ID: 990905506

View in Genome Browser
Species Human (GRCh38)
Location 5:60798418-60798440
Sequence TCTGTAGTATCAAGGTAATT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 152}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990905506_990905512 5 Left 990905506 5:60798418-60798440 CCCAATTACCTTGATACTACAGA 0: 1
1: 0
2: 0
3: 6
4: 152
Right 990905512 5:60798446-60798468 TTTTAACTTGCTGAGGGTGGAGG 0: 1
1: 0
2: 5
3: 88
4: 917
990905506_990905509 -2 Left 990905506 5:60798418-60798440 CCCAATTACCTTGATACTACAGA 0: 1
1: 0
2: 0
3: 6
4: 152
Right 990905509 5:60798439-60798461 GAAGCTTTTTTAACTTGCTGAGG 0: 1
1: 0
2: 1
3: 20
4: 194
990905506_990905515 10 Left 990905506 5:60798418-60798440 CCCAATTACCTTGATACTACAGA 0: 1
1: 0
2: 0
3: 6
4: 152
Right 990905515 5:60798451-60798473 ACTTGCTGAGGGTGGAGGGGAGG 0: 1
1: 1
2: 4
3: 69
4: 886
990905506_990905513 6 Left 990905506 5:60798418-60798440 CCCAATTACCTTGATACTACAGA 0: 1
1: 0
2: 0
3: 6
4: 152
Right 990905513 5:60798447-60798469 TTTAACTTGCTGAGGGTGGAGGG No data
990905506_990905514 7 Left 990905506 5:60798418-60798440 CCCAATTACCTTGATACTACAGA 0: 1
1: 0
2: 0
3: 6
4: 152
Right 990905514 5:60798448-60798470 TTAACTTGCTGAGGGTGGAGGGG 0: 1
1: 0
2: 0
3: 18
4: 177
990905506_990905510 -1 Left 990905506 5:60798418-60798440 CCCAATTACCTTGATACTACAGA 0: 1
1: 0
2: 0
3: 6
4: 152
Right 990905510 5:60798440-60798462 AAGCTTTTTTAACTTGCTGAGGG 0: 1
1: 0
2: 1
3: 36
4: 379
990905506_990905511 2 Left 990905506 5:60798418-60798440 CCCAATTACCTTGATACTACAGA 0: 1
1: 0
2: 0
3: 6
4: 152
Right 990905511 5:60798443-60798465 CTTTTTTAACTTGCTGAGGGTGG 0: 1
1: 0
2: 0
3: 23
4: 272
990905506_990905516 29 Left 990905506 5:60798418-60798440 CCCAATTACCTTGATACTACAGA 0: 1
1: 0
2: 0
3: 6
4: 152
Right 990905516 5:60798470-60798492 GAGGTGCTTAGAGATTAAAGTGG 0: 1
1: 0
2: 2
3: 10
4: 180

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990905506 Original CRISPR TCTGTAGTATCAAGGTAATT GGG (reversed) Intronic
903307209 1:22421351-22421373 TCTGTAGTTCCAATGTAACTGGG - Intergenic
904566452 1:31431422-31431444 TCTGTAAAATGAAGGTAATCAGG - Intronic
906920543 1:50059904-50059926 TCTATAGTGTCAAGGCAAATTGG + Intronic
907918523 1:58892589-58892611 TCTCTAGTATCAAGGTTCTTAGG - Intergenic
908384067 1:63623798-63623820 TCTGTAAAATTAAGGTTATTTGG - Intronic
911806310 1:102212134-102212156 TCTATAGTAGCAATGTAATCTGG - Intergenic
911821522 1:102429890-102429912 TCTGTAGTCTCAGTGTAAGTGGG + Intergenic
912358089 1:109072152-109072174 CCTGTAGTTTCAAGGGCATTTGG + Intronic
916871653 1:168921232-168921254 TTTGTAATATCTAGGTAAGTGGG + Intergenic
921573371 1:216804791-216804813 TCTGTAATATGAAGGTATCTCGG - Intronic
922842458 1:228654230-228654252 CCTGTAGTTTCCAGGTACTTAGG - Intergenic
924417659 1:243874715-243874737 TCTTTAGTATCATTGTTATTGGG + Intergenic
1063330642 10:5155616-5155638 TCTGTAGTATGCAGGGAAATGGG - Intergenic
1065637828 10:27748561-27748583 TCTGAAATGTCAGGGTAATTTGG - Intergenic
1072050256 10:91697388-91697410 TCTGTACTAGCAAAGTATTTAGG + Intergenic
1072331376 10:94356168-94356190 TCTGTAGTATGAAGTCATTTTGG - Intronic
1073993550 10:109291194-109291216 TCTCTACTATTAAGGTTATTTGG - Intergenic
1075204737 10:120437171-120437193 TTTGTAGTATCAAGGGCATGGGG + Intergenic
1076152962 10:128178163-128178185 TCTGTGGCACCAAGGGAATTCGG + Intergenic
1077704008 11:4466889-4466911 TCTGTAGCATCAATGTATCTTGG + Intergenic
1086273694 11:85098268-85098290 ACTGTAGAATCAAGGTACTTAGG - Intronic
1086756805 11:90574392-90574414 TCTGTAGTATATATGCAATTTGG - Intergenic
1087507546 11:99044842-99044864 TCTCTACTATCAATGTTATTAGG + Intronic
1088582420 11:111328864-111328886 TCTGTATTATCAATATACTTAGG - Intergenic
1091601432 12:1920047-1920069 GCTGTAGTATCAGAGTAATCTGG + Intergenic
1092414210 12:8277688-8277710 TCTGTATTTTCATTGTAATTTGG + Intergenic
1095202573 12:39401555-39401577 TCTGTAGAATCATGGGAACTTGG - Intronic
1098266395 12:68725414-68725436 TGTGTAGTGCCAAGGTAAATAGG + Intronic
1099419147 12:82431738-82431760 TCTGTAGTTTCAAGGTATGAAGG - Intronic
1100147029 12:91690810-91690832 TTTGTAGTACCAAGGAAATGCGG + Intergenic
1100511670 12:95280898-95280920 TCTGTAGCAACTAGGAAATTAGG + Intronic
1101388524 12:104278821-104278843 TCAGTTTTATAAAGGTAATTTGG - Intronic
1103665812 12:122564590-122564612 TCTGTAGTCCCAAGCTACTTGGG - Intronic
1105436711 13:20385689-20385711 TCTGTAGTATAAAGTGAACTTGG + Intergenic
1106828424 13:33551053-33551075 TCTGTGGTATAAAGGTATTGTGG - Intergenic
1115520910 14:34231974-34231996 TCTGTAGTATAATAGGAATTGGG + Intronic
1116969242 14:51047611-51047633 TCTGCAGTACAAAGGTAAGTAGG + Intronic
1202831797 14_GL000009v2_random:42589-42611 TCTCTAGTACCAAATTAATTTGG + Intergenic
1126266329 15:46757958-46757980 TCTGTAGTATTAAAATTATTAGG + Intergenic
1126403212 15:48295666-48295688 TCTGTTGTTTCAAGGTATTAAGG + Intronic
1130646419 15:85731127-85731149 TCTGTAGTCCCAAGCTACTTGGG - Intronic
1135032835 16:19052308-19052330 CCTGTAGTATCAAGTTACTCAGG - Intronic
1135289134 16:21219509-21219531 TCAGTAGTATAAAGGTAAAAAGG + Intergenic
1148689749 17:49520383-49520405 GCTGGAGTATCATGGGAATTGGG - Intergenic
1149134494 17:53348136-53348158 GATGTATTATGAAGGTAATTTGG + Intergenic
1150535291 17:66032392-66032414 TCTGCAGTATCAGTGTACTTAGG + Intronic
1151265366 17:72951135-72951157 CCTGTAGTCTCAAGCTACTTGGG + Intronic
1156276198 18:35584965-35584987 GCTGTAGTCTCAAGATAACTGGG + Intronic
1159318394 18:66811995-66812017 TCTGAATTATCAATTTAATTAGG + Intergenic
1168089784 19:54074955-54074977 TCTGTAGAATCAAGGGGCTTCGG + Exonic
1202640894 1_KI270706v1_random:85163-85185 TCTCTAGTACCAAATTAATTTGG - Intergenic
925552266 2:5089512-5089534 TTTGTAGTATCAAGGCATTCTGG - Intergenic
926966645 2:18422134-18422156 GCTGTAGTCTAAAGATAATTAGG - Intergenic
927665246 2:25027522-25027544 TGTGTTTTATCAAGGTACTTTGG - Intergenic
928334386 2:30383762-30383784 ACTTTAATATCAAGCTAATTTGG - Intergenic
931009246 2:57889137-57889159 TACAAAGTATCAAGGTAATTGGG + Intergenic
931648614 2:64448661-64448683 TGTGTTGTACCAAAGTAATTAGG - Intergenic
933472473 2:82743415-82743437 TCTGTATTGTCTAAGTAATTTGG - Intergenic
933525643 2:83435068-83435090 TCTGTCATTTCAAGGTTATTGGG - Intergenic
935851571 2:107226936-107226958 TCTCTAGTAGCATGTTAATTAGG + Intergenic
937695546 2:124804506-124804528 TTTGGAGTAACAGGGTAATTAGG + Intronic
939428372 2:142070963-142070985 TCTGTAAAATAAAGATAATTTGG - Intronic
941104079 2:161332724-161332746 TCTGTGGCATCAAGAGAATTTGG + Intronic
941643185 2:168011172-168011194 TCTGTAGTCCCAAGCTATTTGGG + Intronic
942741551 2:179186144-179186166 TTAGTATTATCAAGGCAATTAGG + Intronic
943217819 2:185061214-185061236 TATGAAGTATTAAGGTAACTAGG + Intergenic
947953376 2:234166875-234166897 TCTGTATTATAAAGCTAGTTGGG - Intergenic
1169286301 20:4310258-4310280 GCTGTAGGATCAAGGGCATTGGG - Intergenic
1169433045 20:5556654-5556676 TCTTTAGTATAAAGATATTTGGG - Intronic
1175146797 20:56903098-56903120 TCTGTAGAGTCGAGGTGATTGGG + Intergenic
1178399923 21:32276802-32276824 TCTGTAGTCCCAAGCTACTTGGG + Intronic
1179288331 21:39996977-39996999 TCTGTGGTATCAAGAGAATGGGG - Intergenic
1180361058 22:11896699-11896721 TCTCTAGTACCAAATTAATTTGG + Intergenic
1181990856 22:26835669-26835691 TATGTAGTATCTAGGAAACTTGG + Intergenic
1182160625 22:28117567-28117589 TGTGTAGGTCCAAGGTAATTTGG - Intronic
1182366641 22:29783696-29783718 TCTGTAGTCTCCAGCTACTTGGG - Intergenic
950410753 3:12835133-12835155 TCTGTAGTATATAGGTCATGAGG - Exonic
950896977 3:16461648-16461670 TTTGAAGTAGCTAGGTAATTTGG - Intronic
951040869 3:17987751-17987773 TCAGTGGGATGAAGGTAATTGGG + Intronic
952271315 3:31834692-31834714 TCTGTCCAATCAAGGTAATCGGG + Intronic
952894568 3:38069388-38069410 TATTTGGTGTCAAGGTAATTAGG - Intronic
953487154 3:43311409-43311431 TCTGTCGTATCTAGGGATTTGGG + Intronic
955113531 3:55973791-55973813 TCTGTATTTTTAATGTAATTTGG - Intronic
959332013 3:105018601-105018623 GCTGTGTTATTAAGGTAATTTGG - Intergenic
959524323 3:107359724-107359746 TCTGTAGTAAAAAAATAATTTGG + Intergenic
959590990 3:108081034-108081056 TCTGTAGTGTCAATGAAATGTGG - Intronic
963423181 3:145088227-145088249 TCTGGAGTATGAAGGAAATAGGG + Intergenic
965083055 3:164060709-164060731 GCTTTAGCATCAGGGTAATTCGG - Intergenic
965769187 3:172162870-172162892 TCTGTGGTATCATGGTGGTTTGG - Intronic
966512782 3:180782727-180782749 TCTGTAGTATGAAAGAAAGTAGG - Intronic
1202737666 3_GL000221v1_random:22225-22247 TCTCTAGTACCAAATTAATTTGG + Intergenic
971080065 4:23199711-23199733 TCTGAAGAACCAAGGTAAGTTGG + Intergenic
972931872 4:44082073-44082095 TCTATAAAATAAAGGTAATTTGG - Intergenic
973384407 4:49495693-49495715 TCTCTAGTACCAAATTAATTTGG - Intergenic
973753016 4:54042727-54042749 TCTGTAGTGCAAAGGTAATCTGG + Intronic
975125512 4:70778107-70778129 TCTGTAGTCTCCAGCTACTTGGG + Intronic
975677104 4:76837838-76837860 TCTGTAATATCAGGATAATAGGG - Intergenic
976641691 4:87345950-87345972 TTTTTAGTATCGGGGTAATTCGG - Intronic
977319959 4:95501030-95501052 TTTGTAGAATTTAGGTAATTTGG + Intronic
977766440 4:100804198-100804220 ACTGTATTCTCAAGGTAATAAGG + Intronic
978476330 4:109135523-109135545 TCAGAAGGATCAAGGGAATTTGG - Intronic
979738516 4:124119375-124119397 CCAGTAGTATCAAGGTAAGATGG - Intergenic
979762923 4:124429187-124429209 TCTGTAGCATAAAGGTTATTGGG + Intergenic
980011421 4:127598936-127598958 TCTTTAGTGTAAAGATAATTAGG - Intergenic
984826867 4:183933258-183933280 TCTGCAGTATTAAAGTAAATCGG - Intronic
1202768261 4_GL000008v2_random:171018-171040 TCTCTAGTACCAAATTAATTTGG - Intergenic
986524475 5:8658478-8658500 AATGTAGTCTTAAGGTAATTAGG + Intergenic
986812844 5:11378249-11378271 TCTTTAGAATCAATGTAATATGG - Intronic
987832977 5:23122308-23122330 TTAGTTGTATCAAGCTAATTAGG + Intergenic
987848297 5:23316386-23316408 TCTGTAGAATCAAGGCTCTTGGG + Intergenic
988948968 5:36239094-36239116 TCTATAGTGTCATGGTAACTTGG - Intronic
990905506 5:60798418-60798440 TCTGTAGTATCAAGGTAATTGGG - Intronic
995175136 5:109167618-109167640 ACTGTAGTTACAAAGTAATTTGG - Intronic
996582579 5:125047988-125048010 TCTGTAGAATGAAGGGAATTTGG + Intergenic
996897904 5:128507057-128507079 GTTTTGGTATCAAGGTAATTTGG + Intronic
998770791 5:145542530-145542552 TCTTTAATCTCAAAGTAATTTGG + Intronic
1007226465 6:40318760-40318782 TGGGCAGGATCAAGGTAATTCGG - Intergenic
1008556278 6:52675884-52675906 TCTGTACTATCAAAGTGATCTGG - Intronic
1010169199 6:72955065-72955087 TCAGTAGCATCATGGAAATTTGG + Intronic
1010847754 6:80731899-80731921 TCTGGATTACCAAGGTAAATAGG + Intergenic
1011600518 6:89055775-89055797 GCTGTTGTATCAAAGTAATAAGG + Intergenic
1012558948 6:100554720-100554742 TCTGAAGTATTAAATTAATTGGG + Intronic
1013689674 6:112626735-112626757 ACAGTAGTATCAGGGTACTTGGG - Intergenic
1015603789 6:134935849-134935871 ACTGTAGCTTCAAGGTGATTGGG - Intronic
1016593655 6:145774103-145774125 TGTGAAGTATAAATGTAATTAGG - Intergenic
1020614053 7:10436848-10436870 TCTGTAGTATTAAGGGAGGTGGG - Intergenic
1021370173 7:19835052-19835074 TCAGTAGTATCAAAGTATTATGG + Intergenic
1025170381 7:56751336-56751358 TCTGTAGTATGAATGTATGTGGG + Intergenic
1025701507 7:63824370-63824392 TCTGTAGTATGAATGTATGTGGG - Intergenic
1029983870 7:104903587-104903609 CCTGTAGTCTCAAGCTACTTGGG - Intronic
1030274073 7:107700788-107700810 TCTGTGATACCAAGGGAATTTGG + Intronic
1030625931 7:111846193-111846215 ACTGTAGCATAAAGGTAATAGGG + Intronic
1030657897 7:112188328-112188350 TCTATAATTTCAAGGTAACTTGG + Intronic
1030933833 7:115559558-115559580 TCTTGAGAATCAAGATAATTAGG + Intergenic
1031610713 7:123823806-123823828 TATGTACTATCTAGGTAACTCGG - Intergenic
1037243905 8:16808829-16808851 TCTGTAATATCAGTTTAATTGGG + Intergenic
1037976009 8:23212887-23212909 TCTATATTATCAGGGTAATGCGG + Intronic
1041822927 8:62060328-62060350 TTTGTATTATAAAAGTAATTAGG + Intergenic
1042911363 8:73830608-73830630 CCTGTAGTCTCAAGCTACTTGGG - Intronic
1043187370 8:77171195-77171217 TCTGTATTCTCAAGATAATTGGG + Intergenic
1044515856 8:93137562-93137584 CCTGTAGTAGCAAGTGAATTTGG + Intronic
1044857039 8:96487089-96487111 TCTGTAGTTTGGAGATAATTGGG - Intergenic
1045311088 8:101003547-101003569 TCTGGAGGAACAAGATAATTTGG + Intergenic
1052748737 9:32467238-32467260 TCTTTAGCATCAAGTAAATTGGG + Intronic
1055832441 9:80397354-80397376 CCTGGAGTACCATGGTAATTAGG + Intergenic
1056266291 9:84899836-84899858 CCTGTAGTATCCAGGTCTTTGGG - Intronic
1058849740 9:108999728-108999750 TCTAAAGTATCTAGTTAATTTGG - Intronic
1061440049 9:130595760-130595782 TCTGTATTATCAAGGCAAATAGG - Intronic
1061687027 9:132289703-132289725 TCTAGAGTATCAAGGTGATGTGG - Intronic
1203692663 Un_GL000214v1:59924-59946 TCTCTAGTACCAAATTAATTCGG - Intergenic
1203706392 Un_KI270742v1:52668-52690 TCTCTAGTACCAAATTAATTTGG + Intergenic
1203556850 Un_KI270744v1:6816-6838 TCTCTAGTACCAAATTAATTCGG - Intergenic
1203643632 Un_KI270751v1:44267-44289 TCTCTAGTACCAAATTAATTCGG + Intergenic
1188231707 X:27671829-27671851 TCAGTAGTATTAATATAATTAGG + Intronic
1190388487 X:49908794-49908816 ACTGTAGTTTCAAGGTATTCTGG + Intergenic
1190956807 X:55203163-55203185 CTTGTAGTCCCAAGGTAATTTGG + Intronic
1191600348 X:62998096-62998118 TCTCTAGTATAAAGGTAAGAAGG - Intergenic
1200636920 Y:5666396-5666418 TAAGTAGTATTAAGGTGATTTGG + Intronic
1200857244 Y:7952247-7952269 TATATAGTATCATGGTAATGTGG - Intergenic