ID: 990905504

View in Genome Browser
Species Human (GRCh38)
Location 5:60798412-60798434
Sequence GTATCAAGGTAATTGGGAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 139}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990905504_990905512 11 Left 990905504 5:60798412-60798434 CCTCCTCCCAATTACCTTGATAC 0: 1
1: 0
2: 1
3: 13
4: 139
Right 990905512 5:60798446-60798468 TTTTAACTTGCTGAGGGTGGAGG 0: 1
1: 0
2: 5
3: 88
4: 917
990905504_990905511 8 Left 990905504 5:60798412-60798434 CCTCCTCCCAATTACCTTGATAC 0: 1
1: 0
2: 1
3: 13
4: 139
Right 990905511 5:60798443-60798465 CTTTTTTAACTTGCTGAGGGTGG 0: 1
1: 0
2: 0
3: 23
4: 272
990905504_990905509 4 Left 990905504 5:60798412-60798434 CCTCCTCCCAATTACCTTGATAC 0: 1
1: 0
2: 1
3: 13
4: 139
Right 990905509 5:60798439-60798461 GAAGCTTTTTTAACTTGCTGAGG 0: 1
1: 0
2: 1
3: 20
4: 194
990905504_990905515 16 Left 990905504 5:60798412-60798434 CCTCCTCCCAATTACCTTGATAC 0: 1
1: 0
2: 1
3: 13
4: 139
Right 990905515 5:60798451-60798473 ACTTGCTGAGGGTGGAGGGGAGG 0: 1
1: 1
2: 4
3: 69
4: 886
990905504_990905514 13 Left 990905504 5:60798412-60798434 CCTCCTCCCAATTACCTTGATAC 0: 1
1: 0
2: 1
3: 13
4: 139
Right 990905514 5:60798448-60798470 TTAACTTGCTGAGGGTGGAGGGG 0: 1
1: 0
2: 0
3: 18
4: 177
990905504_990905513 12 Left 990905504 5:60798412-60798434 CCTCCTCCCAATTACCTTGATAC 0: 1
1: 0
2: 1
3: 13
4: 139
Right 990905513 5:60798447-60798469 TTTAACTTGCTGAGGGTGGAGGG No data
990905504_990905510 5 Left 990905504 5:60798412-60798434 CCTCCTCCCAATTACCTTGATAC 0: 1
1: 0
2: 1
3: 13
4: 139
Right 990905510 5:60798440-60798462 AAGCTTTTTTAACTTGCTGAGGG 0: 1
1: 0
2: 1
3: 36
4: 379

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990905504 Original CRISPR GTATCAAGGTAATTGGGAGG AGG (reversed) Intronic
901683129 1:10927601-10927623 GTAGCAAAATAATTAGGAGGTGG + Intergenic
903400623 1:23043515-23043537 TTATCTAGATCATTGGGAGGTGG + Intronic
905697799 1:39988325-39988347 GTATGCAGATAATTGTGAGGGGG - Intergenic
911239776 1:95452511-95452533 GTATCTAGGAAATTGGAAAGAGG - Intergenic
911239907 1:95453806-95453828 GTATCTAGGAAATTGGAAAGAGG - Intergenic
911565985 1:99464087-99464109 GTGTCACGGTGACTGGGAGGTGG - Intergenic
914237922 1:145829250-145829272 GGAGCAAGATATTTGGGAGGAGG - Intronic
915813122 1:158937168-158937190 GTTAAAAGGTAATTGGGAAGAGG + Exonic
915820178 1:159014938-159014960 GTTAAAAGGTAATTGGGAAGAGG + Exonic
916767266 1:167873441-167873463 GTGTCAAGGCAATTAAGAGGAGG - Intronic
916871654 1:168921238-168921260 ATATCTAGGTAAGTGGGAGATGG + Intergenic
917586997 1:176437331-176437353 ATATCAGGATAATTGGGAGAGGG - Intergenic
919745018 1:201003462-201003484 GGATGATGGTAATAGGGAGGTGG + Intronic
921034939 1:211367996-211368018 GTATCATGGAACTTGAGAGGTGG + Intronic
923938144 1:238787881-238787903 GTTTAAAGGAAATTGGGAAGAGG - Intergenic
924330774 1:242938414-242938436 GTTTCTAGGTAATTCTGAGGTGG - Intergenic
1064133841 10:12733205-12733227 GTATGAAGGTAAATTGGAGGAGG + Intronic
1069814957 10:71188047-71188069 GCATCTAGGGACTTGGGAGGAGG - Intergenic
1076543046 10:131226371-131226393 GTTTCAAGGAAATTGGTAGCCGG - Intronic
1077031304 11:469141-469163 GTCTCTGGGTAATTGGAAGGAGG + Intronic
1077905912 11:6533439-6533461 TCATCAAGGTAATGGGGTGGTGG + Intronic
1082240338 11:49862992-49863014 GAATAAAGGTAAAAGGGAGGAGG - Intergenic
1084110889 11:67013603-67013625 GTAACAAGGTAACTGGCTGGTGG - Intronic
1085311829 11:75521311-75521333 CTTTCAAGGTACTTGGGTGGAGG + Intronic
1085794037 11:79520422-79520444 GCATCAAGGACATGGGGAGGTGG - Intergenic
1086251631 11:84822251-84822273 GTATCAATGCAACTGGGAGTAGG - Intronic
1089492092 11:118890165-118890187 CCATCAAGGTTATTGGGAGAAGG + Intronic
1090739131 11:129641314-129641336 GTAGCAGGGCATTTGGGAGGAGG - Intergenic
1091453898 12:591075-591097 CTATCAAGGTTATAGGGAGGTGG + Intronic
1093165678 12:15802620-15802642 TTATCAAGGGAATGGGCAGGAGG + Intronic
1094395078 12:29996800-29996822 GTATGGATGTAATTGGGAGTAGG - Intergenic
1098419552 12:70279566-70279588 GAGTCAAGGTAATTGGAAGTGGG - Intronic
1099310074 12:81008235-81008257 GCATCAAGGAAAATGGGAGTGGG + Intronic
1099961656 12:89402859-89402881 TTAGCCAGGTATTTGGGAGGAGG - Intergenic
1101842871 12:108340539-108340561 GGAGGAAGGTAATGGGGAGGAGG + Intergenic
1109968350 13:69732045-69732067 TTATAAAGGTGATTGGAAGGAGG + Intronic
1118208535 14:63745799-63745821 GTATGAGGGCAGTTGGGAGGGGG - Intergenic
1120103915 14:80473390-80473412 CCATCAAAGTAACTGGGAGGGGG - Intergenic
1120884497 14:89441305-89441327 GGGTTCAGGTAATTGGGAGGAGG - Intronic
1123113729 14:105884502-105884524 GAATCCAGGCAATTGGCAGGAGG + Intergenic
1123115954 14:105894141-105894163 GAATCCAGGCAATTGGCAGGAGG + Intergenic
1123117982 14:105903251-105903273 GAATCCAGGCAATTGGCAGGAGG + Intergenic
1123512268 15:21011096-21011118 GAATCCAGGCAATTGGCAGGAGG + Intergenic
1124062007 15:26302190-26302212 GTATCAAAGAAATTAGGGGGAGG + Intergenic
1126913612 15:53441177-53441199 GTAACAATGCAATGGGGAGGAGG - Intergenic
1129882423 15:79016239-79016261 GTGTCAAAGTCATTGGGAAGTGG + Intronic
1130125491 15:81090576-81090598 GAATCATGGTATCTGGGAGGCGG - Intronic
1138581217 16:57941543-57941565 TTCTCAAGGTAATTTGGAGGAGG - Intronic
1139229674 16:65271763-65271785 ATGTGAAGGTAATTTGGAGGAGG + Intergenic
1143527733 17:7482221-7482243 GTAGCAGGGCAATAGGGAGGTGG - Exonic
1146731024 17:35194049-35194071 GTAGCAGGGCAATAGGGAGGTGG + Exonic
1148554820 17:48572218-48572240 GGAGCAAGGGAAATGGGAGGAGG - Intronic
1148689747 17:49520377-49520399 GTATCATGGGAATTGGGGAGTGG - Intergenic
1153140023 18:1960642-1960664 GTATAAAGGAAGGTGGGAGGAGG - Intergenic
1154115477 18:11609832-11609854 GTAGCAGGGCAATAGGGAGGTGG - Intergenic
1156071525 18:33216856-33216878 GTATTAAGTTATTTGGGTGGGGG + Intronic
1156844236 18:41645426-41645448 GCATCTATATAATTGGGAGGTGG + Intergenic
1161190330 19:2950959-2950981 TTATCAGGGTAATTGGGCGTTGG - Intergenic
1162861943 19:13512617-13512639 GTATCAAGATCTTTGGGAGGTGG + Intronic
1163722810 19:18906306-18906328 GTTTCCAGCTACTTGGGAGGCGG - Intronic
1165556763 19:36640255-36640277 CTCTCAAGGTAATTCAGAGGTGG - Intronic
1166617348 19:44262048-44262070 CTATTAAATTAATTGGGAGGAGG - Intronic
926124048 2:10260570-10260592 GTATAAAGGCAATTGGGGGATGG - Intergenic
926357812 2:12057261-12057283 GCTTCAAGGTAATTGGAAGATGG + Intergenic
926428821 2:12765536-12765558 GTATCAAGGTTATTGGAGTGAGG - Intergenic
928310582 2:30206256-30206278 TTATAAAAGTAACTGGGAGGTGG - Intergenic
928334384 2:30383756-30383778 ATATCAAGCTAATTTGGAGGTGG - Intergenic
930820868 2:55645549-55645571 TTTTCAAGGTAATAGGGATGTGG - Intronic
930919775 2:56738704-56738726 GTATCAAGATAGTTGCTAGGGGG + Intergenic
935446959 2:103167167-103167189 GTATCCAGGAAATAGGGATGTGG + Intergenic
938937780 2:136142496-136142518 TTAACAAGGTATTTGGGAGGAGG + Intergenic
938965140 2:136381610-136381632 GTGTGAAGATAATTGGGAGGAGG + Intergenic
939073741 2:137575280-137575302 CAAACAAGGTAAGTGGGAGGGGG - Intronic
939770729 2:146313227-146313249 TTAACCAGGAAATTGGGAGGAGG + Intergenic
940819686 2:158338975-158338997 GTATAAAGGTAAGTGTGATGTGG - Exonic
942669658 2:178361041-178361063 GTATGTAGGAAATGGGGAGGGGG + Intronic
1169560081 20:6790397-6790419 GTCTCAAGGGAAGTGGGAAGGGG + Intergenic
1170266897 20:14477075-14477097 GTGTCCAGAGAATTGGGAGGCGG + Intronic
1171244173 20:23596575-23596597 TTAGCAAGATAATTTGGAGGAGG + Intergenic
1171559992 20:26115644-26115666 ATTTCAAGGTATTTGGGAAGAGG + Intergenic
1172068208 20:32236483-32236505 GAATCAAGGTGATTTGGAGCTGG - Exonic
1174143838 20:48436509-48436531 ACATCACGGTACTTGGGAGGGGG - Intergenic
1176651050 21:9547201-9547223 ATTTCAAGGTATTTGGGAAGAGG - Intergenic
1177224940 21:18242340-18242362 GTTACAAGGTTATTGGGAGTTGG - Intronic
1177403333 21:20634575-20634597 GTGTGATGGTAATTAGGAGGTGG + Intergenic
1177915479 21:27083882-27083904 TTATCAAGCTGATTGGGAGAAGG + Intergenic
1180255040 21:46621131-46621153 CTGTGGAGGTAATTGGGAGGGGG + Intergenic
1181989630 22:26827615-26827637 ATATCAGGGGAATTGGAAGGGGG - Intergenic
1185014933 22:48337258-48337280 GTGTCAAGGTTATTGACAGGTGG - Intergenic
1185065257 22:48628871-48628893 GTGTCAAGTTAATTAGGAGATGG + Intronic
949670761 3:6397524-6397546 ATAGCAAGGTGCTTGGGAGGGGG - Intergenic
950325875 3:12109626-12109648 AAATCAAGGAAATTTGGAGGTGG - Intronic
950728781 3:14937770-14937792 GTATTAAGGTAAGTGGCACGGGG + Intergenic
951834853 3:26971715-26971737 GTATCCAGGTTTTTGGGTGGAGG + Intergenic
953794633 3:45975067-45975089 GTGTCAAGGACTTTGGGAGGAGG + Intronic
957115095 3:76014094-76014116 GTATAAAGGCAATTGGCAGCTGG + Intronic
957115145 3:76014451-76014473 GTATAAAGGCAATTGGCAGCTGG + Intronic
957222949 3:77408058-77408080 GTATCAGGGTAATTGGAGGGAGG + Intronic
958792314 3:98666038-98666060 GTTTCAAGGCACTTCGGAGGAGG - Intergenic
959808235 3:110584685-110584707 GTATCAAAGTACCTGGGAGGTGG - Intergenic
963438396 3:145303192-145303214 GCATCAACATCATTGGGAGGTGG + Intergenic
965922369 3:173932966-173932988 GTATAAAGGTAATGGGGTGGTGG + Intronic
969704581 4:8784806-8784828 GCAGCAAGGGAGTTGGGAGGAGG + Intergenic
969964853 4:10983629-10983651 GTATCAACTTAATGAGGAGGAGG + Intergenic
972148319 4:36057459-36057481 TTATCTAGAAAATTGGGAGGAGG - Intronic
974175572 4:58317714-58317736 GTGTCAAGTTGATTGGGAAGTGG + Intergenic
978062449 4:104354458-104354480 GTATGAAGGAAGTAGGGAGGGGG + Intergenic
978535732 4:109760306-109760328 GTATCAATGCAATGGTGAGGTGG - Exonic
979445581 4:120808355-120808377 GTATCTAGCTAATGGGGACGTGG - Intronic
982558551 4:156900337-156900359 GTATCAAGGTAACTGGCATGTGG - Intronic
988053899 5:26067061-26067083 ATATTAAGGTGATTTGGAGGAGG - Intergenic
990377952 5:55191887-55191909 CAATCAACGTTATTGGGAGGTGG + Intergenic
990905504 5:60798412-60798434 GTATCAAGGTAATTGGGAGGAGG - Intronic
993408598 5:87545497-87545519 GTAAGAAGGTAATTGGGAAAAGG + Intergenic
996295650 5:121912478-121912500 GTATAAAGGTAGTTGAGAAGAGG - Intergenic
996664500 5:126043139-126043161 ATATCAAGGTAATGGTGTGGAGG - Intergenic
1001948395 5:175798460-175798482 GTATCAAGGCAACTGGGCTGTGG + Intronic
1003571509 6:7259300-7259322 GCATCAAGGGCATTTGGAGGTGG + Intergenic
1005595999 6:27380026-27380048 GTATCAAGGTATAGGGGAAGGGG - Intronic
1005699760 6:28388617-28388639 GTAGAAAGGTAATTAGGAGTGGG + Intronic
1005965721 6:30725068-30725090 GGATCAAGGGGGTTGGGAGGGGG + Exonic
1011028503 6:82895427-82895449 TTGTCAACGTAACTGGGAGGGGG + Intronic
1011892856 6:92188893-92188915 TTATTAAGGTACTTGGTAGGTGG + Intergenic
1016667376 6:146657679-146657701 GTATCAGGGTCATGGGCAGGAGG + Intronic
1017813662 6:158001776-158001798 GGGTCAAGGTCACTGGGAGGGGG - Intronic
1019936513 7:4261729-4261751 GTATCAAGGGAACTGGGGAGGGG - Intronic
1020719350 7:11721941-11721963 GTATTAAAGGAATTGGGAAGGGG - Intronic
1021753635 7:23829618-23829640 GTATCAAGGTAATGGTGGGCTGG + Intronic
1024921167 7:54556413-54556435 ATGTCAAAGTCATTGGGAGGAGG + Intronic
1028818129 7:95172934-95172956 GTACCAAGGTAATTCCGTGGAGG + Intronic
1029237256 7:99131450-99131472 GAATCAAGGAAATGGGTAGGTGG + Intronic
1029955415 7:104633879-104633901 GTAGCAAGGAAATAGGGTGGAGG - Intronic
1032218065 7:129972627-129972649 ACATCCAGCTAATTGGGAGGTGG - Intergenic
1032240894 7:130157999-130158021 GTATCTAGGTGACTGGGAAGAGG - Intergenic
1033722059 7:144071153-144071175 GTAGCAGGGGTATTGGGAGGAGG - Intergenic
1036737511 8:11331343-11331365 GTAGCAGGGCAATAGGGAGGTGG - Exonic
1038174546 8:25168421-25168443 GTAACTAGGTAATTGGGCTGTGG + Intergenic
1041725219 8:61011840-61011862 GTAACAAAGTAATTGGGTGTTGG + Intergenic
1044006835 8:86947892-86947914 GTAGCAGGGTGGTTGGGAGGAGG - Intronic
1045427197 8:102078762-102078784 GTAATAAGGTAATTGGATGGGGG - Intronic
1047138782 8:122111518-122111540 GTACCAAGGTAATTCAAAGGGGG - Intergenic
1047183904 8:122614798-122614820 GTAACAAGGAAATTGTCAGGAGG - Intergenic
1055047044 9:71937520-71937542 GTAACAAGGAAAATGGGAGGAGG + Intronic
1058032028 9:100210426-100210448 ATATCAAAGAAATTGGGAGCAGG + Intronic
1203628784 Un_KI270750v1:50751-50773 ATTTCAAGGTATTTGGGAAGAGG - Intergenic
1185819271 X:3185989-3186011 GTAGCAAGGTTATTGTGAAGAGG + Intergenic
1187386717 X:18855632-18855654 GAATAAAGGTAATGGGGATGGGG - Intergenic
1189267907 X:39730614-39730636 GGATCAAGGGAATTGGGGAGGGG - Intergenic
1189780862 X:44513284-44513306 ATTTCAAAATAATTGGGAGGGGG + Intergenic
1190005763 X:46736597-46736619 GTATTAATGTAATCAGGAGGTGG + Intronic
1194462351 X:94187455-94187477 GTGTAAAGGTAATTGGGAGGAGG - Intergenic
1195793270 X:108614246-108614268 GTTGCCAGGTAATTGGGATGTGG + Intronic
1198712000 X:139514561-139514583 GTATCAAGATAATTCAAAGGGGG - Intergenic
1200310672 X:155073693-155073715 GTATCAAGGAAAGTGGGAGAAGG - Intronic