ID: 990907241

View in Genome Browser
Species Human (GRCh38)
Location 5:60817510-60817532
Sequence TTGCCAAATCACTCCCATAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 101}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990907241_990907242 -2 Left 990907241 5:60817510-60817532 CCTCTATGGGAGTGATTTGGCAA 0: 1
1: 0
2: 0
3: 12
4: 101
Right 990907242 5:60817531-60817553 AATATCAACTATAAAACAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990907241 Original CRISPR TTGCCAAATCACTCCCATAG AGG (reversed) Intronic
902175022 1:14642937-14642959 GTGCCAAATCTCTTCCAGAGTGG - Intronic
911524546 1:98968141-98968163 TTGCCAAACCACTCACATAAAGG + Intronic
912000172 1:104822867-104822889 TTGCCAGATCAATCCCATTAAGG + Intergenic
915588365 1:156857372-156857394 TTTCCAAATGACTCCCATCAGGG - Intronic
915864683 1:159486304-159486326 TTGCCAAATCGTTTCCCTAGAGG - Intergenic
921665261 1:217862363-217862385 CAGCCAAATCACTATCATAGAGG - Intronic
922747572 1:228053516-228053538 TTGCCTTTTCAGTCCCATAGTGG - Intronic
923680292 1:236113325-236113347 TTACCAAAGCAGTCCCACAGTGG + Intergenic
1064445065 10:15385774-15385796 CTGCCCTTTCACTCCCATAGTGG + Intergenic
1067366891 10:45640237-45640259 CTGCCATATCATTCCCAAAGAGG + Intronic
1069775009 10:70921486-70921508 TTGCCAAATCATTTCCCAAGTGG + Intergenic
1072105832 10:92272906-92272928 TTGCCAAATCAGTCGGAAAGAGG + Intronic
1073348105 10:102799766-102799788 TTGCCATATCACTGACACAGGGG - Intronic
1073489203 10:103841509-103841531 TGGCCAAAACACTGCCAGAGAGG - Intronic
1073862466 10:107763500-107763522 TTTCCAAATCTCTGCCATAATGG + Intergenic
1080039258 11:27741863-27741885 TTGCAAAATCATTCCTGTAGTGG - Intergenic
1098525066 12:71477876-71477898 TTGCAAACTCACTCTCATGGTGG + Intronic
1101029191 12:100643418-100643440 TTGCCAAACCAGTAGCATAGTGG - Intergenic
1101868654 12:108543982-108544004 GAACCAAATCCCTCCCATAGAGG + Intronic
1102897430 12:116609897-116609919 TTGCCAAATGCCTCCTACAGGGG + Intergenic
1108889361 13:55233950-55233972 TTGCCAAATTGCTTCCATATTGG + Intergenic
1111565984 13:90016766-90016788 TTGCCAAATAACACACAAAGAGG - Intergenic
1113884175 13:113649266-113649288 CTGCCAAATCATCCCCAAAGTGG - Exonic
1116032800 14:39592615-39592637 ATGCCACATCATTGCCATAGTGG - Intergenic
1116462798 14:45197216-45197238 TTGACAAATCACTCCCTCTGAGG + Intronic
1117412401 14:55462595-55462617 TTGTCAAATTTCTCCCCTAGAGG + Intergenic
1119271140 14:73306293-73306315 TTGCCAAATCACTTCAATTGGGG + Intronic
1122874391 14:104656826-104656848 TTTCCAAATCAGTCACATTGGGG - Intergenic
1125611823 15:40976549-40976571 TTGCCAAGTCAGACCCAGAGGGG + Intergenic
1133235636 16:4386187-4386209 TTCTCAAATCACTCCCAGATGGG - Intronic
1134339864 16:13335056-13335078 TTCCCAAATTAGTCCCATGGGGG + Intergenic
1134590017 16:15444937-15444959 GTGCCACAGCACTCCCATATGGG - Intronic
1136120437 16:28129580-28129602 TTGGCAATTCACTGCCCTAGGGG + Intronic
1138167613 16:54817747-54817769 TTGCAAAATCAGTCCTACAGTGG - Intergenic
1138617164 16:58178140-58178162 TTTCTAAATCACTCACATAGAGG - Intronic
1142231899 16:88903862-88903884 TTTCCAAAGCCCTCCCATGGAGG + Intronic
1143622226 17:8087304-8087326 TTGCAAAGTCTCTCCCAAAGTGG + Exonic
1145204340 17:20974225-20974247 TTGCCAAATTACCCCCATGGGGG + Intergenic
1147121812 17:38339523-38339545 TTGCCAATTCACTGCCGTAGGGG - Exonic
1151347760 17:73513523-73513545 TTGCCAAATTGCTCTCGTAGAGG - Intronic
1155058671 18:22208267-22208289 TTGCCAAATTGCTCTCACAGAGG + Intergenic
1157167412 18:45370719-45370741 TTGAGAAATCACTCCCAGAAGGG + Intronic
1167162362 19:47776644-47776666 CTGCCAGATCACTCCCATGAAGG + Intergenic
925135702 2:1524032-1524054 TTCCCAAATCCCCCCCATTGTGG + Intronic
926530486 2:14038856-14038878 TTGCCAAATCACTCACTAATTGG - Intergenic
926843647 2:17109388-17109410 TGGCTAAATCACTCCCCTAAGGG - Intergenic
928480031 2:31674501-31674523 CTGCCATTTCAATCCCATAGGGG - Intergenic
928527640 2:32158874-32158896 TTTTAAAATCACTCTCATAGAGG - Intergenic
931481582 2:62646663-62646685 TTGCCTATTCACTCTCATGGTGG + Intergenic
931482192 2:62652670-62652692 TTGCCTATTCACTCTCATGGTGG - Intergenic
943164010 2:184294082-184294104 TTGTCAAATCTTTCCCATATAGG - Intergenic
944146030 2:196508634-196508656 TATGCAAATCACTCCCATTGGGG + Intronic
947563796 2:231180853-231180875 CTGCCGAATCACTGCCATAGTGG - Intergenic
947870057 2:233430150-233430172 TTGCCAAATTATTCCCACAGGGG - Intronic
1172849094 20:37947736-37947758 TGGCCATTTTACTCCCATAGAGG + Intergenic
1173731350 20:45330848-45330870 TTGCCAAATTGCTTCCAGAGTGG - Intronic
1176693297 21:9944113-9944135 TTGCCTAAACATGCCCATAGTGG - Intergenic
1177887228 21:26761634-26761656 TCACCAGATCACCCCCATAGGGG - Intergenic
1178320361 21:31600561-31600583 TTGCAAGAGCACTCCCAAAGTGG + Intergenic
1181566619 22:23742692-23742714 TTGCCAAAGCACTTTCACAGTGG + Exonic
1184180278 22:42818138-42818160 TACCCAAATCACTTCCATATGGG + Intronic
949971799 3:9413597-9413619 TTTACAAATTACTCCCATAAGGG - Intronic
956575309 3:70746152-70746174 TTGCCAGATTGCTTCCATAGGGG - Intergenic
960086668 3:113598615-113598637 TTGCCCAGTCACTCAGATAGTGG - Intronic
960432052 3:117581221-117581243 TTGCCAAGTGACTCTAATAGAGG - Intergenic
960875633 3:122292535-122292557 TTGCCAGAACACCCTCATAGGGG - Intergenic
962449542 3:135501117-135501139 TTGCCAAATTACTCTCAAACTGG - Intergenic
964793529 3:160474520-160474542 ATGACAAAGCACTGCCATAGAGG - Intronic
964947357 3:162242552-162242574 TAACCAAACCACTCCCATTGGGG + Intergenic
966389632 3:179438409-179438431 TTCCCAAAACAATCCCATAGGGG - Intronic
968255818 3:197270589-197270611 TTGCCAAATCACTACATTTGAGG - Intronic
970564932 4:17322815-17322837 CTTCCAAACCACTCCCTTAGGGG + Intergenic
971335099 4:25715494-25715516 TTGCCAAATTTCCACCATAGGGG - Intergenic
972256266 4:37358976-37358998 TTCCCAGGACACTCCCATAGTGG - Intronic
973834306 4:54793806-54793828 TTGCCAAAACACATCCATTGAGG + Intergenic
980365908 4:131804340-131804362 TTGCCTAAACATGCCCATAGTGG - Intergenic
982610767 4:157571865-157571887 ATGCCAAATCACTGGAATAGTGG + Intergenic
990907241 5:60817510-60817532 TTGCCAAATCACTCCCATAGAGG - Intronic
991319906 5:65361084-65361106 CTGCTAAATCACTTCCATACTGG - Intronic
993604911 5:89977506-89977528 TTGCCAATTCATTGCCATACAGG - Intergenic
998275321 5:140746847-140746869 TTGCCAAATTACCTCCATTGTGG + Intergenic
1005245330 6:23877743-23877765 TTGCCAATTCAATCCCAAAAAGG + Intergenic
1007202350 6:40120739-40120761 TTGCCTGCTCACTTCCATAGAGG - Intergenic
1009625644 6:66136797-66136819 TTGGCAAAACACTCTCACAGGGG - Intergenic
1010508165 6:76686119-76686141 TTGCCAATTTAGTTCCATAGAGG + Intergenic
1010713522 6:79203238-79203260 TTCCCAAATTCCTCCCATAGTGG + Intronic
1010751452 6:79620341-79620363 TTGCCATTTCACTCTCATAAAGG - Intergenic
1011360467 6:86518818-86518840 TTTCCATATCACTCCAAGAGTGG - Intergenic
1012294694 6:97506733-97506755 TTGCCAAATCCCTTCCATGTTGG - Intergenic
1014345436 6:120264338-120264360 TTGCCCATTCACTCTGATAGTGG + Intergenic
1018240081 6:161765290-161765312 TTTCTAAATCATTCGCATAGTGG + Intronic
1019586413 7:1806583-1806605 TTCCCAATTCACTCCCGGAGTGG - Intergenic
1020974595 7:14989098-14989120 TGTCCAAGTCACTCTCATAGAGG + Intergenic
1028420698 7:90629510-90629532 TTTCCAAAACACTCCATTAGAGG - Intronic
1030765634 7:113405845-113405867 TTCCCAAATCCCTCCTATAGGGG + Intergenic
1032920711 7:136543348-136543370 TTGCCAAATGTCCCCCAGAGGGG + Intergenic
1033093889 7:138412881-138412903 TTGCCAAATTGCCCCCAAAGTGG - Intergenic
1036680038 8:10865254-10865276 TTGCAGAACCACTCCCTTAGGGG - Intergenic
1040485666 8:47869193-47869215 ATGGCCAAGCACTCCCATAGTGG - Intronic
1042173796 8:66018960-66018982 TTCCCTCATCACTGCCATAGGGG + Intergenic
1042547473 8:69963996-69964018 TTGCTAAATTACCTCCATAGGGG - Intergenic
1042603007 8:70517843-70517865 TTGCCAAAACAATTCAATAGAGG - Intergenic
1047990650 8:130283098-130283120 TTGCCAAATCCATCCCATGAAGG - Intronic
1050157869 9:2686809-2686831 TTGCCAATTCACTGCCTGAGTGG - Intergenic
1053630254 9:39930200-39930222 TTGCCTAAACATGCCCATAGTGG - Intergenic
1053775516 9:41533328-41533350 TTGCCTAAACATGCCCATAGTGG + Intergenic
1054213633 9:62320502-62320524 TTGCCTAAACATGCCCATAGTGG + Intergenic
1055680677 9:78712045-78712067 TTGCTAAATAACTTACATAGTGG + Intergenic
1057148770 9:92777628-92777650 TTGCCAAAGTACTCCTATATAGG - Intergenic
1058436325 9:104967118-104967140 TTCCCAAATGACTCCCATGGAGG + Intergenic
1060691806 9:125668338-125668360 TTGCAAGATCACTGCAATAGAGG + Intronic
1188681895 X:33019160-33019182 TTACAAAATCAGACCCATAGAGG + Intronic
1194002008 X:88442126-88442148 TTGCCAAACCATTTCCAGAGTGG - Intergenic
1201301890 Y:12514466-12514488 TTGCCAAATCATTCCCACGGAGG + Intergenic