ID: 990905505

View in Genome Browser
Species Human (GRCh38)
Location 5:60798415-60798437
Sequence GTAGTATCAAGGTAATTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 140}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990905505_990905515 13 Left 990905505 5:60798415-60798437 CCTCCCAATTACCTTGATACTAC 0: 1
1: 0
2: 0
3: 8
4: 140
Right 990905515 5:60798451-60798473 ACTTGCTGAGGGTGGAGGGGAGG 0: 1
1: 1
2: 4
3: 69
4: 886
990905505_990905511 5 Left 990905505 5:60798415-60798437 CCTCCCAATTACCTTGATACTAC 0: 1
1: 0
2: 0
3: 8
4: 140
Right 990905511 5:60798443-60798465 CTTTTTTAACTTGCTGAGGGTGG 0: 1
1: 0
2: 0
3: 23
4: 272
990905505_990905512 8 Left 990905505 5:60798415-60798437 CCTCCCAATTACCTTGATACTAC 0: 1
1: 0
2: 0
3: 8
4: 140
Right 990905512 5:60798446-60798468 TTTTAACTTGCTGAGGGTGGAGG 0: 1
1: 0
2: 5
3: 88
4: 917
990905505_990905509 1 Left 990905505 5:60798415-60798437 CCTCCCAATTACCTTGATACTAC 0: 1
1: 0
2: 0
3: 8
4: 140
Right 990905509 5:60798439-60798461 GAAGCTTTTTTAACTTGCTGAGG 0: 1
1: 0
2: 1
3: 20
4: 194
990905505_990905510 2 Left 990905505 5:60798415-60798437 CCTCCCAATTACCTTGATACTAC 0: 1
1: 0
2: 0
3: 8
4: 140
Right 990905510 5:60798440-60798462 AAGCTTTTTTAACTTGCTGAGGG 0: 1
1: 0
2: 1
3: 36
4: 379
990905505_990905514 10 Left 990905505 5:60798415-60798437 CCTCCCAATTACCTTGATACTAC 0: 1
1: 0
2: 0
3: 8
4: 140
Right 990905514 5:60798448-60798470 TTAACTTGCTGAGGGTGGAGGGG 0: 1
1: 0
2: 0
3: 18
4: 177
990905505_990905513 9 Left 990905505 5:60798415-60798437 CCTCCCAATTACCTTGATACTAC 0: 1
1: 0
2: 0
3: 8
4: 140
Right 990905513 5:60798447-60798469 TTTAACTTGCTGAGGGTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990905505 Original CRISPR GTAGTATCAAGGTAATTGGG AGG (reversed) Intronic
901248339 1:7751601-7751623 GCAATATCAAAATAATTGGGTGG - Intronic
903067324 1:20707646-20707668 GTAGTTCCAAGCTACTTGGGAGG + Intronic
907107762 1:51899668-51899690 GTAGTAACAAGGGATGTGGGGGG - Intergenic
907767939 1:57429032-57429054 GTAGTCCCAAGATACTTGGGAGG - Intronic
908198086 1:61765503-61765525 GTAATTCCAAGGTACTTGGGAGG - Intronic
908962073 1:69710155-69710177 GTAGTCCCAAGGTACTTGGGAGG + Intronic
909336960 1:74486414-74486436 GTAGTATCAATATAATTTGCTGG + Intronic
911606490 1:99911562-99911584 GTAGTCCCCAGGTACTTGGGAGG - Intronic
913153772 1:116073722-116073744 ATATTATCAAGGAAATGGGGGGG - Intergenic
913244260 1:116857852-116857874 GTAGTCCCCAGGTACTTGGGAGG - Intergenic
914345125 1:146792410-146792432 GTAGTCCCAAGCTACTTGGGAGG + Intergenic
917167365 1:172127528-172127550 GTAGTCCCAAGCTACTTGGGAGG - Intronic
921436983 1:215135077-215135099 GTAGTATAATGCTAATTAGGAGG - Intronic
923594237 1:235348351-235348373 GTAGTCTCCAGCTACTTGGGAGG - Intergenic
924330775 1:242938417-242938439 GTAGTTTCTAGGTAATTCTGAGG - Intergenic
1064133840 10:12733202-12733224 GTAGTATGAAGGTAAATTGGAGG + Intronic
1064407211 10:15074754-15074776 TTGGTATAAAAGTAATTGGGAGG + Intergenic
1065331383 10:24603872-24603894 GTAATCTCAAGCTACTTGGGAGG + Intronic
1065622279 10:27594429-27594451 GTAGTCTCAAGCTACTTGAGAGG + Intergenic
1072238109 10:93470520-93470542 GTAGTCCCAAGCTACTTGGGAGG - Intronic
1072334299 10:94383993-94384015 GTAGTCCCAAGCTACTTGGGAGG - Intergenic
1074466649 10:113689267-113689289 ATAGAATCAAGGTAAAGGGGTGG - Intronic
1078765500 11:14292984-14293006 GTAGTCCCAAGCTACTTGGGAGG + Intronic
1080112635 11:28585635-28585657 GTAGTATCAAGATAATCAAGTGG + Intergenic
1084908968 11:72372348-72372370 GTAAAATAAAGGTTATTGGGAGG - Intronic
1086199187 11:84179927-84179949 GTAGTGGCAAGGTATTGGGGAGG - Intronic
1088369936 11:109077917-109077939 ATAGTATCAAGGAACTTGGAAGG + Intergenic
1089033547 11:115359911-115359933 GAAATATCAAGGCAATTGTGAGG - Intronic
1090006437 11:123006815-123006837 GAAGTATTTAGGTAATTAGGCGG + Intergenic
1091453856 12:590700-590722 TTACTATCAAGGTTATAGGGAGG + Intronic
1091453863 12:590762-590784 TTACTATCAAGGTTATAGGGAGG + Intronic
1091453870 12:590824-590846 TTACTATCAAGGTTACTGGGAGG + Intronic
1091453877 12:590886-590908 TTACTATCAAGGTTATAGGGAGG + Intronic
1091453884 12:590948-590970 TTACTATCAAGGTTACTGGGAGG + Intronic
1091453891 12:591010-591032 TTACTATCAAGGTTATAGGGAGG + Intronic
1091601433 12:1920050-1920072 GTAGTATCAGAGTAATCTGGTGG + Intergenic
1095767956 12:45917622-45917644 GTGGTCTCAAGATACTTGGGAGG - Intergenic
1096118824 12:49073021-49073043 GTAGTCTCAAGCTACTTGGAAGG + Intergenic
1097313117 12:58142825-58142847 TTAGAATCAAGGTAATAGGCTGG - Intergenic
1098775403 12:74607629-74607651 GTATTATGCAGGTTATTGGGAGG + Intergenic
1099582045 12:84461553-84461575 GCAGAAACAAGGAAATTGGGAGG - Intergenic
1100147030 12:91690813-91690835 GTAGTACCAAGGAAATGCGGTGG + Intergenic
1103426586 12:120840708-120840730 GTAGTCCCAAGCTATTTGGGGGG + Intronic
1103665811 12:122564587-122564609 GTAGTCCCAAGCTACTTGGGAGG - Intronic
1106332576 13:28753142-28753164 GTAGTTTCCAGCTACTTGGGAGG + Intergenic
1108534298 13:51357669-51357691 CTAGTATCAAGGAGACTGGGGGG - Intronic
1110006131 13:70272644-70272666 GTGGACTCAAGGTAATTGGTGGG - Intergenic
1111798640 13:92956178-92956200 GTAGTGTCAAGCTACTGGGGAGG - Intergenic
1112179981 13:97069044-97069066 GAAGTATAATGGTAAGTGGGGGG - Intergenic
1115949730 14:38707323-38707345 GTAGTCCCAAGCTACTTGGGAGG - Intergenic
1117798700 14:59421597-59421619 TTAGTTTCAAGATAATTGGTTGG + Intergenic
1117923284 14:60748073-60748095 GTAGTCCCAAGCTACTTGGGAGG + Intronic
1127923708 15:63517202-63517224 AAAATATCAAGGAAATTGGGGGG - Intronic
1129186876 15:73913237-73913259 GTAGTCCCAAGCTACTTGGGAGG - Intergenic
1129292127 15:74576535-74576557 GTAGTCCCAAGCTACTTGGGAGG + Intronic
1129565266 15:76615322-76615344 GTAGTCCCAAGCTACTTGGGAGG + Intronic
1130579926 15:85127073-85127095 GTAGTCCCAAGCTACTTGGGAGG + Intronic
1130646418 15:85731124-85731146 GTAGTCCCAAGCTACTTGGGTGG - Intronic
1133728313 16:8557316-8557338 GTAGTATCAGGGCTTTTGGGAGG - Intergenic
1134419842 16:14076311-14076333 GTAGTCCCAAGCTACTTGGGAGG - Intronic
1135032834 16:19052305-19052327 GTAGTATCAAGTTACTCAGGAGG - Intronic
1139191150 16:64865060-64865082 GTACTACCAAGGAAATTGAGAGG - Intergenic
1139988869 16:70922886-70922908 GTAGTCCCAAGCTACTTGGGAGG - Intronic
1141231186 16:82169380-82169402 GTAGTCTCTAGGTTACTGGGAGG - Intronic
1143832580 17:9664201-9664223 GTAGAATCTAGGTGATGGGGAGG - Intronic
1146042582 17:29471002-29471024 GTAATTCCAAGGTACTTGGGAGG + Intronic
1148922322 17:51049716-51049738 GTAGTACCCAGCTACTTGGGAGG - Intronic
1150905230 17:69329212-69329234 GTAGTATGTAGGCAATTGGGAGG - Intergenic
1151265367 17:72951138-72951160 GTAGTCTCAAGCTACTTGGGAGG + Intronic
1155084433 18:22443563-22443585 GTGGTTACAAGGTGATTGGGTGG + Intergenic
1156071522 18:33216853-33216875 GGAGTATTAAGTTATTTGGGTGG + Intronic
1163259072 19:16175932-16175954 GTGGTATCCAGCTACTTGGGAGG + Intergenic
1163280460 19:16313397-16313419 GTAGTTCCAAGCTACTTGGGAGG + Intergenic
1164948825 19:32318949-32318971 GTATTTTCAGGGTAAATGGGGGG - Intergenic
1166070134 19:40382222-40382244 GTAGTTCCAAGCTACTTGGGAGG - Intronic
925690838 2:6521628-6521650 TTAGTATTAAGGGACTTGGGTGG - Intergenic
926661379 2:15470837-15470859 GTAGTCCCAAGCTACTTGGGAGG + Intronic
927563836 2:24093735-24093757 GTAGTCCCAAGCTACTTGGGAGG - Intronic
927583330 2:24275307-24275329 GTAGTCCCAAGCTATTTGGGAGG - Intronic
927646848 2:24882936-24882958 GTAGTCCCAAGTTATTTGGGAGG + Intronic
928334385 2:30383759-30383781 TTAATATCAAGCTAATTTGGAGG - Intergenic
929716996 2:44322267-44322289 GTAGTTTCAAGGCAAAAGGGAGG + Intronic
930083355 2:47473107-47473129 GTAGTCCCAAGCTACTTGGGAGG - Intronic
939344322 2:140943625-140943647 TTAGTTTCCATGTAATTGGGTGG - Intronic
939344516 2:140946477-140946499 GTAGTCCCAAGCTACTTGGGAGG + Intronic
941643186 2:168011175-168011197 GTAGTCCCAAGCTATTTGGGAGG + Intronic
944784656 2:203056686-203056708 GTAATATCCAGCTACTTGGGAGG - Intronic
945120352 2:206451196-206451218 GTAGTAGCAGGTTATTTGGGTGG + Intronic
946511839 2:220366358-220366380 GTAAGATCAAGGTAATTCTGAGG + Intergenic
946667891 2:222070063-222070085 ATAGTAACAAAGTATTTGGGAGG + Intergenic
1175068237 20:56308814-56308836 GTAGAATCAAGGGGATTGGGTGG + Intergenic
1175609857 20:60341748-60341770 GTAGTACCCAGCTACTTGGGAGG + Intergenic
1175822915 20:61920783-61920805 GTGGTATCATGGTGATTGCGTGG + Intronic
1176768071 21:13039339-13039361 GTAGTCCCCAGCTAATTGGGAGG + Intergenic
1177278973 21:18953163-18953185 CTATTATCAAGTAAATTGGGTGG - Intergenic
1181135228 22:20760917-20760939 GTAGTCCCAAGTTACTTGGGAGG - Intronic
1182366640 22:29783693-29783715 GTAGTCTCCAGCTACTTGGGAGG - Intergenic
949217437 3:1586493-1586515 TTAGTTTCCATGTAATTGGGTGG - Intergenic
956598466 3:70994054-70994076 TTAGAATCAAGGAAATAGGGTGG + Intronic
961335194 3:126171886-126171908 GTAGTAGCAAGGTGTTTTGGTGG - Intronic
964062455 3:152539740-152539762 GTAGTATTGAGGTACTGGGGAGG - Intergenic
966236921 3:177712096-177712118 GTAGTAAGTAGGTAATTGAGAGG + Intergenic
968023486 3:195417474-195417496 ATAGCATCAAGGTATTTAGGAGG - Intronic
968822623 4:2866948-2866970 GTAGTCCCAAGCTACTTGGGAGG + Intronic
972561943 4:40236668-40236690 GTAGTCCCAAGCTACTTGGGAGG + Intronic
973895328 4:55406781-55406803 GTAGTTTCCAGCTATTTGGGAGG - Intronic
976772087 4:88664253-88664275 GTAGTCTCAAGCTATTTGGAAGG + Intronic
977287569 4:95128004-95128026 GTAGTGACAAGCTACTTGGGAGG - Intronic
979114146 4:116799707-116799729 GTAGTCTCAAGCTATTTGGAAGG + Intergenic
979692489 4:123574666-123574688 GTAGTCCCAAGCTACTTGGGAGG - Intergenic
980345336 4:131608838-131608860 GTAGTCCCAAGCTACTTGGGAGG + Intergenic
980527248 4:134006669-134006691 GTATGTTCAAGGTATTTGGGAGG + Intergenic
982121008 4:152143717-152143739 GTAGTTCCAAGCTACTTGGGAGG + Intergenic
990905505 5:60798415-60798437 GTAGTATCAAGGTAATTGGGAGG - Intronic
995582087 5:113613044-113613066 GAAGAATCAAGGTAAAAGGGAGG - Intergenic
997685973 5:135788380-135788402 ATAGTATCCAGGGAATTGAGAGG + Intergenic
1000638854 5:163677123-163677145 GTAGTCCCAAGCTACTTGGGAGG + Intergenic
1003186030 6:3831222-3831244 GGAGTATCAAAGCATTTGGGGGG + Intergenic
1004536765 6:16510613-16510635 GTAGTCCCAAGCTACTTGGGAGG + Intronic
1006274079 6:32987443-32987465 GTAGTCTCCAGCTACTTGGGAGG - Intergenic
1006676587 6:35768956-35768978 GTAGTCCCAAGCTACTTGGGAGG - Intergenic
1007226232 6:40316890-40316912 GTAGTTTCCAGCTACTTGGGAGG - Intergenic
1008323798 6:50151577-50151599 GTAGTGCCAAGGGAATTGGAGGG - Intergenic
1011728982 6:90241011-90241033 GTAGTCTCCAGCTACTTGGGAGG + Intronic
1012974425 6:105764845-105764867 GTAATATCAGGGCAATGGGGTGG - Intergenic
1019858242 7:3631052-3631074 GTAGTCCCAAGCTACTTGGGAGG - Intronic
1023841474 7:44100938-44100960 GTAATATCCAGGCACTTGGGCGG + Intergenic
1024899676 7:54304569-54304591 GTTGTTTCAAGGGATTTGGGAGG + Intergenic
1026850602 7:73720980-73721002 GTAATCTCAAGCTACTTGGGAGG - Intergenic
1029983869 7:104903584-104903606 GTAGTCTCAAGCTACTTGGGAGG - Intronic
1031337738 7:120557225-120557247 ATAAAATCAGGGTAATTGGGAGG + Intronic
1039697054 8:39924243-39924265 GTAGTTTCCAGCTACTTGGGAGG + Intronic
1042911362 8:73830605-73830627 GTAGTCTCAAGCTACTTGGGAGG - Intronic
1044012361 8:87010213-87010235 GAAGTACCAAGGGAAGTGGGGGG - Intronic
1044510574 8:93073701-93073723 GTAATATATAGTTAATTGGGTGG - Intergenic
1047447698 8:124934136-124934158 GTAGTCTTCAGGTACTTGGGAGG + Intergenic
1048784564 8:138036785-138036807 GTAGTATCAAGAGAGTGGGGTGG - Intergenic
1048854184 8:138672760-138672782 GCAGCATCAAGGAAATTGGGAGG - Intronic
1050107071 9:2176671-2176693 GTAGTCCCAAGCTACTTGGGAGG - Intronic
1051269415 9:15340869-15340891 GTAGTCCCAAGCTACTTGGGAGG - Intergenic
1051756233 9:20403938-20403960 GTAGTCCCAAGCTACTTGGGAGG - Intronic
1055047043 9:71937517-71937539 GCAGTAACAAGGAAAATGGGAGG + Intronic
1186059145 X:5684990-5685012 GTAGTCCCAAGCTATTTGGGAGG - Intergenic
1187268134 X:17756035-17756057 GTAGTGGCAGTGTAATTGGGAGG + Intergenic
1187321105 X:18238248-18238270 GTAGTGGCAGTGTAATTGGGAGG - Intergenic
1187469575 X:19556797-19556819 GTGGTAGCTAGCTAATTGGGAGG - Intronic
1189826142 X:44919968-44919990 TTAGTATCCAGATATTTGGGGGG + Intronic
1198531702 X:137554543-137554565 GTAGTCTCCAGCTACTTGGGAGG + Intergenic
1198879970 X:141269879-141269901 GTATGATAAAAGTAATTGGGAGG + Intergenic