ID: 990905900

View in Genome Browser
Species Human (GRCh38)
Location 5:60802592-60802614
Sequence TTGAATCAGCACATATATCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 111}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990905900 Original CRISPR TTGAATCAGCACATATATCC AGG Intronic
902152591 1:14456004-14456026 TTGAGTCAGCACCAATATTCAGG - Intergenic
902790381 1:18763801-18763823 TTCAATGAGCACATAAATGCGGG + Intergenic
907357509 1:53888470-53888492 TTGAATCAGTAAATATCTCCTGG - Intronic
909923378 1:81409372-81409394 TTGAATCTGCAAATATGTCCTGG + Intronic
910167243 1:84340611-84340633 TTGAATCATGACATATATTATGG - Intronic
910571001 1:88702477-88702499 TAGAACCAGCAAATATATCAAGG - Intronic
914784552 1:150816759-150816781 GTAAAGCAGCACATATATACGGG + Intronic
923382267 1:233433241-233433263 CTGAATGAGCACAGATTTCCAGG - Intergenic
924802839 1:247340094-247340116 TGGAATCAGGACACATATCAGGG - Intergenic
924802848 1:247340150-247340172 TGGAATCAGGACACATATCAGGG - Intergenic
1062888888 10:1040968-1040990 TAGAAACAGAACACATATCCAGG + Exonic
1068010260 10:51440035-51440057 ATTCATCTGCACATATATCCTGG - Intronic
1069248216 10:66234945-66234967 TTGGATCAGCACATATGACAAGG + Intronic
1069388451 10:67906781-67906803 TTGATACAGGAAATATATCCTGG + Exonic
1077550027 11:3196094-3196116 TTCAATCAGTCCATATAGCCCGG - Intergenic
1085336520 11:75700947-75700969 TTGAACCAGCATATGAATCCAGG + Intergenic
1086752157 11:90510447-90510469 GAGAATCAACACATATATTCTGG + Intergenic
1092305769 12:7299198-7299220 TAGCATCAGAACAGATATCCAGG + Intergenic
1094209190 12:27872870-27872892 ATGAATCAACAAATATATTCAGG + Intergenic
1097949358 12:65409933-65409955 TTAAATCAGCACAAATTTTCTGG - Intronic
1098422164 12:70310412-70310434 TTGAATCAGTGCATATATAGTGG - Intronic
1099296498 12:80834571-80834593 TTGAAACAGCCCATACCTCCTGG + Intronic
1099344083 12:81476161-81476183 TGGAATCAGCAAATATCTACAGG + Intronic
1100509654 12:95256820-95256842 CTGAAGCAGCCCATTTATCCTGG - Intronic
1102082556 12:110110261-110110283 TTGAATCAGCTCTTATTTCTTGG - Intergenic
1107069063 13:36250234-36250256 ATAAAGCAGCAGATATATCCAGG + Intronic
1109628890 13:65017679-65017701 TAGATTCAGCATATATATGCAGG + Intergenic
1116254784 14:42538251-42538273 TTGGATAAGCAGATATATGCTGG + Intergenic
1123772588 15:23543723-23543745 TGGAATTAGCACATCTATTCGGG + Intergenic
1127034298 15:54897921-54897943 GTGTGTCAGCACATATATCTAGG - Intergenic
1127322419 15:57859895-57859917 TTGCATCAGCACAGATTTCTGGG - Intergenic
1133518664 16:6534910-6534932 TTGAATGCGCACATATGACCAGG - Intronic
1135673352 16:24393383-24393405 ATGAACCTGCACATGTATCCTGG - Intergenic
1136994344 16:35178060-35178082 TGTACTCAGCACATATATGCAGG + Intergenic
1138411775 16:56846062-56846084 TTAAATCAGCACATATAAGCAGG - Intronic
1138989465 16:62373831-62373853 TTCAATCAGCATATAAGTCCAGG - Intergenic
1139131853 16:64156318-64156340 TTGAACCATCACAAATAACCAGG + Intergenic
1141944411 16:87299414-87299436 TTCAATCAGCACATATTTATTGG - Intronic
1146431812 17:32803880-32803902 TTGAATCATTACAAATTTCCTGG - Intronic
1147454455 17:40528026-40528048 TTCAATCAGCAAGTATTTCCTGG - Intergenic
1148718835 17:49735894-49735916 TTAAATAAGCACATATATGATGG - Intronic
1152118509 17:78403733-78403755 CTGAATCAGCGGATAAATCCAGG - Exonic
1153279781 18:3403834-3403856 TTAAATGAGCTCATATATACAGG - Intergenic
1157077949 18:44487661-44487683 TTAAATTATCACATGTATCCTGG + Intergenic
1158614936 18:58978493-58978515 TTGATTCAACACAAACATCCAGG - Intronic
1159392044 18:67806181-67806203 TTGAATCTGGTCATATAGCCTGG + Intergenic
1160465679 18:79074047-79074069 TAGATTCAGCACATAGGTCCTGG + Intronic
1164468463 19:28508132-28508154 TTCCCTCAGCAGATATATCCGGG + Intergenic
1168426530 19:56243744-56243766 TTAAATCAGAACATATAGTCAGG + Intronic
925612035 2:5709577-5709599 TGCAACCAGCACATATGTCCTGG - Intergenic
926356702 2:12047272-12047294 TTGAATAAGCACATAGACCAGGG - Intergenic
928550879 2:32369107-32369129 TAGCATCAGTACAGATATCCAGG + Intronic
929659797 2:43772607-43772629 TTGAATCAACAGCTATAGCCTGG - Intergenic
930724925 2:54673643-54673665 TTGCCTCAGCACAGACATCCTGG + Intergenic
930854512 2:55998398-55998420 TTTCATCACCACAAATATCCCGG - Intergenic
934301411 2:91778776-91778798 TAGAAGCTGCACATACATCCCGG - Intergenic
935404625 2:102696172-102696194 TTGAATCAGGGCTTATATCATGG + Intronic
935876796 2:107515927-107515949 TGGAAACAGCACATACATCCAGG - Intergenic
936475890 2:112839472-112839494 TTGAAGCAGCACTAGTATCCAGG + Intergenic
938109121 2:128552479-128552501 CTGAATCAGCACCTCTATACTGG + Intergenic
938995104 2:136670075-136670097 TTGAATAAGCAGATTTACCCAGG - Intergenic
944498912 2:200337935-200337957 TTGAATGAACATATATATTCAGG + Intronic
945648294 2:212528939-212528961 TTGTATTATCACATATATCTAGG + Intronic
1174194996 20:48766702-48766724 TTGAATCATCACATAAATCAAGG - Intronic
1176961945 21:15168896-15168918 ATGAACCTGCACATGTATCCTGG + Intergenic
1177115128 21:17075848-17075870 TTGAGTCAGCAAATCTATCTAGG + Intergenic
1177380007 21:20327629-20327651 TTCAATCATCACATATATCTAGG + Intergenic
1177396222 21:20538692-20538714 TTGAATCATCATATGTATTCTGG - Intergenic
1180815026 22:18783946-18783968 TAGAAGCTGCACATATATCCCGG + Intergenic
1181201214 22:21218283-21218305 TAGAAGCTGCACATATATCCCGG + Intronic
1181700529 22:24618684-24618706 TAGAAGCTGCACATACATCCCGG - Intronic
1203225699 22_KI270731v1_random:77148-77170 TAGAAGCTGCACATATATCCCGG - Intergenic
1203265129 22_KI270734v1_random:9636-9658 TAGAAGCTGCACATATATCCCGG + Intergenic
949137419 3:584881-584903 TTGAATAAAAACATATATGCAGG - Intergenic
949760385 3:7464068-7464090 TTGTAACAGCACATATTACCGGG + Intronic
951476810 3:23115591-23115613 TTGAATCACCACCTATGTGCTGG - Intergenic
952212300 3:31240437-31240459 TTGTATTAGCAAATATATCTTGG + Intergenic
957412060 3:79855002-79855024 TTGAATCTGTTCATATATCTGGG + Intergenic
958531322 3:95334922-95334944 TTGAATCTGAAAATATATTCTGG - Intergenic
959479815 3:106857737-106857759 ATAAATCAGCCCATATAGCCAGG + Intergenic
963821335 3:149897996-149898018 TAGAATAAACACATATTTCCTGG - Intronic
972628482 4:40823107-40823129 TGGAATCAGGACTTAAATCCAGG - Intronic
973761411 4:54119657-54119679 TTGACTCTGGATATATATCCAGG - Intronic
978488030 4:109278175-109278197 CTGAATCAGCATATCTATTCAGG + Intronic
978953509 4:114590011-114590033 TTTAATCAGCACCTATACACAGG - Intergenic
979082465 4:116360812-116360834 TTGCCTCAGCACATACATTCAGG + Intergenic
980328303 4:131377168-131377190 TCGAGTCAGAACAAATATCCAGG + Intergenic
983314786 4:166117642-166117664 TAAAATCAGTACATATAGCCTGG + Intergenic
984382341 4:179011183-179011205 TTCAATCGGTAAATATATCCTGG - Intergenic
985178024 4:187224091-187224113 TGCAACCAGCACACATATCCAGG + Intergenic
990905900 5:60802592-60802614 TTGAATCAGCACATATATCCAGG + Intronic
994560274 5:101361055-101361077 ATGAATGAGCACAAATATCATGG + Intergenic
995208314 5:109507753-109507775 TTGACTCTGCACATTTTTCCTGG - Intergenic
998940426 5:147276063-147276085 TTGAATTTGCAAATAAATCCTGG + Intronic
1000749232 5:165074104-165074126 TCAAATCAGCACAAAAATCCTGG - Intergenic
1003646944 6:7920560-7920582 TTGAATCTGCTGATATATCATGG + Intronic
1006586728 6:35119886-35119908 TGGTATCATCACATATATCCAGG - Intronic
1007871052 6:45038951-45038973 TTTAATCATCAGATATTTCCAGG + Intronic
1010096609 6:72053725-72053747 TTGAATCAGGAAATAAATTCAGG + Intronic
1015811837 6:137168618-137168640 TTTAATCAGCACCTATACACTGG + Intronic
1016648509 6:146437478-146437500 TTGTATCAGAACATACATCAAGG - Exonic
1019291871 7:254476-254498 TTTAATCAGCAAATAAATACAGG + Intronic
1025028366 7:55536214-55536236 TTTAATCAGCCTATGTATCCTGG - Intronic
1027424687 7:78050803-78050825 ATGAAACAGCACATATTTGCAGG + Intronic
1031423567 7:121578994-121579016 TGGATACAGCACATATATCATGG - Intergenic
1033350044 7:140554768-140554790 TTGAATTAGCTCATCTACCCCGG - Intronic
1036285627 8:7442329-7442351 TTGACTCAGCGCCTAGATCCTGG - Intergenic
1036335846 8:7869200-7869222 TTGACTCAGCGCCTAGATCCTGG + Intergenic
1038314455 8:26471671-26471693 TTGAAGCTGCACGTTTATCCAGG - Intronic
1039618749 8:38977478-38977500 CTGAGTCAGCACATCTATCTGGG - Intronic
1039767281 8:40642702-40642724 TTGACTTAGCTCACATATCCTGG - Intronic
1040693266 8:49965380-49965402 TTGCATTAGCAAATATATCCAGG - Intronic
1041152348 8:54948495-54948517 TTGACTCAGCACAGATTTTCCGG + Intergenic
1043280396 8:78458178-78458200 TTGAATCTGCAGATATATTTGGG - Intergenic
1044373001 8:91435918-91435940 TGGAATGAGCACATATATATGGG + Intergenic
1049927744 9:425993-426015 TTATATCAGCTCATATGTCCTGG - Intronic
1050429236 9:5544876-5544898 TCTAAGCAGCACAAATATCCAGG - Intronic
1051008398 9:12379010-12379032 TTCAATCAACACAAATATACAGG - Intergenic
1051756039 9:20401902-20401924 TTGAAACAGAACAGATACCCAGG - Intronic
1057329478 9:94099687-94099709 TTCAGTCAGCAAATATTTCCTGG + Intronic
1059430456 9:114246848-114246870 TCCAATCAGGAAATATATCCAGG - Intronic
1187333683 X:18363493-18363515 TTAAATCAGCAAATACATACAGG - Intergenic
1188531739 X:31148765-31148787 TTTAATTTGCACATACATCCCGG + Intronic
1197388822 X:125835343-125835365 TTGCATCAGCAGAAATATGCAGG + Intergenic