAGGAGACAGATGAGGGTGG + Intergenic
1104814568 12:131638309-131638331 GGTGAGAAGAGAGATGAGGGTGG + Intergenic
1104814589 12:131638414-131638436 GGTGAGGAGACAGATGAGGGTGG + Intergenic
1104814626 12:131638603-131638625 GGTGAGGAGACAGATGAGGGTGG + Intergenic
1104814646 12:131638708-131638730 GGTGAGGAGACAGATGAGGGTGG + Intergenic
1104855687 12:131901533-131901555 AATGAGAAAGCAGAGGGGGAGGG - Intronic
1105019592 12:132807323-132807345 AGTGTGAAAGAAAATGAGGATGG - Intronic
1106058878 13:26265992-26266014 AGTGAGAGAGGGGATGAGGAGGG + Intronic
1106495001 13:30268087-30268109 AGTCATAAATCACATGAGGATGG - Intronic
1106720518 13:32430330-32430352 AGAGAGAAGACAGCTGAGGAAGG + Intergenic
1106938576 13:34750890-34750912 AGTGAGAAAGCAGTTGATCATGG + Intergenic
1107012699 13:35683954-35683976 AGAAAGAAAACAGAAGGGGATGG + Intergenic
1107028216 13:35824939-35824961 AGTTAGAAAACTGAAGGGGAGGG - Intronic
1107881000 13:44831842-44831864 AAGGAGGAAACAGAAGAGGAAGG + Intergenic
1107921215 13:45210239-45210261 AGGGAAGAAAAAGATGAGGATGG - Intronic
1107944454 13:45405440-45405462 ATTGTGAAAAGAGATGAAGATGG + Intronic
1108173139 13:47764522-47764544 GGTGAAGAAGCAGATGAGGAAGG + Intergenic
1109373667 13:61459329-61459351 AGTGGTAAAAGAGATGAGGATGG - Intergenic
1109580307 13:64322708-64322730 AGTGAAACCACAGATGAGAAGGG - Intergenic
1109838475 13:67890107-67890129 AGTCAGCAAACAGATGAAGGTGG + Intergenic
1109880961 13:68475940-68475962 AGGGAGAAAGGAGAAGAGGAGGG - Intergenic
1110095823 13:71519003-71519025 AGTGAGAAACCAGATGTATATGG - Intronic
1110427344 13:75383508-75383530 AGTGAAACTACAGATAAGGAGGG - Intronic
1110484615 13:76023615-76023637 AGTGAGAAAAGTGGTGGGGAAGG + Intergenic
1110568538 13:76980097-76980119 AGAGGGAAAACAGCTTAGGAAGG + Intergenic
1111572501 13:90105806-90105828 ATTGAGAAACCAGAGGAGGCTGG + Intergenic
1111962398 13:94825818-94825840 AGAGAGAATGCAGATGAGGCAGG - Intergenic
1112228048 13:97559808-97559830 AGTGAAAACACAGATAAGGGGGG + Intergenic
1112379028 13:98871187-98871209 AGTGAGAAAATAGCTGGGAACGG + Intronic
1112664211 13:101551091-101551113 GGTGAGGATACAGAGGAGGATGG + Intronic
1113151447 13:107268355-107268377 AGTGAAACCACAGATGAGGGGGG + Intronic
1114298436 14:21351806-21351828 GATGAGAAAAGAGAAGAGGAAGG - Exonic
1114366466 14:22032466-22032488 AGAGAGAAAAGAGATGAGAGAGG - Intergenic
1114616694 14:24072250-24072272 AGTGTGAAAACAGGGGAGGTGGG + Intronic
1114728324 14:24963269-24963291 AGCTAGAAAACAGACGAGGGCGG + Intronic
1115635415 14:35286275-35286297 AGTGAAAAATAAGATGGGGAAGG - Intronic
1115682206 14:35753321-35753343 AGTAAGTAAACAAATGGGGAGGG + Intronic
1116154038 14:41180691-41180713 AGAGAGAAAACAATTGAGGCAGG + Intergenic
1118652513 14:67912625-67912647 AGTGAGAACACAGAGGAAGAAGG + Intronic
1118961417 14:70537169-70537191 AGTGAGAGACAAGATGAGGTAGG - Intergenic
1119196882 14:72723591-72723613 AGCGAGGAAAGAGATGAGGGAGG - Intronic
1119834608 14:77737303-77737325 TGTTGGAAAACATATGAGGATGG - Intronic
1120085766 14:80270831-80270853 AGTGAGAAAACAGAAAAGAGGGG + Intronic
1120355138 14:83423441-83423463 AGAGAGAAAAAGGATGTGGATGG - Intergenic
1120751467 14:88202569-88202591 AGTGAGACGAAAGAGGAGGACGG - Intronic
1121122434 14:91384502-91384524 GGTGAAGAAGCAGATGAGGAAGG - Intronic
1121216526 14:92252814-92252836 AGAGAGAAAACAGAAGAAGGAGG + Intergenic
1121410801 14:93746991-93747013 AGTGAGAAAGCAGCTGGGGCCGG + Intronic
1121962415 14:98273750-98273772 AGTTAGAAAACAGAGGCTGAGGG + Intergenic
1122523782 14:102365258-102365280 GGAGAGAAAACAGATAATGATGG + Intronic
1122765871 14:104069472-104069494 ACAGAGAAAACAGCTGAGGGAGG - Intergenic
1124372303 15:29110708-29110730 AGGGGGAGAAGAGATGAGGAAGG + Intronic
1124517219 15:30376831-30376853 ATTGAGACAAAAGAGGAGGATGG + Intronic
1124725725 15:32154163-32154185 ATTGAGACAAAAGAGGAGGATGG - Intronic
1124750531 15:32368685-32368707 AAGGAGAAAACAAATGAGGGGGG - Intergenic
1125069393 15:35533788-35533810 AGTTAGAAAGCAGATAAAGAAGG + Intronic
1125530359 15:40409233-40409255 AGTTAGAAATCAGATGAAAATGG + Intronic
1126275919 15:46880782-46880804 AGAGAAAAAACAGATGATGGAGG + Intergenic
1126370114 15:47937232-47937254 AGTGAGAACACAGATCAGAAAGG - Intergenic
1127123515 15:55790989-55791011 AGAGAGAGAACAGAGGAGGCTGG + Intergenic
1127360692 15:58242476-58242498 AATGAGAAAAAAAATGATGATGG + Intronic
1127532210 15:59854513-59854535 ACTGAGATCAAAGATGAGGAAGG - Intergenic
1128597001 15:68961793-68961815 ATTCAAAAAACAGAAGAGGAAGG - Intronic
1129069936 15:72942372-72942394 AGTGAGAGAGCAGAAGAGCAAGG + Intergenic
1129309071 15:74692465-74692487 TTTCAGAAAACAGAGGAGGAAGG + Intronic
1129856253 15:78827441-78827463 AATGAGAAAACAGACCAGAATGG + Intronic
1130170492 15:81507228-81507250 AGTGAAAGAAAAAATGAGGATGG - Intergenic
1130739720 15:86586128-86586150 AGTCAGAAAGGAGAAGAGGAAGG + Intronic
1130755567 15:86759362-86759384 AGTGAGAAAACAGACTAAGAGGG - Intronic
1130827701 15:87566266-87566288 CTTGAGAAAAGAGATTAGGAGGG + Intergenic
1131044874 15:89306238-89306260 AGTGAGCCAGGAGATGAGGATGG + Intronic
1131821892 15:96282159-96282181 AGAAAGAAAAAAGATGAGAAAGG + Intergenic
1131875430 15:96801291-96801313 AGTTAGAATTCAGATGAGGCTGG + Intergenic
1131940732 15:97562124-97562146 AGAGAGAAAGTAGATGGGGAGGG + Intergenic
1133415855 16:5606464-5606486 AGTGAGAGAGAAGGTGAGGAAGG - Intergenic
1133517243 16:6521401-6521423 AGAGAAAAAAGAAATGAGGAAGG - Intronic
1133554076 16:6887961-6887983 AGTAATAAAAATGATGAGGATGG - Intronic
1133574016 16:7070036-7070058 AGAGAGGAAAAAGAGGAGGAGGG - Intronic
1134452020 16:14369433-14369455 AGTGAGGAAGGAGCTGAGGATGG + Intergenic
1134649599 16:15898200-15898222 AGGGAGAAGAAAGAGGAGGAGGG - Intergenic
1135181032 16:20274800-20274822 TGTGAGAAATCAGATGGGAATGG + Intergenic
1136648866 16:31648197-31648219 AGTGGGGAAAAAGATGATGATGG + Intergenic
1137948414 16:52758123-52758145 AGTGAGGAGACAGTTAAGGATGG - Intergenic
1138654436 16:58482638-58482660 AGAGAGAAAAGAGAGAAGGAAGG - Intronic
1138775360 16:59716355-59716377 AATGAGTAGAAAGATGAGGATGG + Intronic
1138947449 16:61869124-61869146 AGTGAGAATACAGAGAAAGAAGG - Intronic
1138953066 16:61937509-61937531 ACTGAGAAAAGTGAGGAGGAAGG - Intronic
1140056393 16:71529642-71529664 AGTGAGTAAATAGATGAGTGTGG - Intronic
1140911989 16:79462486-79462508 AATCAGAGACCAGATGAGGAGGG - Intergenic
1141283444 16:82649684-82649706 AGAGAGAAAAATGATGGGGAAGG + Intronic
1141314925 16:82952841-82952863 AGTGAGGAATCAGAGGTGGAGGG - Intronic
1142027854 16:87824076-87824098 ACTGAGACCACAGATGACGAAGG - Intergenic
1142738811 17:1918352-1918374 AGTGAGAAAAAAAAAGAGAAGGG - Intergenic
1143142444 17:4748798-4748820 GCTGAGAGAAAAGATGAGGAGGG - Intergenic
1143354378 17:6314615-6314637 GGTGAGAAAACTGGGGAGGAAGG + Intergenic
1144084441 17:11796274-11796296 ATTAGGAAAACACATGAGGATGG - Intronic
1144491502 17:15715750-15715772 AATGAGTACACAGATCAGGATGG - Intronic
1144494854 17:15739644-15739666 AGACAGAGAACAGATCAGGATGG + Intronic
1144908985 17:18663455-18663477 AATGAGTACACAGATCAGGATGG + Intronic
1145086609 17:19947273-19947295 ACTCAGAAAACAAATTAGGAAGG + Intronic
1146146997 17:30427809-30427831 GGTGAGAAAAGAGAGGAGAAAGG - Intronic
1147198655 17:38784530-38784552 AGTCAGAATATAGATGAGGCTGG - Intronic
1147755216 17:42762918-42762940 AGTGAGAAAAGGGAGTAGGAGGG - Exonic
1148558335 17:48591834-48591856 AGTTAGAACACAGATGGGGAGGG + Exonic
1149275826 17:55034565-55034587 AGAGATAAAACAGATTAGAATGG - Intronic
1149276214 17:55040778-55040800 AGACAGGAAACAGATGTGGAAGG + Intronic
1149397817 17:56262731-56262753 AATGAGATAATAAATGAGGATGG + Intronic
1149515488 17:57277909-57277931 ATTGAGAAAACATTTGAGGCTGG + Intronic
1150040320 17:61853337-61853359 ACTGAAAAAGAAGATGAGGAGGG + Intronic
1150309413 17:64115566-64115588 AGTGAGAAGACAGCTGAGCAGGG - Intronic
1150519165 17:65848468-65848490 AGGGAGGAAACAGTTGAAGAAGG - Intronic
1150631742 17:66884956-66884978 AGGGAGAAGACAGCAGAGGATGG - Intronic
1150809925 17:68348259-68348281 AGTGAGAAAACTGAAGACCAAGG - Intronic
1150895323 17:69203464-69203486 AGAGGGAAAAGAGATGAGGATGG - Intronic
1150931949 17:69594610-69594632 AGGGAGAAAAAAGATAATGACGG - Intergenic
1151291861 17:73156282-73156304 AGTGAGAAAAGAGAAAAGAAAGG + Intergenic
1153223665 18:2882121-2882143 AGTGAGAAAACAGAGGCTCATGG - Intronic
1153385225 18:4485752-4485774 AGTGAAAACTCACATGAGGAAGG - Intergenic
1153448560 18:5199889-5199911 GGGCAGAAAACAGCTGAGGATGG - Intergenic
1153713473 18:7822835-7822857 AGTGTGAAAACAAGAGAGGACGG - Intronic
1154180455 18:12134356-12134378 AAAGGGAAAACAGATGAGAAAGG - Intergenic
1154941618 18:21118651-21118673 AGGGAGAAAAAAGATGAAAAGGG - Intergenic
1156035561 18:32763382-32763404 TGTGATAAAACAGAAGTGGAAGG + Intronic
1156257892 18:35415600-35415622 AGTGAGACAGTAGATTAGGAAGG + Intergenic
1157331883 18:46710219-46710241 AGTGAGAAGACAAATGCAGAAGG + Intronic
1157699864 18:49755360-49755382 AGTGAGATAATAGATGAGAAAGG + Intergenic
1158129491 18:54137049-54137071 TGTGAAGAAACAGATGAGAAGGG - Intergenic
1158370755 18:56800807-56800829 AGGGAAAATACAGATGAGCAGGG - Intronic
1158439230 18:57459318-57459340 ACTGTGAACAAAGATGAGGAGGG + Intronic
1158627838 18:59087187-59087209 AGTGAGAACAGAGGTGAGAATGG - Intergenic
1158837506 18:61346700-61346722 ATTGAGAGAACAGAAGAGGTCGG + Intronic
1159314033 18:66747737-66747759 ACTGTGAAAACGGATGATGAAGG - Intergenic
1159428864 18:68325130-68325152 AGGGAGAAAACAGATGGGCTAGG + Intergenic
1159913901 18:74172081-74172103 GATGAGGAAACAGAGGAGGAGGG - Intergenic
1161009189 19:1951978-1952000 AGTCAGAAAACAGCAGAGAATGG - Intronic
1161637711 19:5399510-5399532 AGAGAGCAAGCAGAGGAGGAGGG + Intergenic
1161847308 19:6719119-6719141 AGGGAGAAGACAGAAGGGGAGGG + Intronic
1162203745 19:9040206-9040228 AGGGAGAAGATAGAAGAGGAAGG + Intergenic
1162291601 19:9785143-9785165 AGTGAGAGAACAGATGGGGCCGG - Intronic
1163225251 19:15956024-15956046 AGTCATAAAATTGATGAGGAGGG + Intergenic
1163270046 19:16247679-16247701 AGTGACAAATCAGATGGGGCGGG - Intergenic
1163455065 19:17401717-17401739 AGTAAGATAACAGAGAAGGAAGG + Intergenic
1163709763 19:18839715-18839737 AGTAAGAAAACAGCAGGGGATGG - Intronic
1164606368 19:29601293-29601315 AGTGAGGACACAGATAATGATGG + Intergenic
1164866769 19:31610875-31610897 AGGCAGAAAACAGTTGTGGAAGG - Intergenic
1165306202 19:35004521-35004543 AGTAAGAAAACAAGTGAGCAGGG - Intronic
1165472751 19:36012986-36013008 AGTGGGAAAACAGACCAGTAGGG + Intronic
1165636927 19:37348084-37348106 ACGGAGAAGACAAATGAGGAAGG - Intronic
1165933598 19:39375823-39375845 AGTGAGCAGACAGAGGAGCAGGG + Exonic
1166152146 19:40882217-40882239 AGTGAGATGACAGATGGTGATGG + Exonic
1166317650 19:41998019-41998041 AGACAGAAAACAGATGGGGCTGG - Intergenic
1166674709 19:44732825-44732847 AGTGAGAACAGAGAAGAGAAAGG - Intergenic
1166956441 19:46468587-46468609 AATGAGAGAACAGATCAAGAAGG + Intronic
1167138770 19:47634722-47634744 AGAGAGAAGAGAGTTGAGGATGG - Intronic
1167296681 19:48654572-48654594 GGTGAGAGAAGAGATGAGGCTGG - Intergenic
1167463365 19:49638052-49638074 AGGGAGGAAGCAGAAGAGGAGGG - Intronic
1167732527 19:51269140-51269162 GGTGAGAAAAAACATGACGATGG + Exonic
1167753833 19:51397927-51397949 AGTGAGAAAAAAGCTGAGGCAGG - Intergenic
1168290901 19:55357051-55357073 CGTCAGAAAAGAGAAGAGGAAGG + Intronic
1168457015 19:56520394-56520416 TGTGAGAAAACAGTAGATGATGG + Intronic
1168651877 19:58097245-58097267 AGAGAGAAGACAGGAGAGGAAGG + Intronic
1168669617 19:58230689-58230711 AGTGAGAGAGCAGAGCAGGATGG + Intronic
926546383 2:14245541-14245563 AGTGAAAAGACAAATCAGGAGGG - Intergenic
926789544 2:16556463-16556485 AGTGACAATGCAGATGTGGAAGG + Intronic
926952298 2:18255274-18255296 AGAGAGAAGTGAGATGAGGAAGG - Intronic
927022909 2:19035845-19035867 AGTGAGACCAGAGATGAGAAAGG - Intergenic
927058966 2:19395941-19395963 AGTGCAATAACAGATGAAGATGG + Intergenic
927393281 2:22620511-22620533 AGGGAGAAACTAGATGAGGATGG + Intergenic
927666880 2:25039038-25039060 AGTGGGAGCACAGTTGAGGAGGG + Intergenic
927716179 2:25354782-25354804 TGACTGAAAACAGATGAGGAGGG + Intergenic
927786612 2:25979307-25979329 GGTGAGGAAACAGCTCAGGAAGG + Intronic
929321337 2:40546592-40546614 AGTAAGAAAAATGATGAGGGAGG - Intronic
929402407 2:41600104-41600126 AGTGAAACAGCAGATGAGAAGGG + Intergenic
929772406 2:44903412-44903434 AGAGACAAAACAGTAGAGGATGG - Intergenic
929989113 2:46769675-46769697 ATTGAGGAAACAGGTGAAGAAGG - Intergenic
930188872 2:48437619-48437641 AGTGATAAAACAGAAAAGTATGG - Intergenic
930356317 2:50325145-50325167 ACTGAGAAAGAAGAAGAGGATGG + Intronic
930624306 2:53679469-53679491 ATGGAGAAGAAAGATGAGGATGG - Intronic
931729131 2:65137582-65137604 AGTGAGCAAACAGACAAGGAGGG + Intergenic
932224632 2:70029916-70029938 AGGGAGAGACCAGAGGAGGAGGG - Intergenic
933141941 2:78802113-78802135 ATTTTGAAAACAAATGAGGAAGG - Intergenic
933599769 2:84317524-84317546 AGAGAAAAGACAGCTGAGGAGGG - Intergenic
934881611 2:97986352-97986374 AGAGGGAAGAGAGATGAGGAAGG + Intronic
934930679 2:98420201-98420223 TTTGGGAATACAGATGAGGAAGG + Intergenic
934999480 2:98999515-98999537 AGTGAGAAAAAAGGTGATTAAGG + Intronic
935506507 2:103911121-103911143 AGTGAGAAAACAGTAGATGCTGG - Intergenic
935797312 2:106657295-106657317 AGAGAGAAAACAAAGGAGTAGGG - Intergenic
935803437 2:106723186-106723208 AATCAGCAAACAGACGAGGAAGG + Intergenic
936349610 2:111702821-111702843 AGTCGGTAAACAGAGGAGGAGGG + Intergenic
937201622 2:120207635-120207657 AGTGAGCACACAGAGGAAGAAGG - Intergenic
937248937 2:120511342-120511364 AGAGAGAAAAGGGAAGAGGAGGG - Intergenic
937409041 2:121656840-121656862 CTTGAAAAAATAGATGAGGAGGG - Intergenic
937430357 2:121832783-121832805 CTGGAGAAAACAGATGTGGAAGG + Intergenic
939027884 2:137035241-137035263 AATGAGAAAAGAGATGGGTATGG - Intronic
939111500 2:138013315-138013337 AGAGGGAAAAGAGATGAGGTTGG - Intronic
939806888 2:146784902-146784924 ACTGAGAAAACAGATCAGAGTGG - Intergenic
939952712 2:148494626-148494648 AGGGAAAAAACACATTAGGAAGG - Intronic
940046531 2:149416119-149416141 AGAGAGAACTCAGAAGAGGAAGG + Intronic
940268178 2:151862134-151862156 AGTTTGAAAACAGAAGAGAATGG - Intronic
940900988 2:159126026-159126048 AGTGAGAAAAGGCAGGAGGAAGG - Intronic
940904722 2:159158764-159158786 AGAGAGAAAACACATGTGGAAGG + Intronic
940967797 2:159859421-159859443 AGAGTGAAAAAAGATGAAGATGG - Intronic
941283587 2:163581970-163581992 AGGAAGAAAACATATGAGGCTGG + Intergenic
941741400 2:169039210-169039232 AGTGAGATCACAGGTGAGCAAGG + Intergenic
941870008 2:170374107-170374129 ATTGAGATGACAGATGAGAAAGG - Intronic
942016373 2:171820861-171820883 AGTGAGATAAAAGAGGAGGTGGG - Intronic
942151382 2:173078942-173078964 AGTGAGAAAACTGAGGATCAGGG - Intronic
942243406 2:173985001-173985023 ACTGAGTAAACAGATAAGGCAGG - Intergenic
942271616 2:174281432-174281454 TCTGAGAAAACAGAGGAGAATGG + Intergenic
942413572 2:175735916-175735938 AGTTAGAAAACAAATGGAGAAGG + Intergenic
942676863 2:178435521-178435543 AGAGAAAATACAGATGATGATGG + Intronic
942891165 2:180990476-180990498 AGTGAAGAATCAGCTGAGGAAGG - Intronic
943978996 2:194522827-194522849 AGAGAGACAGGAGATGAGGAAGG + Intergenic
944212901 2:197225051-197225073 AGGGAGAAAAGGGAAGAGGAGGG + Intronic
944962243 2:204888341-204888363 AGAGAGCAAACAGAGGAGAAAGG + Intronic
945335191 2:208583634-208583656 AGTGAAAAATGAGATGGGGAGGG + Intronic
945590808 2:211728157-211728179 AGAGAGAAAAAAGAAGATGAAGG - Intronic
945996677 2:216442980-216443002 AGTGAGGAAATAAATGAGAATGG - Intronic
946066751 2:216994478-216994500 AGAGAGAAAGGAGATGAAGAAGG - Intergenic
946355690 2:219182910-219182932 AATGAGAATAGAGATGAGGCAGG - Exonic
946488541 2:220125297-220125319 AGTGAAAAAAAGGAGGAGGAGGG + Intergenic
946580562 2:221124016-221124038 ACGAAGAAAACACATGAGGAAGG + Intergenic
946581713 2:221135368-221135390 TGTGAGAAAACAAATGCTGATGG - Intergenic
947214560 2:227738091-227738113 AGTAAGCAAAGAGTTGAGGAGGG - Intergenic
948122408 2:235540716-235540738 AGGGAGAAAGCAGGTGAAGATGG + Intronic
948247705 2:236500372-236500394 AGGGAGAAAGCAGACGAGGAAGG + Intronic
948375628 2:237518577-237518599 AGCGACCAGACAGATGAGGATGG + Exonic
948587005 2:239025956-239025978 AAAAAGAAAACAGATGGGGATGG - Intergenic
948698499 2:239746361-239746383 AATGTAAAAACAGATGTGGAAGG + Intergenic
948865107 2:240771222-240771244 GGAGAGAAAAAAGATGAAGATGG + Intronic
1168914052 20:1471999-1472021 AAGGAGAAAACAGAAGGGGAGGG + Intronic
1168989186 20:2079698-2079720 AGTGACACAAGAAATGAGGATGG - Intergenic
1169044975 20:2527977-2527999 AGAGAGAATACAGAAGAGGCTGG + Intergenic
1169780815 20:9307742-9307764 AATGAAAAAACAATTGAGGATGG - Intronic
1170317970 20:15063117-15063139 AGTCAAAAAAGAGATGAGTAAGG + Intronic
1170442671 20:16395160-16395182 AGGCAGAAAGGAGATGAGGAAGG + Intronic
1170915319 20:20618432-20618454 AGTGAGAAAATTCATGAGTATGG + Intronic
1171147471 20:22797951-22797973 AGTCAGAACACAGCTGAGCAAGG - Intergenic
1171338697 20:24410249-24410271 AGTGTGAAAGCAGATGAAGGGGG + Intergenic
1171340239 20:24421643-24421665 AGGGAGAAAATAAATGAGTAAGG - Intergenic
1172853060 20:37980660-37980682 AATGAGAAAACAGGTCAGGGAGG - Intergenic
1173221069 20:41133671-41133693 AGAGAGAAAACATATCAGGTAGG + Intergenic
1174044101 20:47721244-47721266 TGTGTGAAAACAAATGAGGAAGG + Intronic
1174441845 20:50561922-50561944 AGGGAGAAAAATGATGAGGTTGG - Intronic
1175247111 20:57588851-57588873 AATGAGAAAACACATGTGGAGGG + Intergenic
1175287694 20:57848717-57848739 AGGGAGAAAGGAAATGAGGAAGG - Intergenic
1176935670 21:14863965-14863987 AGTGACAGCAGAGATGAGGAAGG - Intergenic
1177304106 21:19290159-19290181 AATGAGGAAACTGATGAGGTTGG - Intergenic
1177551070 21:22623255-22623277 ATTGAGAAAGCAGATGAAGGTGG + Intergenic
1177769103 21:25495054-25495076 AGTGAGAAAACTGAGGAAGGAGG - Intergenic
1178579958 21:33830000-33830022 AGTGAGAACTCATATGACGAGGG + Intronic
1178871152 21:36377661-36377683 AGTGAGCACACAGAGCAGGAGGG + Intronic
1180942686 22:19669807-19669829 AGGGACAACCCAGATGAGGAAGG + Intergenic
1181320050 22:21997621-21997643 AGTTAGAAACAAGATGAAGATGG + Intergenic
1182020314 22:27076124-27076146 GGTCAGAGAACAAATGAGGAAGG - Intergenic
1182095436 22:27622340-27622362 GGTGATAAGACAGATGAGAAAGG - Intergenic
1183319311 22:37155482-37155504 AGTGAGAAAGCACAGGAGGCAGG - Intronic
1184144811 22:42603542-42603564 AGTGAGAACATGGATGGGGATGG - Intronic
1184190209 22:42889515-42889537 AGGGACAAAACAGAAGAGAAAGG + Intronic
1184440877 22:44513912-44513934 AGAGAGAAAAAAAAGGAGGAGGG - Intergenic
949507578 3:4741678-4741700 AGTTAGCAAAGAGATGAGGGCGG + Intronic
950043101 3:9932927-9932949 CCGGAGAAAACAGATGGGGAGGG - Intronic
950373839 3:12554048-12554070 GCTGAGAAAACAGAAGAGAAGGG - Intronic
950645647 3:14374973-14374995 AGGGAGGAAAGAGATGCGGAGGG + Intergenic
950747797 3:15104565-15104587 AATGAGAAAAAGGATGAGGCTGG + Intergenic
951591070 3:24265197-24265219 AGTGAAGAAAGAGGTGAGGAGGG + Intronic
951998689 3:28759770-28759792 AGTGAGGAAGCAGCTGAGCATGG - Intergenic
952334171 3:32391035-32391057 AGCCAGAAAAGAGATGAGGGAGG + Intergenic
953335583 3:42091353-42091375 ACTCAGAAAACTGCTGAGGAAGG + Exonic
953833312 3:46321624-46321646 AGTAAGAAACCAAAAGAGGAAGG + Intergenic
954680446 3:52343157-52343179 AGCGAGGGAAGAGATGAGGATGG + Intronic
955124282 3:56094954-56094976 AGTGCTAAAACAGATGGGGTTGG + Intronic
956017776 3:64902033-64902055 AGAGAGAGAAAAGAAGAGGAGGG - Intergenic
956078726 3:65534704-65534726 AGTGAGAACACTGACGATGATGG + Intronic
956318572 3:67968673-67968695 AGTGAGAAAATGGATATGGATGG + Intergenic
956761765 3:72449967-72449989 AGGGAGGAAACAGAGGAGCAGGG - Intergenic
956855904 3:73274459-73274481 AGTGTGTAAACAAATGAGCACGG - Intergenic
957237118 3:77608021-77608043 AGTGAGAGAACATAAGATGATGG - Intronic
958869135 3:99536492-99536514 GGTGAGAAAACTGATTAGAAGGG - Intergenic
959095472 3:101950896-101950918 AGTGAGAACACAGAGGTGAATGG + Intergenic
959130692 3:102352803-102352825 ATTGAGAAAACAGATGTTGGTGG + Intronic
959423415 3:106155664-106155686 AGTGAGAGAGCAGATCAGTAAGG + Intergenic
960166637 3:114410255-114410277 AGAGAGAAAACAGGAGAGAAGGG - Intronic
960178194 3:114542476-114542498 AGTGAGTAAACAGCTAAGGCAGG + Intronic
960418706 3:117416425-117416447 AGTGAGGATGCAAATGAGGAGGG - Intergenic
960504660 3:118478436-118478458 AGTGAGACACCAGATGGGAACGG + Intergenic
961160710 3:124722336-124722358 AGTGAGAAGACAGGAAAGGAGGG + Intronic
961507868 3:127383292-127383314 AGTGAGAACACATTAGAGGAAGG - Intergenic
961554230 3:127687000-127687022 AGTGAGAGAATGGATGAGTAAGG - Intergenic
961705817 3:128784389-128784411 AGTGTGAAAGCAGAAGAGAATGG - Intronic
962020499 3:131495985-131496007 AGTGAGAAAACAAGTGATGTGGG - Intronic
962566767 3:136668595-136668617 ACTGTGAAAGCAGAGGAGGAAGG + Intronic
963131365 3:141861245-141861267 AGAGAGATAACAGATGATTAAGG - Intergenic
964635402 3:158852896-158852918 AGTGAGTGAACAGAAGTGGATGG - Intergenic
964710407 3:159665808-159665830 AGTGAGAAAACAGACTCTGAAGG + Intronic
964713337 3:159695510-159695532 AGTGAGAAGAGAGATGAAGGTGG - Intronic
964996905 3:162892566-162892588 AGTGTGTAAACAGGTGAGCATGG - Intergenic
965425541 3:168518165-168518187 AGTGAGCACACAGTTGAAGAAGG + Intergenic
965523121 3:169688692-169688714 AGTGTGAATACAGATGTGGGTGG - Intergenic
965550593 3:169961251-169961273 AGTGGGAAAGGACATGAGGAGGG + Intergenic
965795424 3:172433954-172433976 AGTGTGAAAACAGATTAATAAGG - Intergenic
965834700 3:172838514-172838536 AGTGAAGAAACAGAGAAGGAAGG + Intergenic
966110167 3:176391327-176391349 AGAGAGCAATCAGATGAGGCAGG - Intergenic
966627281 3:182031879-182031901 AAAGGGAAAAGAGATGAGGAGGG - Intergenic
967131250 3:186472817-186472839 TGTGAGTAAAGTGATGAGGAAGG + Intergenic
967184639 3:186934051-186934073 AGTGAGAAGACAGAAGAGAGAGG + Intronic
967710050 3:192696410-192696432 AATCAGCAAACAGATGAGGGAGG + Intronic
968000801 3:195204981-195205003 AGTCAGAAAATAGAGGTGGAGGG + Intronic
968399207 4:275893-275915 AGTGAGAAAACAGAAAAAGTAGG + Intronic
969434818 4:7182776-7182798 AGGAAGAAAACAGAGAAGGACGG - Intergenic
970079898 4:12270527-12270549 AATTAGAACACAGAAGAGGATGG - Intergenic
970099660 4:12505615-12505637 AGTGAGAAAAGAGTGAAGGAGGG - Intergenic
970452960 4:16190229-16190251 AGTGAGAGGACAGATGGGGTGGG - Intronic
970602830 4:17653881-17653903 AGTGAGAAAAGAGTTGATGGTGG + Intronic
970836795 4:20418838-20418860 AGAGAGAAAACAAATGTGAAAGG + Intronic
970948674 4:21726713-21726735 AGTGAGCAAACATTTGGGGAGGG - Intronic
971389750 4:26175031-26175053 AATGAGAAAACACATGAAGAGGG - Intronic
971506360 4:27370268-27370290 AGTGAGAAAAGGGAAGGGGAGGG - Intergenic
971884119 4:32421499-32421521 AGTGAAACCACAGATAAGGAGGG - Intergenic
972281820 4:37609061-37609083 AATGAAAAAACAGATTTGGAAGG + Intronic
972607069 4:40623380-40623402 ACTAAGAAAAGAGATGAGGAAGG - Intronic
972707087 4:41555628-41555650 AATGAGAAAACAGATAATAATGG + Intronic
972947438 4:44273538-44273560 ACTGGGAAAAAAGATGAAGATGG + Intronic
975008026 4:69314561-69314583 AGAGGGAAAAAAGATGAGAATGG + Intronic
975009997 4:69339188-69339210 AGAGGGAAAAAAGATGAGAATGG - Intronic
976310419 4:83606277-83606299 AGTGAGAACAGAGAGGTGGATGG - Intergenic
976397002 4:84566759-84566781 AGAGAGAAAAGAAATGAGAAAGG + Intergenic
976814779 4:89135099-89135121 AGTGAGGAAACAGAGACGGAGGG - Intergenic
977220222 4:94329334-94329356 ACTAAGAAAACAGCTGAGCAAGG - Intronic
977423622 4:96836686-96836708 AGTGAGAAAATGCATGTGGAAGG + Intergenic
977525624 4:98142529-98142551 TGTGTTAAAAGAGATGAGGACGG + Intronic
977613505 4:99061536-99061558 AATGAGAAAACAGGTGTGCAGGG - Exonic
977902634 4:102439610-102439632 AGGAAGAAAACAAATAAGGAAGG + Intergenic
977950415 4:102964397-102964419 ATTAAGCAAATAGATGAGGAAGG + Intronic
979160547 4:117455038-117455060 AGTAGGAAAACAGAAGTGGAGGG - Intergenic
979457122 4:120939721-120939743 AGTGAACCCACAGATGAGGAGGG - Intergenic
980164179 4:129204631-129204653 AATGAGAAAGCAGAGTAGGAGGG + Intergenic
981743174 4:148024374-148024396 AGTGAGGAAGGGGATGAGGATGG + Intronic
981913611 4:150010196-150010218 AGTGAGAGAACAGGTGGTGAAGG - Intergenic
982270906 4:153587018-153587040 AGTGAGAAAAAAAATAAAGATGG - Intronic
982395338 4:154909843-154909865 AGTGAGGAAAAAAATGAGGCAGG - Intergenic
982580504 4:157173004-157173026 AATGAGAAAACGAATTAGGAGGG - Intergenic
983358061 4:166690486-166690508 TGTGGGGAAACAGATGTGGATGG + Intergenic
985140800 4:186839226-186839248 AGAGAGAAAAGAGAAGAGAAGGG - Intergenic
985478066 5:91031-91053 AGTGAGAACACAGGTGTAGATGG + Intergenic
985898093 5:2762330-2762352 AGAGAGAAAAAAGAGGAAGAAGG + Intergenic
985961013 5:3303248-3303270 AGTGAAAAATTAGATGAAGAAGG - Intergenic
986415350 5:7522610-7522632 AATGAGAAAACAGCTGGGCACGG + Intronic
986722486 5:10569672-10569694 TGTGAGAAAGCGGGTGAGGAGGG + Intronic
986879112 5:12147902-12147924 AGAGAGAAAAAAGAAGAAGAAGG - Intergenic
987213115 5:15704861-15704883 AGTGAGAAAAAAGAATAGGTGGG - Intronic
987655570 5:20801073-20801095 AATGTGAAGACAGATTAGGAGGG + Intergenic
987954441 5:24719766-24719788 TTTGAGAAAATAGAAGAGGAAGG - Intergenic
988252651 5:28780269-28780291 AGAGAGAAAAGAGAAAAGGAAGG - Intergenic
988767983 5:34402820-34402842 AATGTGAAGACAGATTAGGAGGG - Intergenic
988994715 5:36703727-36703749 AGTGGGAAATCAGGAGAGGAAGG - Intergenic
989204203 5:38795504-38795526 AGGGAGAAAACAGAAGAGCATGG + Intergenic
989274416 5:39570349-39570371 AGTGAGAATAGATATCAGGAAGG - Intergenic
989422253 5:41253570-41253592 AGAGAGAAAACAAATTAGGTGGG - Intronic
989451325 5:41589462-41589484 AGAGAGAAAGCTGATGAGAATGG + Intergenic
989597363 5:43168943-43168965 GATGAGTAAACAGATGGGGAAGG + Intronic
989611892 5:43301879-43301901 AGTCATAAAACACTTGAGGATGG - Intronic
990686250 5:58304471-58304493 AGTGAGAAAACAAATCATGCTGG - Intergenic
990905266 5:60796184-60796206 AGTGAGAAAACAGATGAGGAAGG - Intronic
991452535 5:66768272-66768294 AGAGAGACAACAGCTGAAGAAGG + Intronic
992357842 5:76003930-76003952 AGAGAGAAACCAGAGGAGAAGGG + Intergenic
992753235 5:79880317-79880339 AGAGAGAATACAGGTGAGAAAGG + Intergenic
992753462 5:79882414-79882436 AGAGAGAATACAGGTGAGAAAGG - Intergenic
992994849 5:82322803-82322825 AGTGAGAAAACAGGTGAGGGTGG + Intronic
993346923 5:86795719-86795741 AAGGAGAAAACAAAGGAGGAAGG + Intergenic
993402565 5:87472166-87472188 ATTAAGAAAACAGAAAAGGAAGG - Intergenic
993712401 5:91239196-91239218 AGTGAAAAAACTGATGGGGTTGG - Intergenic
993820698 5:92612723-92612745 AGATATAAAAGAGATGAGGAAGG + Intergenic
994029441 5:95124550-95124572 AATGAGATAACAGATCAGCATGG - Intronic
994377662 5:99033421-99033443 ATTGAGTACACAGAAGAGGATGG - Intergenic
994457041 5:100023861-100023883 AGTGACAAAATGGATGAAGAAGG - Intergenic
995008665 5:107232591-107232613 AGACAGAAACCAGATTAGGAGGG + Intergenic
995036784 5:107543231-107543253 AGTGAGAAAACAAAGTAGAAGGG + Intronic
995076038 5:107983887-107983909 AGTGAGAACAAAGGTGGGGAGGG + Intronic
995119061 5:108516613-108516635 AGAAAGAAAAGAGATGGGGATGG - Intergenic
995349224 5:111155964-111155986 AGTGACAAAAAAGCTGAAGATGG - Intergenic
995439880 5:112179298-112179320 ATTCAGAAAACAGAGGAAGAAGG + Intronic
995924395 5:117353327-117353349 ATTGACAAAACAGAAGAAGAAGG + Intergenic
996657809 5:125962488-125962510 AGTGAGAAAACAAAGGAAAAGGG + Intergenic
997904896 5:137806829-137806851 GATAAGAAAACAGAGGAGGAAGG + Intergenic
998529280 5:142870192-142870214 AGAGAGAAAAGAGAAGAGGCTGG - Intronic
998863453 5:146470046-146470068 ATTGATAATACAGATCAGGAAGG + Intronic
999293258 5:150441445-150441467 AGTGATAAAACAGCAGGGGAGGG + Intergenic
999610711 5:153366275-153366297 AGTGAGCAAAGAGATAAGAAGGG + Intergenic
1000177107 5:158767766-158767788 AGTGGGAAACCAGAAGAGCAGGG + Intronic
1001099931 5:168805946-168805968 GGTGAGAAAACAAAGGATGAAGG + Intronic
1001517375 5:172365438-172365460 AGTGAGAAAAGATAAGATGACGG + Intronic
1001571699 5:172734388-172734410 ACTAAGAAAACAGATGAAGAGGG + Intergenic
1001750944 5:174131003-174131025 AGTTGGGAAACAGATCAGGAAGG + Intronic
1001786148 5:174415413-174415435 AGTGAGAAAAGAGCCCAGGAGGG + Intergenic
1002305102 5:178278547-178278569 AGTGAGAAAATAGATGAGGCTGG - Intronic
1003597476 6:7487238-7487260 ATTGAGGAAGGAGATGAGGAGGG - Intergenic
1004162176 6:13224233-13224255 AGTAAGCAAACAGATGATCATGG + Intronic
1004389636 6:15199110-15199132 AAAGAAAAAACAGAAGAGGAGGG + Intergenic
1004573825 6:16873544-16873566 AGTGAGAAACAGGAGGAGGATGG + Intergenic
1004618816 6:17315530-17315552 AGTGAGAATACTGATGATGCAGG + Intergenic
1004948073 6:20637260-20637282 GGGGAGTAAACAAATGAGGAAGG + Intronic
1004951753 6:20681028-20681050 AATGAAAACACAGATGAGGAAGG + Intronic
1005209024 6:23439449-23439471 TTTCAGAAAACAGAAGAGGAGGG - Intergenic
1005496859 6:26395359-26395381 TCAGAGAAAATAGATGAGGAGGG - Intergenic
1005729819 6:28685889-28685911 AGTGAGATAAAAGAACAGGAGGG + Intergenic
1005774069 6:29110084-29110106 AGTGAGAGAACAGAGAAGGAAGG - Intergenic
1007432404 6:41784277-41784299 AGTAAGAAAAGAGATGAGGGAGG - Intronic
1007436508 6:41816517-41816539 ATTGAGAAGAGAGCTGAGGATGG - Intronic
1008102531 6:47407300-47407322 CAGGAAAAAACAGATGAGGATGG + Intergenic
1010225275 6:73483090-73483112 ACTTAGAAAACAGATGAGTTAGG - Intronic
1010265847 6:73865784-73865806 TGAGAGATAAAAGATGAGGAAGG + Intergenic
1010562827 6:77371763-77371785 AGAGAGAAAAGAGAAGAGAAGGG + Intergenic
1011952365 6:92982594-92982616 AGTGAGAAAACTGTTAATGAAGG + Intergenic
1012252763 6:96997165-96997187 ATTGAGCAAGCAAATGAGGAAGG + Intronic
1012507319 6:99962420-99962442 AGTGAAACCACAGATAAGGAAGG + Intronic
1012719291 6:102721778-102721800 AGTGAAGAAAATGATGAGGAGGG - Intergenic
1013147569 6:107409856-107409878 AGTGAGAAAGGAGATGAACAAGG + Intronic
1013944556 6:115706045-115706067 TGTGAGAAAACAGGTCAGCAGGG - Intergenic
1014016333 6:116534575-116534597 AGAGAGAAAACAGAATAGCAGGG - Intronic
1014033336 6:116735802-116735824 AGAGAAAAAACAAATGAAGATGG + Intronic
1014880937 6:126723694-126723716 AGTAAGAAAACAGACCAGGATGG + Intergenic
1015840905 6:137476456-137476478 AGTGATGGAAAAGATGAGGAGGG - Intergenic
1016689651 6:146922294-146922316 AATGAGATGAGAGATGAGGAGGG + Intergenic
1016754066 6:147664189-147664211 AGTGAGGAGACAGATAAGGAAGG + Intronic
1017016730 6:150107075-150107097 AGAGAGAAAAGAGAGGAGGCAGG - Intergenic
1018044766 6:159956085-159956107 AGGAAGAAAAGAGAGGAGGAAGG + Intergenic
1018736601 6:166691294-166691316 AGTGAGTCATAAGATGAGGAGGG - Intronic
1020285127 7:6672772-6672794 TGAGAGAAAACAGATGAGCAAGG - Intergenic
1020318490 7:6923935-6923957 GGAGAGAAAGCAGCTGAGGATGG - Intergenic
1021075287 7:16296565-16296587 AGAGAAAAAACAGCTCAGGAAGG + Intronic
1021089203 7:16462453-16462475 AGTGAGAAAACAGCAGTGGCAGG + Exonic
1021286422 7:18786749-18786771 AGAGAGAAAAAAGAAAAGGAAGG - Intronic
1021829581 7:24590959-24590981 AGTTAGAAAACAGATAAGAAAGG - Intronic
1022257150 7:28670324-28670346 AGTCAGAAAACAGGTGAGTACGG - Intronic
1022332152 7:29390135-29390157 AGTGAGAAAACACATGAAATGGG - Intronic
1022346796 7:29524643-29524665 AGTCAGAAACAAGGTGAGGATGG - Intergenic
1022676671 7:32506824-32506846 TGTCGGAAAACAGAAGAGGAGGG + Intronic
1022837245 7:34130054-34130076 AGGAAGAAAACAGGAGAGGAGGG - Intronic
1023488831 7:40715544-40715566 AGATAGAAAACACATGAGGGGGG - Intronic
1023502462 7:40865149-40865171 AAGGAGAAAAGAGAGGAGGAGGG - Intergenic
1024683922 7:51724372-51724394 AGTGCGAAAGGAGCTGAGGAAGG - Intergenic
1024771184 7:52725082-52725104 AGCGAGAGAAGAAATGAGGAAGG + Intergenic
1025031578 7:55561279-55561301 TGTGAGGAAGGAGATGAGGAAGG - Intronic
1026931634 7:74225998-74226020 AGAGAGAAAACAGATAGGGCTGG + Intronic
1027643602 7:80768593-80768615 AGTGAAAAAACATTTGGGGATGG + Intronic
1028219137 7:88174794-88174816 AGAGAGAAAAGAAATGGGGAAGG - Intronic
1028289972 7:89053650-89053672 AGGAAGAAAAGAGAAGAGGAAGG - Intronic
1028509437 7:91607612-91607634 AGGGAGAAATCACATTAGGATGG - Intergenic
1028654637 7:93190481-93190503 ATTGAGAAGACAGAAGAAGAAGG + Intronic
1028720691 7:94027524-94027546 TTTGAGAAAAAAGATAAGGATGG - Intergenic
1028965096 7:96793376-96793398 GGAGAGAAAACAGAGGAAGATGG + Intergenic
1029264705 7:99328967-99328989 AGAGAGAAAAGGGATGAGGGGGG + Intronic
1029337605 7:99915674-99915696 AGTGACTAAGCAGAGGAGGATGG + Intronic
1029813791 7:103074484-103074506 AGAGAGAAAACAGAGGGTGATGG - Exonic
1029829750 7:103244410-103244432 AGGAAGAAAACAGCAGAGGAAGG + Intergenic
1029986600 7:104928518-104928540 AGGGAGAAAACAGCCAAGGAGGG + Intergenic
1030916207 7:115316941-115316963 ATTGCCAAAACAAATGAGGAAGG + Intergenic
1031632350 7:124059555-124059577 ACCGAGAAAACAGAAGAGAATGG + Intergenic
1032484756 7:132277064-132277086 AGTGAGGAAGCAGGAGAGGAAGG + Intronic
1033382605 7:140837991-140838013 AGTGAGAAAACAGAGGAAAAGGG - Intronic
1035979308 8:4351618-4351640 AGTGAGAAAGGAGATGAGGGAGG + Intronic
1036790462 8:11714772-11714794 AGTTAGAAAAGAAATGGGGAGGG - Intronic
1037260984 8:17008048-17008070 AGTGAGAAAAATGATGGGCACGG + Intergenic
1037325276 8:17682680-17682702 GGAGAGAAAACAGTTGAGGATGG + Intronic
1039143059 8:34414965-34414987 AGTAAGAAAAAGCATGAGGATGG + Intergenic
1041470986 8:58208846-58208868 AGTGAGAAGAGAGAGGTGGAGGG - Intergenic
1042658694 8:71130499-71130521 AGAGATAAAAGAGATGGGGAGGG + Intergenic
1042765366 8:72315458-72315480 AATGAGAAAAGAGAAGGGGAGGG - Intergenic
1043143447 8:76620074-76620096 AGTGAGCCTACAGATCAGGAAGG + Intergenic
1043354989 8:79401604-79401626 AGTAATAAAATAGATGAGGCAGG - Intergenic
1044457874 8:92410037-92410059 AGAGAGAAAACAGATCAGCCAGG + Intergenic
1044477094 8:92639848-92639870 AGTGAGAAAGAAGACGAGGGAGG + Intergenic
1044944258 8:97376035-97376057 AGGGAGAAAAGAGAAGGGGATGG - Intergenic
1045089250 8:98722833-98722855 AGGGAGAAAACACATGAGAGAGG + Intronic
1045555550 8:103211594-103211616 AATGAGCAAACATTTGAGGAAGG - Intronic
1046258734 8:111737466-111737488 ACTGAGAAGTGAGATGAGGAGGG + Intergenic
1046303480 8:112329599-112329621 AGTGAGACAACATATGATGAGGG - Intronic
1046878573 8:119282961-119282983 AGTGAGAAAACCTATGATGCTGG + Intergenic
1046980352 8:120330222-120330244 AGTCAGAAACCAGATAAGGCAGG - Intronic
1047309777 8:123682546-123682568 AGTGAGAGAAATGATCAGGATGG + Intronic
1047717646 8:127610471-127610493 AGTGAAAAAATAGCTGAGCATGG - Intergenic
1047802004 8:128319543-128319565 AGTGGGAAAAGAGATGGAGAAGG - Intergenic
1047963228 8:130026023-130026045 AGTGAAGCAACAGATCAGGAAGG + Intergenic
1048412430 8:134189228-134189250 AGAGAGAAAAAAAATGAGAAAGG - Intergenic
1048887802 8:138922663-138922685 AGTGTGAGAACAGATTAAGACGG + Intergenic
1049011527 8:139890593-139890615 ACTGAGAAAACAGACCGGGAAGG - Intronic
1050279834 9:4038953-4038975 AGTGAGAGAAGACATGGGGAGGG - Intronic
1050399282 9:5233906-5233928 ATTGAGAATACATATGAGAATGG - Exonic
1050714634 9:8508992-8509014 AGAGAGAGAAAAGATGATGAAGG - Intronic
1051198138 9:14586367-14586389 AGTGAGGAAAAAGAAGAGAAAGG - Intergenic
1051426512 9:16937481-16937503 AGTCAGCAAATAGATGAGTAGGG - Intergenic
1051438481 9:17057414-17057436 AGGGAGGCAACAGATGAGGGAGG + Intergenic
1051909238 9:22134115-22134137 AGCCAGAAGACAGATCAGGAGGG - Intergenic
1052559726 9:30069908-30069930 AGTGAGGTTACAGATGAGCAAGG + Intergenic
1053195293 9:36113088-36113110 AGTGAGGAAACAGCAGAGAAAGG - Intronic
1054784735 9:69199999-69200021 AGTGTGAAAACTGGAGAGGAAGG - Intronic
1054989005 9:71299522-71299544 AGGGAGAAAAAAGAAAAGGAAGG + Intronic
1054999906 9:71437181-71437203 AATGAGAAAATAGTTGATGAAGG + Intronic
1055268496 9:74527765-74527787 AGTGACAAAACAGATTTGAAGGG - Intronic
1055312462 9:74997171-74997193 TTTGAGAGAACAGATGATGAAGG - Intronic
1055688796 9:78807949-78807971 AGGGAGAAAATAAATGGGGAGGG - Intergenic
1055690638 9:78826703-78826725 AGTGAGAGAGCAGAAGAGGGAGG + Intergenic
1055819851 9:80248619-80248641 AGTGAAACAACAGATAAGGTGGG + Intergenic
1056363898 9:85884105-85884127 AGATAGGTAACAGATGAGGAAGG - Intergenic
1056783608 9:89571615-89571637 AGTGAGAAAACTCAAGAGAAAGG + Intergenic
1057598585 9:96437643-96437665 GGTGAGAAAACTGAGGAGCAGGG - Intergenic
1057635187 9:96758105-96758127 AGTGAAAATACAGATAAGGGGGG + Exonic
1058059900 9:100484224-100484246 ATTTAGAAAAAAGATGATGATGG - Intronic
1058726578 9:107810417-107810439 AGTGAGAAAACATCTGTGGTTGG + Intergenic
1058955273 9:109941086-109941108 AGGAAGAAAAAAGAAGAGGAAGG - Intronic
1059238434 9:112782388-112782410 AGTAGGTAAACAAATGAGGATGG - Intronic
1059660917 9:116399148-116399170 AGTGTGAAAATAGATGATGATGG - Exonic
1059900684 9:118921798-118921820 AGGGAGAAATCAGATGAGGTGGG - Intergenic
1060259837 9:122064760-122064782 AGTAAGAAGACAAAGGAGGAGGG + Intronic
1060576861 9:124703773-124703795 TTTTAGAAAACAGAAGAGGAAGG - Intronic
1060689613 9:125645351-125645373 AGTGAGAACGCAGATGACAATGG + Intronic
1061079468 9:128361320-128361342 AGTGAATGAACAGATGAGGCGGG - Exonic
1185626491 X:1486527-1486549 AGAGAGAAAGCAGATGACCATGG + Intronic
1185701178 X:2231545-2231567 AGAGAGAAAAAGGAAGAGGAAGG - Intronic
1185755769 X:2651917-2651939 AGAGAGAAAGAAGATGAGGGAGG - Intergenic
1186076718 X:5887585-5887607 AGTGAGAAGACAGAGGAAGTTGG - Intronic
1186275250 X:7931127-7931149 AGTGAGGGAATAGATGAAGAAGG + Intergenic
1186503241 X:10068924-10068946 TTTGAGAAAACAGAAGAGGAAGG - Intronic
1186785983 X:12956249-12956271 CCTGGGAAAACAGATGAGGCTGG - Intergenic
1186800780 X:13090481-13090503 AGTGGGAAAACAGACAATGACGG - Intergenic
1186814323 X:13221167-13221189 AGTGAGGAAACACATGAAGCAGG - Intergenic
1186985630 X:15010760-15010782 AGTGAGAAAAGAAAGAAGGAAGG + Intergenic
1187087094 X:16051956-16051978 AAAGAGAAAACAGAAGAGGTAGG - Intergenic
1187245872 X:17552527-17552549 AGGGAGAAAGAAGATGAGGAAGG + Intronic
1187331491 X:18344306-18344328 ACTGATAAGACAGAAGAGGAGGG - Intronic
1187543326 X:20221604-20221626 AGTGAGAAAACGAATGGGTAAGG + Intronic
1187578730 X:20585981-20586003 AGTAAGATAAGAGATGAGGCTGG + Intergenic
1187786583 X:22894955-22894977 AGAGAGAAAAAGGCTGAGGATGG - Intergenic
1188211624 X:27432424-27432446 AGGGAGAAAACAGAAGAGGATGG + Intergenic
1188382734 X:29516925-29516947 AGTGAGCAAACAAATGCTGAGGG - Intronic
1188382828 X:29518527-29518549 AGTGAGCAAAGATATGAAGAAGG + Intronic
1188487008 X:30692942-30692964 AATAAGAATACAGATGGGGAGGG + Intronic
1189000304 X:36937146-36937168 AGAGAGAAAAGAAAAGAGGAAGG + Intergenic
1189238258 X:39505550-39505572 TGTGGGAAGACAGATGAGAAGGG - Intergenic
1189326882 X:40118005-40118027 AGAGAGAAGACAGATAGGGAGGG - Intronic
1190321462 X:49182305-49182327 AGTGAGGAACCTGATGATGATGG - Intronic
1191671331 X:63751315-63751337 AGAGAGAAGGCAGAGGAGGAAGG + Intronic
1191728212 X:64304105-64304127 AGTCAGAAAACATTTCAGGAAGG - Intronic
1192454045 X:71262800-71262822 AGTAAGAATACAGATGGGCACGG - Intergenic
1192589692 X:72349720-72349742 AGTGAGAGAAGACATAAGGAAGG - Intronic
1192746488 X:73943934-73943956 AGTGAGATAACAGAAGTGAATGG + Intergenic
1192805514 X:74505323-74505345 AATGAGGAAACAGCAGAGGAAGG - Intronic
1193754395 X:85389468-85389490 AGTGAGATAACATCTCAGGATGG + Intergenic
1194189500 X:90817322-90817344 ATTGAGAAAACAAATGGTGATGG - Intergenic
1194426677 X:93747449-93747471 AGGGAGAAAAAAGATGATGAAGG + Intergenic
1195034391 X:100958582-100958604 TTTGAGAAAAGAGAGGAGGAGGG + Intergenic
1195666950 X:107440438-107440460 ACTGAGCAAACAGAAGAGGGAGG + Intergenic
1195710967 X:107773649-107773671 AGTGAAATAATAGATGAGAAAGG + Intronic
1195767462 X:108311492-108311514 AGAGAGAAAGGAGATGAGGTTGG - Intronic
1196599653 X:117587186-117587208 ACTCAAAAAACAGGTGAGGAGGG - Intergenic
1196682666 X:118484626-118484648 AGAAAGCAAATAGATGAGGATGG - Intergenic
1196742400 X:119036756-119036778 AGAAAGCAAATAGATGAGGATGG - Intergenic
1197015856 X:121625437-121625459 AGTGAGAATACAGAACAGTAAGG + Intergenic
1197293474 X:124688214-124688236 AGGGAGAAAAGAGAAGAGAAGGG - Intronic
1197421733 X:126243986-126244008 TGGCAGAAAACAAATGAGGATGG - Intergenic
1197696206 X:129553149-129553171 AGAGAGAAACTAGATGAGTATGG + Intronic
1197728113 X:129789655-129789677 AGAGAGAAAACAGAGAAGGCTGG + Intronic
1197783294 X:130177348-130177370 AGTGAAATAACACATGAGAAAGG - Intronic
1197841480 X:130752200-130752222 ATAGAGGAAACAGATGGGGAGGG - Intronic
1198026936 X:132716132-132716154 TGTGAGAGAGGAGATGAGGAGGG - Intronic
1198681387 X:139186464-139186486 AGTGAGAAAGCTGATGCGGTGGG - Intronic
1198739435 X:139825188-139825210 GGAGAGAAAAAAAATGAGGAAGG + Intronic
1198932154 X:141872878-141872900 AGTGAGAGAAAAGATGGGGTGGG + Intronic
1199232762 X:145457696-145457718 AGCCAGAAAACTGAAGAGGAGGG - Intergenic
1199239091 X:145526010-145526032 AGTTAGAAAAGAGAAGAGTAGGG + Intergenic
1199265222 X:145820342-145820364 AAGGAGAAAACAGATAATGAAGG + Exonic
1199601367 X:149543314-149543336 GGTGGGAAACCAGATCAGGAGGG + Intronic
1199649010 X:149936170-149936192 GGTGGGAAACCAGATCAGGAGGG - Intronic
1199850429 X:151721969-151721991 CATGAGAAGACAGGTGAGGAGGG + Exonic
1200536080 Y:4399212-4399234 ATTGAGAAAACAAATGGTGATGG - Intergenic
1201853350 Y:18513485-18513507 AGTGAGAAATCAGTTGAAGTAGG - Intergenic
1201879971 Y:18806899-18806921 AGTGAGAAATCAGTTGAAGTAGG + Intronic
1202082414 Y:21097766-21097788 AGTGAGAAAACAGAGTACCATGG + Intergenic