ID: 990905508

View in Genome Browser
Species Human (GRCh38)
Location 5:60798426-60798448
Sequence AAAAAGCTTCTGTAGTATCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 312
Summary {0: 1, 1: 0, 2: 3, 3: 24, 4: 284}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990905508_990905513 -2 Left 990905508 5:60798426-60798448 CCTTGATACTACAGAAGCTTTTT 0: 1
1: 0
2: 3
3: 24
4: 284
Right 990905513 5:60798447-60798469 TTTAACTTGCTGAGGGTGGAGGG No data
990905508_990905512 -3 Left 990905508 5:60798426-60798448 CCTTGATACTACAGAAGCTTTTT 0: 1
1: 0
2: 3
3: 24
4: 284
Right 990905512 5:60798446-60798468 TTTTAACTTGCTGAGGGTGGAGG 0: 1
1: 0
2: 5
3: 88
4: 917
990905508_990905510 -9 Left 990905508 5:60798426-60798448 CCTTGATACTACAGAAGCTTTTT 0: 1
1: 0
2: 3
3: 24
4: 284
Right 990905510 5:60798440-60798462 AAGCTTTTTTAACTTGCTGAGGG 0: 1
1: 0
2: 1
3: 36
4: 379
990905508_990905514 -1 Left 990905508 5:60798426-60798448 CCTTGATACTACAGAAGCTTTTT 0: 1
1: 0
2: 3
3: 24
4: 284
Right 990905514 5:60798448-60798470 TTAACTTGCTGAGGGTGGAGGGG 0: 1
1: 0
2: 0
3: 18
4: 177
990905508_990905509 -10 Left 990905508 5:60798426-60798448 CCTTGATACTACAGAAGCTTTTT 0: 1
1: 0
2: 3
3: 24
4: 284
Right 990905509 5:60798439-60798461 GAAGCTTTTTTAACTTGCTGAGG 0: 1
1: 0
2: 1
3: 20
4: 194
990905508_990905515 2 Left 990905508 5:60798426-60798448 CCTTGATACTACAGAAGCTTTTT 0: 1
1: 0
2: 3
3: 24
4: 284
Right 990905515 5:60798451-60798473 ACTTGCTGAGGGTGGAGGGGAGG 0: 1
1: 1
2: 4
3: 69
4: 886
990905508_990905516 21 Left 990905508 5:60798426-60798448 CCTTGATACTACAGAAGCTTTTT 0: 1
1: 0
2: 3
3: 24
4: 284
Right 990905516 5:60798470-60798492 GAGGTGCTTAGAGATTAAAGTGG 0: 1
1: 0
2: 2
3: 10
4: 180
990905508_990905511 -6 Left 990905508 5:60798426-60798448 CCTTGATACTACAGAAGCTTTTT 0: 1
1: 0
2: 3
3: 24
4: 284
Right 990905511 5:60798443-60798465 CTTTTTTAACTTGCTGAGGGTGG 0: 1
1: 0
2: 0
3: 23
4: 272

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990905508 Original CRISPR AAAAAGCTTCTGTAGTATCA AGG (reversed) Intronic
900877621 1:5356179-5356201 AATGAGCTTCAGAAGTATCAGGG - Intergenic
905815877 1:40950459-40950481 AAAAATCTTTTGTAGAAACAGGG + Intergenic
912033413 1:105279378-105279400 AAAAAGGTTAAGTAGTACCAAGG - Intergenic
912394735 1:109333430-109333452 AAAAAGCTTCTGCAAAATAAAGG + Intronic
912614746 1:111086649-111086671 AAAAAGCTTCTGTAAAACAAAGG - Intergenic
912736530 1:112153985-112154007 CACAAGCTTCTGAAGTATGAAGG - Intergenic
914969949 1:152299236-152299258 AAAAAGCTTCTGCAGCACAAAGG + Intergenic
915071038 1:153267422-153267444 AAAAAGCTTCTGTAGAGCCAAGG - Intergenic
915805854 1:158848935-158848957 AATAAACTTCTGTGGTATCCTGG - Intronic
915819357 1:159005520-159005542 AAAGAGCTTCTGTAGTTCTAGGG - Intronic
916451332 1:164923299-164923321 ACATTGCTTCTGTATTATCAGGG + Intergenic
916868819 1:168889327-168889349 ACAAAGACTCTGTATTATCAAGG + Intergenic
917300196 1:173565182-173565204 AAAAAGCTTCTGTATAGTAAAGG - Intronic
917332572 1:173897208-173897230 AAAATGCTTCTGTGCTACCAAGG - Exonic
918675634 1:187281530-187281552 AAAGAGTTTCTGTAGTATAAAGG - Intergenic
919102322 1:193109851-193109873 AGAAAGCTTCTGCAGAACCAAGG - Intergenic
920152724 1:203921859-203921881 AAAAAGATTCTGAAGAATTAGGG + Intergenic
921693025 1:218174730-218174752 AAGAATCTACTGTAGTATCTTGG + Intergenic
922235029 1:223716258-223716280 AGAAAGTTTCTGAAGTATAATGG + Intronic
1065091175 10:22235105-22235127 AAAAAGTTTTTGTAGAATTACGG + Intergenic
1066260343 10:33723739-33723761 AAGTAGCTTCAGGAGTATCAAGG + Intergenic
1067915581 10:50394395-50394417 AGAACGCATCTGTAGTGTCAAGG - Intronic
1068497685 10:57805894-57805916 AAAAAGCTTCAGCAATCTCAAGG + Intergenic
1069092437 10:64217233-64217255 AAAGAGCTTCTGTAATATCATGG + Intergenic
1070408679 10:76119415-76119437 AAAAAGCCCCTGCAGTTTCAGGG - Intronic
1071842592 10:89488219-89488241 AAAAAATTTCTGTAGACTCAGGG - Intronic
1073195692 10:101689318-101689340 AAACAGCTTCTGTATTCTCATGG + Intronic
1073840848 10:107497097-107497119 ATAAATCTTCTGCAGTAACATGG + Intergenic
1076153601 10:128185472-128185494 AAACAGCTGCTGTAGACTCAGGG + Intergenic
1078790262 11:14535108-14535130 AAAAAGCTTCTAAAATACCAGGG - Intronic
1079114258 11:17630913-17630935 AATAAGCTTCTGTTGTGTTAAGG - Intronic
1079625586 11:22612904-22612926 AAAAAGCTTCTGCACAATAAAGG - Intergenic
1079953592 11:26834927-26834949 TAAAATCTACTCTAGTATCAGGG - Intergenic
1080204724 11:29715723-29715745 AAAAAGCTTCTGTACAATAAAGG - Intergenic
1082111133 11:48275724-48275746 AAAAAGCTTCTGCACTGTGAAGG - Intergenic
1082201271 11:49371837-49371859 AAAACACTTTTGTAGTATTAGGG + Intergenic
1085223977 11:74901936-74901958 AAAAAGCTTCTGTACAACAAAGG + Intronic
1085925029 11:81008120-81008142 AAAATGCTTATGTACTCTCAGGG - Intergenic
1085990914 11:81843170-81843192 AAAAAGCTTCTGCAGTGCAAGGG - Intergenic
1086381351 11:86258294-86258316 AAAAAGCTTTTGTTTTATAAAGG + Intronic
1086468794 11:87084724-87084746 GAAAAGCTTATGTGGTATAAAGG + Intronic
1087798214 11:102476728-102476750 AAAGATCTTCTGGAGGATCAGGG - Intronic
1089392248 11:118110113-118110135 AAAATGCATCTGTAGGCTCAAGG + Intronic
1090317844 11:125811789-125811811 AAAAAGCTTCTGGACAATAAAGG - Intergenic
1090629410 11:128633230-128633252 AAAAACCTTATGTACTATGAAGG - Intergenic
1093017388 12:14168616-14168638 AAAAAGTATTTGTAGTATAAAGG + Intergenic
1093340059 12:17963052-17963074 AAAATGAGTCTGTATTATCAAGG - Intergenic
1094305648 12:29016421-29016443 AAAAAGCTTCTGCAGTTATATGG - Intergenic
1097764548 12:63510628-63510650 AAAAAGCTTCTGTACAATAAAGG + Intergenic
1100052464 12:90465420-90465442 AAAAAGCTTCTGTACAGCCAAGG - Intergenic
1103169308 12:118800196-118800218 AAAAAGCTTCTGCACAACCAAGG - Intergenic
1103710869 12:122911686-122911708 AAAAATCTTTTGTAGTATGAGGG + Intergenic
1105388145 13:19951241-19951263 AAAAAGCTTCTGTATCGTAAAGG + Intergenic
1105505265 13:21004446-21004468 AAAAAGCTTCTGTAATGCAAGGG + Intronic
1106589056 13:31083383-31083405 AAAAAGCTTCTGTACAACAAAGG - Intergenic
1110398406 13:75060332-75060354 AAAAAGCTTCTGTACAACAAAGG + Intergenic
1110692477 13:78447365-78447387 AAAAAGCTTTTCTGGTATCAAGG - Intergenic
1111573158 13:90114398-90114420 AAAAAGCTCCAGGAGTAACAAGG + Intergenic
1112750178 13:102575243-102575265 AAAAAGCTTCTGCACAACCAAGG - Intergenic
1112873128 13:104000236-104000258 AAAAAGCTTCTGTAGAGCAAAGG + Intergenic
1113312929 13:109149776-109149798 AAATACCTTCTGCAGTACCAGGG + Intronic
1113969041 13:114174542-114174564 AAAGAGCTCCTCTTGTATCAGGG + Intergenic
1115669562 14:35594287-35594309 AAAAAGCTTCTGCAGAACAAAGG + Intronic
1116122719 14:40741246-40741268 AAAGAGCTTCTGTGGTGTAATGG - Intergenic
1119152889 14:72380336-72380358 AAAAAGCTTCTGTACAGTAAAGG + Intronic
1120304732 14:82754693-82754715 AAAAAGCTTCTGTACAGTAAAGG + Intergenic
1122002993 14:98679320-98679342 AAAAAGCTTCTGGACTACAAAGG + Intergenic
1122194039 14:100071580-100071602 AAAAAGCTTCTGTTTTATGTAGG - Intronic
1124199180 15:27662326-27662348 AAAAATCTTCTGCAGAACCAAGG + Intergenic
1124382951 15:29183018-29183040 AAAAATTTTCTGTATTTTCATGG - Intronic
1124572787 15:30881436-30881458 AAAAAGCTTCTGTACAACAAAGG - Intergenic
1125234072 15:37491163-37491185 AAAAAGCTTCTGAAAGATCAGGG + Intergenic
1125708094 15:41759812-41759834 AAAAAGCCTGTGTAATGTCAGGG + Intronic
1125849942 15:42893319-42893341 AAAAAATTTTTGTAGTAACAGGG - Intronic
1128123086 15:65169271-65169293 AAAAATCTTCTGTAGAGACAGGG + Intronic
1128333481 15:66771294-66771316 AAAAAGCTTGTTTTGTGTCAGGG + Intronic
1129289705 15:74555502-74555524 AAAAATCTTTTGTAGAAACAGGG + Intronic
1130010208 15:80146562-80146584 AAAAAGCTTCTGTATAGCCAAGG + Intergenic
1133163628 16:3930021-3930043 AAAAAGCGTCTCTAGAATTAAGG + Intergenic
1134259672 16:12640846-12640868 AATAAGAGTCTGTAGTATGAGGG + Intergenic
1134288768 16:12886295-12886317 AAATAGCTCCAGTAGTCTCAGGG + Intergenic
1136603599 16:31315257-31315279 AAAAAGCTTCTGCACAATAAAGG - Intronic
1137793278 16:51193272-51193294 AAGAAGGTTCTGTAGAAGCACGG - Intergenic
1138866840 16:60832072-60832094 AAAAAGTTACAGTAGTACCAGGG - Intergenic
1140578877 16:76205257-76205279 AAAAAGCTTCTGTACAACAAAGG - Intergenic
1140752507 16:78038626-78038648 CAAAAGCTACTGTATTATCATGG + Intronic
1143295634 17:5869849-5869871 AAAAAGCTTCTGAAATATATTGG - Intronic
1143420292 17:6785509-6785531 AAAAAGTTTCTGTACAATGAAGG + Intronic
1146109121 17:30071155-30071177 AAAAAGCTTCTGCAGTGCAAAGG + Intronic
1146361637 17:32180855-32180877 AAAAAACTTTTGTAGAAACAGGG + Intronic
1146552734 17:33795660-33795682 AAATACCTTCTGTGGTTTCAGGG + Intronic
1146888676 17:36490060-36490082 AAAAAGCTTCTGTACAACAAAGG - Intronic
1149227116 17:54485194-54485216 AAAAAGGTTCTGTGTTCTCAAGG + Intergenic
1149326302 17:55533551-55533573 AAATAGCTACTGGAGTATTATGG - Intergenic
1149631538 17:58129231-58129253 GAAAAGTTTTTGTAATATCAGGG - Intergenic
1149631659 17:58130417-58130439 GAAAAGTTTTTGTAATATCAGGG + Intergenic
1150541770 17:66108316-66108338 AAAAAGCTTCTGCACAACCAAGG + Intronic
1150967291 17:69986427-69986449 TAAAAGCTTCTGCAGAATGAAGG - Intergenic
1153875857 18:9369936-9369958 AAAAAGCTTCTGCACAGTCAAGG - Intronic
1156838509 18:41584093-41584115 AAAGGGCTTCTGTAGTATCACGG + Intergenic
1158049367 18:53197647-53197669 AAAAAGCTTTAGAAGGATCAAGG - Intronic
1158224708 18:55188836-55188858 AAAAAGTTTCTGTAGAGACAGGG - Intergenic
1158521921 18:58178283-58178305 AAAAAGCTACTGCACTATCTAGG - Intronic
1159715533 18:71817204-71817226 AAAAAGATTCTGTAAGAGCATGG + Intergenic
1162577906 19:11509857-11509879 AAAAAGTTTCTTTAGTAGCAGGG - Intronic
1163157523 19:15447668-15447690 AAACAGCTTCTGTAGTGGCTAGG - Intronic
1163227492 19:15974663-15974685 AAAAGGCTTCTGCAGTTTTATGG - Intergenic
1164905409 19:31963712-31963734 AAAATGCGTCTGTAGAGTCATGG + Intergenic
1168138803 19:54370539-54370561 AAAAAGCTTCTGCTATACCAGGG + Intronic
1168159220 19:54497958-54497980 AAAAAGCTTCTGCTATACCAGGG - Intronic
925225462 2:2180244-2180266 AAACATCTTCTGTACTCTCAAGG - Intronic
925475128 2:4205028-4205050 AAAAAGATACTTTAGTATAAAGG + Intergenic
925895045 2:8464602-8464624 ATAAAGCTTCTGCAGCACCAAGG + Intergenic
926649965 2:15332690-15332712 AAAAAGCCTGTATACTATCAGGG + Intronic
928169931 2:28997128-28997150 AAAAAGCTTCTGTAGACACAAGG + Intronic
929664334 2:43822208-43822230 AAAGAGCTTCGGTAGAGTCATGG - Intronic
930282262 2:49384252-49384274 AAAGAGCTGCTTTAGTTTCAGGG - Intergenic
930550128 2:52823475-52823497 AAAAACCTTCTGAAGTGGCATGG + Intergenic
930592679 2:53347947-53347969 AAAAAGCTTCTGTACAACAAAGG - Intergenic
930968557 2:57364502-57364524 AAAAAGCTTCTGTACTACAAAGG + Intergenic
931263140 2:60637690-60637712 AATAAGCTTCTGTTGTGTTATGG - Intergenic
931510304 2:62984432-62984454 AACCAGCTTCTGTTGTATAATGG + Intronic
932035602 2:68243511-68243533 AAATAGCTTCTGAAGTATAATGG - Intronic
933007790 2:77017301-77017323 TAAAAGCTTATGTAGTAAAATGG - Intronic
933081108 2:77987894-77987916 AAAAATATTCTGTAGTTTAAAGG - Intergenic
933419101 2:82024637-82024659 AAGAAGGTTAAGTAGTATCAGGG - Intergenic
935310716 2:101780519-101780541 AAAAAGCTTGTTTATTATAATGG - Intronic
935586821 2:104808060-104808082 AAAAAGATTCTGTGGTGCCAAGG - Intergenic
935665899 2:105511908-105511930 ATAGAGCTTCTGTAGTAACGTGG - Intergenic
936705564 2:115068543-115068565 AAAAAGCTTCTGTATAACAAAGG - Intronic
936901165 2:117483355-117483377 AAAAAGCTTCTGTACAACAAAGG - Intergenic
940968227 2:159864213-159864235 AAAAAGCTTCTGCACAATAAAGG - Intronic
941114248 2:161453029-161453051 AAAAAGCTTCATTAGTTTCAGGG - Intronic
942093918 2:172520247-172520269 AAAGAGCTTCTGAAGCATTAAGG - Intergenic
942281631 2:174370221-174370243 AAAAAGTTTCTGTAGCAATAGGG + Intronic
942652731 2:178185475-178185497 AAAAAGCTTCTGTACAGCCAAGG + Intergenic
942856345 2:180554161-180554183 AAAAAGCTTCTGTATAGCCAAGG + Intergenic
944070531 2:195662929-195662951 AAAAAGCTTCTCTACTATGTAGG - Intronic
944831346 2:203535926-203535948 AAAAAGTCTCTGCAGTTTCATGG + Intergenic
945749458 2:213762798-213762820 AAAAAGCTTCTGTACAACAAAGG + Intronic
946716952 2:222562841-222562863 AAGGAGGTTCTTTAGTATCATGG - Intergenic
947258697 2:228196212-228196234 AAAAAGCTTCTGTACAATCAAGG + Intergenic
947409597 2:229822207-229822229 GAAAATCTTCTGCAGTCTCATGG + Intronic
948045763 2:234942887-234942909 AAAAAGCTTCTGTACGATAAAGG - Intergenic
948440764 2:237986486-237986508 AAAAAGCTTCTGTACAATAAAGG - Intronic
948597626 2:239090514-239090536 AAAATGCTTTTGTAGTATTTCGG - Intronic
948990200 2:241550244-241550266 AAAAAGATTTTGTAATATCAAGG + Intergenic
1169242197 20:3993050-3993072 AAAAAGGTTCTCCAGTTTCAGGG - Intronic
1169352314 20:4879009-4879031 AATAAGCTTGTTTATTATCACGG - Intronic
1170013977 20:11759722-11759744 AAAAAGCTTCTGTAAAACAAAGG - Intergenic
1170335217 20:15263015-15263037 AAAAAGCTTCTGTACAACAAAGG - Intronic
1171942150 20:31341388-31341410 ACAAAGATTCTGTTGCATCAAGG + Intergenic
1173109586 20:40174240-40174262 AAAAATATTCTGTAGTATCTGGG - Intergenic
1176087061 20:63302254-63302276 AAAATGTTTCAGTACTATCATGG + Intronic
1177955698 21:27595813-27595835 AAAAATCTTTTGGAGTATCCAGG + Intergenic
1178427295 21:32489081-32489103 AAAAAGCTTCTGCACAATAAAGG - Intronic
1179129889 21:38625748-38625770 AAAAAGCTGGTGTTGTATCCTGG - Intronic
1179474395 21:41634070-41634092 CAAAAGCCTCTGTAGCTTCAGGG - Intergenic
1181892422 22:26075378-26075400 AACAAGCTTCTGTGTCATCATGG - Intergenic
1183305842 22:37082625-37082647 AGAAGGCTTCTGTAGCATGATGG - Intronic
1184763094 22:46556467-46556489 AAAAAACTTCTTTAATATAAAGG - Intergenic
1184826495 22:46956181-46956203 AAACATCTTCTGTGGTATTAGGG - Intronic
950315339 3:11996989-11997011 AAAAAGTTTCCTTAGTACCAGGG - Intergenic
951434564 3:22646732-22646754 AAAAAGCTTCTGTACAACAAAGG - Intergenic
951726241 3:25763771-25763793 AAAAAGCTTCTTTAGGTTTAAGG - Intronic
954723242 3:52583815-52583837 AAAAATCTTCTGTAGAGACAAGG + Intronic
956266277 3:67399576-67399598 AAAAAGCTTTTCTAATATGATGG + Intronic
957182522 3:76898775-76898797 AAAATGTTTCTGTACTTTCAAGG + Intronic
957267772 3:77988834-77988856 TAAAAGCTTCTGTACTGCCAAGG - Intergenic
958150175 3:89682768-89682790 CAAAAGCCTCTGGAGTATTAAGG - Intergenic
958588773 3:96125885-96125907 AAAAGTCTTCTGTAGACTCAAGG + Intergenic
960491266 3:118319117-118319139 AAAAAGCTTCTGCACAACCAAGG + Intergenic
961616099 3:128182322-128182344 AAAAAAATTCTGTAGTAAGAAGG + Intronic
964159663 3:153631842-153631864 AAAAAGATGCTGTGGCATCAGGG + Intergenic
964180421 3:153876975-153876997 AAAAAGCATTTTTAGCATCATGG + Intergenic
964782523 3:160356168-160356190 AAAAATCTTTTATAATATCAGGG + Intronic
964806082 3:160611194-160611216 AAAAAGTTTCTACAGTAGCAGGG + Intergenic
965274135 3:166658744-166658766 AAAAAGCTTCTGTACAACAAAGG + Intergenic
965274361 3:166662088-166662110 AAAAAGCTTCTGTACAACAAAGG - Intergenic
965952066 3:174321568-174321590 AAAAATCTTCTGTAAAACCAGGG + Intergenic
966290128 3:178345675-178345697 AAAAAGCATATGTAAAATCATGG - Intergenic
966327950 3:178778237-178778259 TTAAAGCTTCAGTTGTATCAAGG - Intronic
966531350 3:180984768-180984790 AAAAAGCTACTCTTGTTTCAAGG + Intronic
967659406 3:192087321-192087343 AAAAATCTTCTGAAGTACCTGGG + Intergenic
968079714 3:195837509-195837531 ACAAATCTTCTTTAGTATAAGGG - Intergenic
971400967 4:26274981-26275003 AAAAAGTTTCTAAAGTACCAGGG + Intronic
971542405 4:27835965-27835987 AAAAAGCATCTATAGAAACATGG - Intergenic
973554865 4:52072777-52072799 AAAAATGTTCTGTAATATGAGGG + Intronic
973833606 4:54787154-54787176 AAAAAGCTTCTGTACAACAAAGG - Intergenic
973922235 4:55699591-55699613 AAAAAGCTTCTGTACCACAAAGG + Intergenic
975074241 4:70185102-70185124 AAAAAGCTTTAGTAGGATTAAGG + Intergenic
976202441 4:82592996-82593018 AGAAAGTTTCTGTAGCAACATGG + Intergenic
976487011 4:85618941-85618963 AAAAAGCTTCTGTACTGCAAAGG - Intronic
977525432 4:98140334-98140356 AAAAATCCTTTGTAATATCAAGG - Intronic
977689046 4:99882982-99883004 AAAAAGCATCTGAACTCTCAAGG + Intronic
978252700 4:106652091-106652113 AAAAAGCTGCAGTAATGTCAAGG + Intergenic
978907538 4:114025494-114025516 AATAAGCTTCTATACCATCAAGG + Intergenic
979685976 4:123510670-123510692 AAAAAGCTTGTGGGGCATCAAGG - Intergenic
979771833 4:124535210-124535232 AAAAAACTGCTGTAGTAGGAAGG - Intergenic
981474810 4:145178206-145178228 AAGAGGCTTCTGTATAATCAAGG + Intronic
981797020 4:148606857-148606879 AAAAACCTTCTGTTGCATCTGGG - Intergenic
981906659 4:149928936-149928958 AAAAACTTTCTGTAGGATGAGGG + Intergenic
982891201 4:160852912-160852934 AAAAATCTTCTGTAGTAGTCTGG + Intergenic
982908016 4:161102038-161102060 AAAAGGCTCCTGTAGTTTTATGG + Intergenic
983808266 4:172022101-172022123 AAAAAGCTTCTGAACAAGCAAGG + Intronic
983862825 4:172729204-172729226 AAAAAGCTTCTGAACTACAAAGG - Intronic
984358755 4:178700411-178700433 AAAAAGTTTCTGTTGTGGCAGGG + Intergenic
984508467 4:180650975-180650997 AAAAAGCTTCCTTAATACCAAGG + Intergenic
986176594 5:5357749-5357771 AAACAGCATCTGTAGTTTCAGGG - Intergenic
987221361 5:15793226-15793248 AATAAACTTCTGTTGTTTCAAGG - Intronic
987256526 5:16159232-16159254 AGGAAGCTTCTGTTGTATGATGG - Intronic
987952854 5:24698356-24698378 AGAAAGCTTCTGTACAATGAAGG - Intergenic
987999779 5:25332933-25332955 AAAGAACTTTTGTATTATCAAGG + Intergenic
989548488 5:42703031-42703053 AAAAAGCTTCTGCACTGCCAAGG - Intronic
989756155 5:44957560-44957582 AAAAAACTTCTGTACAACCAAGG - Intergenic
990116333 5:52396689-52396711 AAAATGTTTCTGTAGAAACAGGG - Intergenic
990905508 5:60798426-60798448 AAAAAGCTTCTGTAGTATCAAGG - Intronic
991076314 5:62543121-62543143 AAAATGCTTGTGTTATATCATGG - Intronic
991512078 5:67389509-67389531 AAAAAGCCTCTGTACAACCAAGG - Intergenic
991556383 5:67899474-67899496 AAGAAGCTTATGTATTGTCATGG + Intergenic
992053724 5:72966203-72966225 AAAAAGTTTATGTAGAAACAGGG - Intronic
992400581 5:76407805-76407827 AAAAAGCTTGTGTAGTAAGAGGG - Intronic
993636080 5:90345364-90345386 AACAAGCTTCTGCTGTAGCATGG - Intergenic
994901445 5:105776768-105776790 AAAATCTTTCTGTGGTATCATGG + Intergenic
995038817 5:107565128-107565150 AAAAACCTTCTGTGGTTTCAGGG + Intronic
995258938 5:110078939-110078961 AAAAAGCTTCTGTACAGTAAAGG + Intergenic
997777737 5:136626541-136626563 AAAAAAATTCTCTAGTATCTAGG - Intergenic
1004040249 6:11968122-11968144 AAAAAGATCCTGTAGTTTCAGGG - Intergenic
1004056932 6:12148541-12148563 AACAACCTTTTGTGGTATCATGG + Intronic
1004112645 6:12734679-12734701 AGAAAGTTACTGTAGTCTCATGG + Intronic
1004711708 6:18177579-18177601 AAAAATTTTCTGTAGTGACAGGG + Intronic
1004897223 6:20160454-20160476 AAAAAGCTTCTGTACAACAAAGG + Intronic
1005054178 6:21714465-21714487 AAAAAGCTTCTGTCCTGTAAAGG + Intergenic
1005228891 6:23676123-23676145 AATAGGCTTCAGTAGTATTATGG + Intergenic
1006949586 6:37810491-37810513 AAAAAGCTCCTGTAGAAAAACGG + Intergenic
1008188213 6:48421887-48421909 AGAAAGCTTTTCTACTATCATGG - Intergenic
1008774616 6:55022576-55022598 AAAAAGCTTCTGTATGGTGATGG + Intergenic
1009416377 6:63420279-63420301 AAAAGGCTACTGTAGTTTTATGG - Intergenic
1009568585 6:65348688-65348710 AAAATGCTTCTGTAGAAGAAAGG - Intronic
1010038560 6:71355090-71355112 AAAAAGGTTTTGTAATCTCAGGG + Intergenic
1010466559 6:76173829-76173851 AAAAAAATTCTGGAATATCAAGG + Intergenic
1010561884 6:77361081-77361103 AAAAACCTGCTGTAGTATGCTGG - Intergenic
1010668809 6:78661676-78661698 AAAAATATGCTGTATTATCAAGG + Intergenic
1011341405 6:86319093-86319115 AAAAAGCTTCTGTATGACAAAGG + Intergenic
1012011751 6:93796587-93796609 AAAAAGCTTCTGCACAATAAAGG + Intergenic
1012160071 6:95873530-95873552 AAAAACTTTCTGTAGTTTCTAGG + Intergenic
1012293259 6:97485441-97485463 AAAAAGCTTCTGCAGATTAAAGG - Intergenic
1012601372 6:101101619-101101641 AAAAAGCTTCTGCACAGTCAAGG - Intergenic
1013640505 6:112073124-112073146 AAAAGGCTTCTGCAGTATATGGG + Intronic
1014131889 6:117844952-117844974 AAAAAGCTTCTGCACCATAAAGG + Intergenic
1017344171 6:153360158-153360180 AAAAAGAATCTTTGGTATCAAGG + Intergenic
1021610201 7:22450106-22450128 AAAAAGCTTCTGTACTGCAAAGG - Intronic
1021739796 7:23675059-23675081 AAAAAGCTTCTGCACTGCCAAGG - Intergenic
1022756840 7:33302252-33302274 AAAAAGCTTCTGTACAGTGAAGG - Intronic
1022757312 7:33306346-33306368 AAAAACCTTCAGTAGCATGATGG - Intronic
1023213557 7:37834079-37834101 AAAAAGTTTCTGTACAACCAAGG - Intronic
1024783780 7:52882815-52882837 AAGCAGCCTCTGTATTATCATGG + Intergenic
1025246545 7:57321869-57321891 AGAAAACTTCTGCAGTGTCATGG - Intergenic
1027919560 7:84375439-84375461 TAAAATCTTCTTCAGTATCAGGG + Intronic
1028755672 7:94431099-94431121 ACAAAGCTTCTGTGGAACCATGG - Exonic
1028897330 7:96056786-96056808 AACAAGCATCTGTAGTAAGAAGG + Intronic
1029963843 7:104717321-104717343 AAAAAGCTTCTGCAGAACAAAGG + Intronic
1030233346 7:107231600-107231622 AGAAAGGTGCTGTACTATCAGGG - Intronic
1031187640 7:118502800-118502822 AAAAGACTTCTGCAGTTTCAAGG + Intergenic
1032770392 7:135047842-135047864 AAAACGCTTCTGTACAACCAAGG - Intronic
1033446525 7:141427717-141427739 AAAAAGCTTCTGTACAGTAAAGG + Intronic
1034580437 7:152037055-152037077 AAAAAGCTTCTGTACAACAAAGG - Intronic
1035922313 8:3691016-3691038 AAAAAGATACTTTAGTACCAGGG - Intronic
1036397958 8:8385006-8385028 AAAAAGAATCTGAAGAATCAAGG + Intronic
1036923819 8:12884171-12884193 AAAAAATTTCTGTAGAAACAGGG - Intergenic
1037648550 8:20816071-20816093 AAAACCCATCTGTAGTAACACGG + Intergenic
1040138764 8:43885653-43885675 AAAATGTGTCTGTAGTAACATGG + Intergenic
1040760164 8:50832020-50832042 AAAAAACTTCTGGAATATCAGGG - Intergenic
1041871388 8:62638485-62638507 CAAAATCTTCTGTATTATCTTGG + Intronic
1042736053 8:71990254-71990276 AAAGAGCTTCTGTTGTATTTTGG - Intronic
1042787181 8:72561125-72561147 AAAAAGCATCGGTTATATCAAGG + Intronic
1044731980 8:95236319-95236341 AAAAAACCTATGTAGAATCATGG + Intergenic
1045762533 8:105627628-105627650 ACAAAGCTGTTGTAGTATTAGGG - Intronic
1046069831 8:109237123-109237145 AAGAAGTTTCTGTGGTACCAGGG - Intergenic
1046225487 8:111273418-111273440 AAAAAGCCTCAGCATTATCAGGG - Intergenic
1048736515 8:137507965-137507987 AAAAAACTGCTGAAGTTTCAGGG + Intergenic
1048750181 8:137664118-137664140 ATAAGGCCTCTGTAGTTTCATGG + Intergenic
1049876878 8:145029542-145029564 AAAAGGCATCTATAGTAACATGG - Intergenic
1051975672 9:22944960-22944982 AAAAACATACTCTAGTATCACGG + Intergenic
1052152746 9:25139305-25139327 AAAAAGCTTCTGTAAAACAAAGG + Intergenic
1052694755 9:31863300-31863322 AAAAAGCTTCTGCACAGTCAAGG - Intergenic
1054748862 9:68884166-68884188 AAAAAGCTTCTGCACTACAAAGG + Intronic
1055002990 9:71474635-71474657 ATAAAGCTTCTGTTTTAGCAGGG + Intergenic
1056099138 9:83284268-83284290 AAACAGCTTCTGCTGTTTCATGG + Intronic
1056500095 9:87200268-87200290 AAAAAGCTTCTGTTTTATATAGG + Intergenic
1058015602 9:100029201-100029223 AAAAAGCTTCTGTAGGGCAAGGG + Intronic
1059843797 9:118248239-118248261 AAAAAGCTTCTGTACAGCCAAGG - Intergenic
1061440050 9:130595768-130595790 AAAAGATTTCTGTATTATCAAGG - Intronic
1061638732 9:131934292-131934314 AAAAAGCTTCTGTACTGCAAAGG + Intronic
1186657067 X:11624391-11624413 AAAAAGCTTCTGCAGTGGAAAGG + Intronic
1188741669 X:33790837-33790859 AAAAAGCTTCTGTAAAACAAAGG - Intergenic
1189550868 X:42091578-42091600 ATAAAACTTCTTTAGCATCAGGG + Intergenic
1190459327 X:50656232-50656254 AAAAAGCTTCTGTACAGCCAAGG - Intronic
1190961407 X:55252805-55252827 AAAAAGCTTCTGTACAGTAATGG + Intronic
1191089543 X:56605306-56605328 AAAAAGCTTCTGTAGAGCAAAGG + Intergenic
1191769957 X:64744234-64744256 AAAAAGCTCCTGTAATGTCAAGG - Intergenic
1192769870 X:74177554-74177576 AAAAAGCTTCTGTACTGCAAAGG + Intergenic
1192826972 X:74707423-74707445 AATAAGTTTCTGTTGTTTCAAGG + Intergenic
1193782870 X:85724173-85724195 AAAAAGCTTCTGTATCACAAAGG - Intergenic
1193816435 X:86109780-86109802 AAAAAGCTTCTGCACTGTAAAGG + Intergenic
1194965302 X:100281608-100281630 AAAAAGCTTCTGTACAGTAAAGG - Intergenic
1195808698 X:108804604-108804626 AAAAAGCTTATCCAGGATCAAGG + Intergenic
1196146525 X:112324316-112324338 AAAAAGCTTCTGCACTGCCAAGG - Intergenic
1197839396 X:130729289-130729311 AAAAAGCTTCTGAATCCTCAGGG + Intronic
1199013157 X:142780685-142780707 AAAATATTTCTGTAGTTTCATGG + Intergenic
1199816362 X:151401011-151401033 AAAAAGCTTCTGTACTGCAAAGG - Intronic
1201964974 Y:19722553-19722575 AAAAAGCTTCTGCATAATGAAGG + Intronic