ID: 990905507

View in Genome Browser
Species Human (GRCh38)
Location 5:60798419-60798441
Sequence TTCTGTAGTATCAAGGTAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 133}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990905507_990905512 4 Left 990905507 5:60798419-60798441 CCAATTACCTTGATACTACAGAA 0: 1
1: 0
2: 0
3: 9
4: 133
Right 990905512 5:60798446-60798468 TTTTAACTTGCTGAGGGTGGAGG 0: 1
1: 0
2: 5
3: 88
4: 917
990905507_990905516 28 Left 990905507 5:60798419-60798441 CCAATTACCTTGATACTACAGAA 0: 1
1: 0
2: 0
3: 9
4: 133
Right 990905516 5:60798470-60798492 GAGGTGCTTAGAGATTAAAGTGG 0: 1
1: 0
2: 2
3: 10
4: 180
990905507_990905511 1 Left 990905507 5:60798419-60798441 CCAATTACCTTGATACTACAGAA 0: 1
1: 0
2: 0
3: 9
4: 133
Right 990905511 5:60798443-60798465 CTTTTTTAACTTGCTGAGGGTGG 0: 1
1: 0
2: 0
3: 23
4: 272
990905507_990905514 6 Left 990905507 5:60798419-60798441 CCAATTACCTTGATACTACAGAA 0: 1
1: 0
2: 0
3: 9
4: 133
Right 990905514 5:60798448-60798470 TTAACTTGCTGAGGGTGGAGGGG 0: 1
1: 0
2: 0
3: 18
4: 177
990905507_990905509 -3 Left 990905507 5:60798419-60798441 CCAATTACCTTGATACTACAGAA 0: 1
1: 0
2: 0
3: 9
4: 133
Right 990905509 5:60798439-60798461 GAAGCTTTTTTAACTTGCTGAGG 0: 1
1: 0
2: 1
3: 20
4: 194
990905507_990905510 -2 Left 990905507 5:60798419-60798441 CCAATTACCTTGATACTACAGAA 0: 1
1: 0
2: 0
3: 9
4: 133
Right 990905510 5:60798440-60798462 AAGCTTTTTTAACTTGCTGAGGG 0: 1
1: 0
2: 1
3: 36
4: 379
990905507_990905513 5 Left 990905507 5:60798419-60798441 CCAATTACCTTGATACTACAGAA 0: 1
1: 0
2: 0
3: 9
4: 133
Right 990905513 5:60798447-60798469 TTTAACTTGCTGAGGGTGGAGGG No data
990905507_990905515 9 Left 990905507 5:60798419-60798441 CCAATTACCTTGATACTACAGAA 0: 1
1: 0
2: 0
3: 9
4: 133
Right 990905515 5:60798451-60798473 ACTTGCTGAGGGTGGAGGGGAGG 0: 1
1: 1
2: 4
3: 69
4: 886

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990905507 Original CRISPR TTCTGTAGTATCAAGGTAAT TGG (reversed) Intronic
906899523 1:49818750-49818772 TTCTGTATCATGCAGGTAATTGG - Intronic
910775863 1:90873936-90873958 TTCTGTAGTTTCATGTAAATTGG + Intergenic
911821521 1:102429889-102429911 TTCTGTAGTCTCAGTGTAAGTGG + Intergenic
913153776 1:116073726-116073748 TTTTATATTATCAAGGAAATGGG - Intergenic
916830851 1:168489438-168489460 TTCTGTAGGATGAAGCTATTTGG + Intergenic
917089177 1:171335875-171335897 TTCTGTGGTTTTAATGTAATTGG - Intronic
917828812 1:178855098-178855120 TTCTGTACTATAAGGATAATAGG + Intronic
918635336 1:186767368-186767390 TTCTGTAGTAAGAAGAAAATAGG + Intergenic
920317224 1:205085517-205085539 TTCTGTAGGATAAAGGGAGTAGG - Intergenic
921416146 1:214889415-214889437 TTCTGTTATAAAAAGGTAATTGG + Intergenic
922057801 1:222058024-222058046 TTCTGTAGGAGCCAAGTAATAGG + Intergenic
923165593 1:231358538-231358560 TTCTGAAGAATCAAAGTTATAGG + Intergenic
1063330643 10:5155617-5155639 TTCTGTAGTATGCAGGGAAATGG - Intergenic
1068280984 10:54869388-54869410 TTCTGTAGTTTAAAGCTACTTGG + Intronic
1069864223 10:71491488-71491510 TTCTGTTGAACCAAGGTAGTGGG + Intronic
1075204736 10:120437170-120437192 CTTTGTAGTATCAAGGGCATGGG + Intergenic
1076346019 10:129779723-129779745 TTCTGTAGTTTCAAGCAAATTGG + Intergenic
1077695385 11:4388529-4388551 TTCTTTAGTGTCAAGGGAAAGGG + Exonic
1082266177 11:50121006-50121028 TTCTGTTATTTCAATGTAATAGG - Intergenic
1082289912 11:50357566-50357588 TTCTGTTATTTCAATGTAATAGG + Intergenic
1086245849 11:84751975-84751997 TTCTCCAGTAGCAAGGTAACAGG + Intronic
1086456078 11:86959902-86959924 TTCTGTATTATAAAGTTATTGGG + Intergenic
1097596729 12:61642568-61642590 TTATGTAGCATCAAGAAAATTGG - Intergenic
1097723638 12:63050293-63050315 TTCTGAATTCTCAAGGTGATGGG - Intergenic
1098939880 12:76521906-76521928 TTCTTTAGTATAAAGTTCATTGG - Intronic
1099134641 12:78880888-78880910 TTCAGTAGGATGAAGGTGATTGG - Intronic
1099451205 12:82809378-82809400 TTCTGTATAGTCAAGGAAATTGG - Intronic
1102243360 12:111339404-111339426 TTATGTAGAATCTGGGTAATGGG - Intronic
1105666815 13:22568782-22568804 TTCTGTATTATCAAGGTTACTGG + Intergenic
1106246767 13:27956687-27956709 ATCTGTAGTATGATGATAATAGG - Intergenic
1106329062 13:28722110-28722132 TTCAGGAGGATCTAGGTAATTGG - Intergenic
1110467377 13:75817360-75817382 TTCTGTAATAGCAAGGAAAATGG - Intronic
1110528047 13:76562764-76562786 CTCTCTAGTTTCAATGTAATCGG - Intergenic
1111457293 13:88501785-88501807 TTTAGTAGTATGAAGGTATTTGG - Intergenic
1111734685 13:92122966-92122988 TTCTGCAGGATCAATGTGATTGG - Intronic
1112849117 13:103682466-103682488 TTCAGTAGTTTCAATGTAAAAGG + Intergenic
1113353688 13:109555578-109555600 ATCTTTAGTATCAAGGTTAAAGG + Intergenic
1119510977 14:75211004-75211026 ACCTGGAGTAGCAAGGTAATTGG + Intergenic
1120813270 14:88826378-88826400 TTCTGTTGTACCAACGTAAAGGG - Intronic
1125777239 15:42227534-42227556 TTCTGTACTATCATGGTGCTTGG - Intronic
1128607330 15:69046852-69046874 TTCTGTAACATCAAGGTGAGAGG + Exonic
1130644619 15:85713322-85713344 TTATGTAGTATTAATGTAAAAGG - Intronic
1131979503 15:97981264-97981286 TTCTCTAAAAACAAGGTAATAGG - Intergenic
1132297023 15:100746045-100746067 TTCTGTAGTTTGAAGATGATAGG + Intergenic
1133540302 16:6746079-6746101 TTCTGTAGTTTTAAGGGTATAGG - Intronic
1133723824 16:8519318-8519340 TTCTGTATTATCAAGGGGAAAGG - Intergenic
1137537873 16:49341273-49341295 TGCTGGAGGATAAAGGTAATAGG + Intergenic
1137989297 16:53136832-53136854 TTCTGTATTCCCAAGATAATAGG + Intronic
1138235065 16:55375203-55375225 CTCTCTAGTTTCAGGGTAATGGG - Intergenic
1140603882 16:76510782-76510804 TTCTGAAGTGTTAAGGCAATAGG - Intronic
1149103368 17:52932812-52932834 TACTTTAGTGTAAAGGTAATGGG - Intergenic
1151470520 17:74314973-74314995 CTGTGTAGTATAAAGGTGATGGG - Intergenic
1153876840 18:9380982-9381004 ATCTGTAGTTTCAAAATAATAGG + Intronic
1155871754 18:31038458-31038480 GTCTGTATTTTCAAGTTAATTGG + Intronic
1156276197 18:35584964-35584986 TGCTGTAGTCTCAAGATAACTGG + Intronic
1156892187 18:42203582-42203604 TTCTCTAGTAACAAGGGTATGGG + Intergenic
1157824041 18:50796374-50796396 TTCTGTAGTTTCAATCTAACAGG + Intronic
1158109440 18:53924322-53924344 TTCTGTAGTTTCACTGTTATAGG - Intergenic
1158919235 18:62171180-62171202 TTCTGTAGTTTCAAATTAATAGG + Intronic
1160597439 18:79986528-79986550 TTCTGTAATAACAAAGAAATTGG + Intronic
1167458807 19:49613374-49613396 TTCTGTAGTGTCCAGGGAATTGG + Intronic
930332766 2:50007040-50007062 TTCTGTGCTATCAAGGGAACAGG + Intronic
931367421 2:61630838-61630860 TTCTGTAAAATCATGGTTATAGG - Intergenic
933525644 2:83435069-83435091 TTCTGTCATTTCAAGGTTATTGG - Intergenic
936764153 2:115824943-115824965 TCCTCTAGTATCCATGTAATAGG - Intronic
937638532 2:124185372-124185394 TTCTGTAGTATCTTAGTATTAGG + Intronic
941981049 2:171457337-171457359 TCCTGTATTTCCAAGGTAATTGG + Intronic
942808688 2:179969120-179969142 TTCTTTAGCATCTAGGCAATTGG - Intronic
943116782 2:183682756-183682778 TTCTGTAGAATCTAGCTATTTGG + Intergenic
946098297 2:217295150-217295172 TTCTGAAGTATCAAGGTGCAGGG + Intronic
947873811 2:233455144-233455166 TTCTGTAGTATCACGGACTTGGG - Intronic
947953377 2:234166876-234166898 TTCTGTATTATAAAGCTAGTTGG - Intergenic
1169433046 20:5556655-5556677 TTCTTTAGTATAAAGATATTTGG - Intronic
1172439252 20:34954084-34954106 TACTCTAATGTCAAGGTAATGGG - Intronic
1172630474 20:36374977-36374999 TCCTCTACTGTCAAGGTAATGGG - Intronic
1175146796 20:56903097-56903119 TTCTGTAGAGTCGAGGTGATTGG + Intergenic
1179288332 21:39996978-39997000 CTCTGTGGTATCAAGAGAATGGG - Intergenic
1179330245 21:40393474-40393496 TTTTTTAAAATCAAGGTAATAGG + Intronic
1182289579 22:29267576-29267598 TTCTGTAGAAACAAGGATATCGG + Exonic
1183882152 22:40842123-40842145 TTCTGTATTACCAAAGTAATTGG + Intronic
951040868 3:17987750-17987772 TTCAGTGGGATGAAGGTAATTGG + Intronic
952271314 3:31834691-31834713 ATCTGTCCAATCAAGGTAATCGG + Intronic
952533462 3:34286276-34286298 ATCTGTAGTAACAGGGTTATGGG - Intergenic
953487153 3:43311408-43311430 TTCTGTCGTATCTAGGGATTTGG + Intronic
956049719 3:65234824-65234846 TTGTGTAATATTTAGGTAATTGG - Intergenic
958130416 3:89412993-89413015 TTCTGTAGTATCACAGAAACTGG - Intronic
959157861 3:102688385-102688407 TTCTGCAGTTGTAAGGTAATGGG + Intergenic
963423180 3:145088226-145088248 GTCTGGAGTATGAAGGAAATAGG + Intergenic
964606241 3:158563002-158563024 TTCTGGGGTAACAAGGTAAAGGG - Intergenic
965428674 3:168560093-168560115 TTCTGTAGTAGCAAAATAAGGGG + Intergenic
967879535 3:194290792-194290814 TTTTGTAGTTTTAAGGTTATAGG - Intergenic
971603208 4:28622812-28622834 TTCTCTTCTATCATGGTAATGGG + Intergenic
975677105 4:76837839-76837861 TTCTGTAATATCAGGATAATAGG - Intergenic
977801142 4:101233592-101233614 TTTTCTATTATCAAGGTAACTGG + Intronic
977996198 4:103499698-103499720 TTCTTTACTATAAAGGAAATTGG + Intergenic
978256198 4:106695594-106695616 TTCTCTAGTATTCAGGAAATGGG + Intergenic
979361601 4:119771906-119771928 TTCTGTGGTTTGTAGGTAATGGG - Intergenic
979762922 4:124429186-124429208 ATCTGTAGCATAAAGGTTATTGG + Intergenic
979989097 4:127353039-127353061 TTCTGTACTCTCCAGGGAATGGG - Intergenic
981078376 4:140614107-140614129 TTTTGTTATATGAAGGTAATAGG + Intergenic
990905507 5:60798419-60798441 TTCTGTAGTATCAAGGTAATTGG - Intronic
992768161 5:80022110-80022132 TTCTGTTGTATCAGCATAATGGG - Intronic
993834908 5:92807067-92807089 TTCTGTAGTATGAAAGGGATGGG + Intergenic
994336585 5:98573959-98573981 CTCTTTAGGATCAAGGTAAGAGG - Intergenic
994811894 5:104530058-104530080 TTTTGTAGTGACAAAGTAATAGG - Intergenic
995126196 5:108578944-108578966 TGATGAGGTATCAAGGTAATAGG - Intergenic
996797687 5:127367509-127367531 TTCTTTAGTATGAAGTTAATTGG + Intronic
998615219 5:143733018-143733040 TTCTGTAGTATCAGGTTAAATGG - Intergenic
1002549824 5:179979338-179979360 TACGGTGGTATCAAGGCAATGGG + Intronic
1003412851 6:5880825-5880847 TCCTGTGGTACCCAGGTAATGGG + Intergenic
1008021622 6:46584769-46584791 TTCTGTTGTCTCAAGCTAAAAGG + Intronic
1011968055 6:93185092-93185114 TTCTGTAAAAGAAAGGTAATTGG + Intergenic
1012558947 6:100554719-100554741 TTCTGAAGTATTAAATTAATTGG + Intronic
1013689675 6:112626736-112626758 TACAGTAGTATCAGGGTACTTGG - Intergenic
1013973941 6:116055276-116055298 TTCTGAAGTATAAAAGTAATGGG - Intronic
1014243692 6:119044678-119044700 ATCAGTAGTACCCAGGTAATTGG - Intronic
1017376571 6:153776553-153776575 TTCTGTAGAAACAGGGAAATTGG - Intergenic
1020586186 7:10071611-10071633 TTATATCCTATCAAGGTAATAGG + Intergenic
1021490635 7:21216605-21216627 TTCTGTAATTTTAATGTAATTGG - Intergenic
1023107058 7:36772957-36772979 TTCAATAGTGTCAAGGTCATGGG + Intergenic
1028194580 7:87890877-87890899 TTCTGGACTATCAAGATATTTGG - Intronic
1030625930 7:111846192-111846214 AACTGTAGCATAAAGGTAATAGG + Intronic
1031547163 7:123064933-123064955 ATCTGTATTATCAAGGATATTGG + Intergenic
1036422990 8:8615144-8615166 TTATCTAGTATTAAGGTTATAGG + Intergenic
1037243904 8:16808828-16808850 TTCTGTAATATCAGTTTAATTGG + Intergenic
1037562216 8:20085144-20085166 TTCTGTAATATAAATATAATGGG - Intergenic
1043187369 8:77171194-77171216 GTCTGTATTCTCAAGATAATTGG + Intergenic
1043463488 8:80483887-80483909 TTATCTAGGATCAAGGTGATGGG - Intergenic
1044395993 8:91713251-91713273 TTATGTAATATCAAAGTACTAGG + Intergenic
1048016159 8:130499397-130499419 TGCTGTAGTATCAAGGGTTTAGG + Intergenic
1048063742 8:130947339-130947361 TGCTGTATTATCAAGGAAAATGG - Intronic
1048155488 8:131944455-131944477 ATCTGTAGTATATAGGGAATGGG - Intronic
1048488888 8:134873344-134873366 CTCTGTAGTATCAAGGAATAGGG + Intergenic
1048860370 8:138720270-138720292 TTCTGTAGGGTCAAGGGATTAGG + Intronic
1052452002 9:28642773-28642795 TTCTGTAGTTGAAAGATAATAGG - Intronic
1054751513 9:68911991-68912013 TTCTGTAGAAAGATGGTAATTGG + Intronic
1056266293 9:84899837-84899859 TCCTGTAGTATCCAGGTCTTTGG - Intronic
1186913209 X:14192182-14192204 TTCTTTAGCATCAACCTAATAGG + Intergenic
1187576920 X:20566670-20566692 TTCTGCAGTATACAGGTATTAGG - Intergenic
1190018416 X:46849643-46849665 TTCTGTAGTATAAAATTAGTTGG - Intronic
1195670767 X:107467990-107468012 TTCTGCAGTTTCTGGGTAATGGG - Intergenic
1197138223 X:123087687-123087709 TTCTGTACTAGCAAGGACATAGG - Intergenic
1199496867 X:148462000-148462022 TTGTCTAGTAGCAAGGTTATGGG - Intergenic