ID: 990905513

View in Genome Browser
Species Human (GRCh38)
Location 5:60798447-60798469
Sequence TTTAACTTGCTGAGGGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990905506_990905513 6 Left 990905506 5:60798418-60798440 CCCAATTACCTTGATACTACAGA 0: 1
1: 0
2: 0
3: 6
4: 152
Right 990905513 5:60798447-60798469 TTTAACTTGCTGAGGGTGGAGGG No data
990905505_990905513 9 Left 990905505 5:60798415-60798437 CCTCCCAATTACCTTGATACTAC 0: 1
1: 0
2: 0
3: 8
4: 140
Right 990905513 5:60798447-60798469 TTTAACTTGCTGAGGGTGGAGGG No data
990905508_990905513 -2 Left 990905508 5:60798426-60798448 CCTTGATACTACAGAAGCTTTTT 0: 1
1: 0
2: 3
3: 24
4: 284
Right 990905513 5:60798447-60798469 TTTAACTTGCTGAGGGTGGAGGG No data
990905504_990905513 12 Left 990905504 5:60798412-60798434 CCTCCTCCCAATTACCTTGATAC 0: 1
1: 0
2: 1
3: 13
4: 139
Right 990905513 5:60798447-60798469 TTTAACTTGCTGAGGGTGGAGGG No data
990905507_990905513 5 Left 990905507 5:60798419-60798441 CCAATTACCTTGATACTACAGAA 0: 1
1: 0
2: 0
3: 9
4: 133
Right 990905513 5:60798447-60798469 TTTAACTTGCTGAGGGTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990905513 Original CRISPR TTTAACTTGCTGAGGGTGGA GGG Intronic
No off target data available for this crispr