ID: 990921592

View in Genome Browser
Species Human (GRCh38)
Location 5:60974121-60974143
Sequence GTGCCCACCTGGACTGAGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1079
Summary {0: 1, 1: 3, 2: 29, 3: 192, 4: 854}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990921592_990921597 28 Left 990921592 5:60974121-60974143 CCACTCTCAGTCCAGGTGGGCAC 0: 1
1: 3
2: 29
3: 192
4: 854
Right 990921597 5:60974172-60974194 TTAAAGCAGGCAGAAGAAAGTGG 0: 1
1: 51
2: 256
3: 626
4: 1126
990921592_990921596 15 Left 990921592 5:60974121-60974143 CCACTCTCAGTCCAGGTGGGCAC 0: 1
1: 3
2: 29
3: 192
4: 854
Right 990921596 5:60974159-60974181 CAGTGCTGCTAGATTAAAGCAGG 0: 1
1: 2
2: 35
3: 167
4: 429

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990921592 Original CRISPR GTGCCCACCTGGACTGAGAG TGG (reversed) Intronic
900080924 1:856783-856805 GGTCCCACCTGACCTGAGAGTGG - Intergenic
900515157 1:3078268-3078290 GGGCCCACCTGGAGGGAGACAGG + Intronic
900719828 1:4168346-4168368 GTGCCAACCCAGACTGAGGGTGG + Intergenic
900721598 1:4179634-4179656 GTGCCCACCCAGATTGAGGGTGG + Intergenic
900730107 1:4252631-4252653 GTGCCCACCCAGATTGAGGGTGG - Intergenic
900805007 1:4761875-4761897 GTGCCCACCCAGACTGAGGATGG + Intronic
900814795 1:4835290-4835312 GTGCCCACCCAGACTGAGGGTGG + Intergenic
900819887 1:4878526-4878548 GTGCCCACCCAGATTGAGAGTGG - Intergenic
901183567 1:7357881-7357903 GTCCCCACCTGGAATGAGATAGG + Intronic
901920480 1:12532753-12532775 GTGCCCACCCAGATTGAGGGTGG + Intergenic
902149501 1:14431577-14431599 GTGCCCACCTACACTGAAGGTGG - Intergenic
902568359 1:17330739-17330761 GTGCCCACCCATACTGAGGGTGG + Intronic
902868588 1:19298067-19298089 GTGCCCACCCAGATTGAGGGTGG - Intergenic
903553678 1:24177583-24177605 GTGCCCACCCACACTGAGTGAGG + Intronic
904158035 1:28501157-28501179 GAGGCCACCTGGACTGAAACTGG - Intergenic
904614466 1:31742541-31742563 ATGGCCAGCTGGACTGTGAGAGG - Intronic
905383037 1:37577786-37577808 GTGCCCACCCTGAATGAGGGAGG - Intronic
905536136 1:38723304-38723326 GTGCCCACCCAGATTGAGGGTGG + Intergenic
905873087 1:41416126-41416148 GGGCCCACCAGGGCTGAGTGGGG + Intergenic
905903169 1:41595691-41595713 GTGCCCACCCAGATTGAGGGTGG - Intronic
906397083 1:45475729-45475751 GTGCCCACCCAGATTGAGGGTGG - Intronic
906773512 1:48507045-48507067 GTGCCCACCCACACTGAGAAGGG - Intergenic
907147473 1:52248425-52248447 GTGCCCACCCCCATTGAGAGTGG + Intronic
907402036 1:54230176-54230198 GTGCCCACCCAGACTGGGGGAGG + Intronic
907571934 1:55491765-55491787 CTGCCCACCCGGATTGAGGGTGG + Intergenic
907611018 1:55871230-55871252 GTACCCACCCAGACTGAGGGTGG - Intergenic
908038994 1:60086995-60087017 GTGCCCACCCAGATTGAGGGTGG - Intergenic
908052640 1:60249210-60249232 GTGCCCACCCAGAGTGAGGGTGG - Intergenic
908346370 1:63237684-63237706 GTGCCCACCCAGACTGAGGGTGG - Intergenic
909427185 1:75539059-75539081 GTGTCCACCAGGACAGAGACAGG - Intronic
910741085 1:90517267-90517289 GTGCCCACCTACAGTGAGGGTGG - Intergenic
910791492 1:91055638-91055660 GTGCCCACCCAGATTGAGGGTGG + Intergenic
911291848 1:96065963-96065985 GTGCCCACCCAGAGTAAGAGTGG - Intergenic
911339484 1:96619330-96619352 GTGCCCACCCAGACTGAGGGTGG + Intergenic
911743807 1:101417103-101417125 GTGCCCACCCAGATTGAGGGTGG + Intergenic
911761745 1:101625238-101625260 GTGCCCACCTAGATTAAGGGTGG - Intergenic
911763482 1:101643970-101643992 GTGCCCACCCAGATTGAGAGTGG - Intergenic
912119804 1:106456131-106456153 GTGCCCACCCAGAGTGAGGGTGG + Intergenic
912458848 1:109818070-109818092 CTGCTCACCTGGACTCAGATGGG + Intergenic
912630646 1:111243868-111243890 GGGCCCATCTTTACTGAGAGTGG - Intergenic
915793194 1:158697700-158697722 GTGCCCACCCAGATTGAGGGTGG + Intergenic
916919571 1:169449794-169449816 GTGCCCACCCAGATTGAGTGTGG + Intronic
917288485 1:173446601-173446623 GTGCCCACCCAGATTGAGGGGGG - Intergenic
917682118 1:177377880-177377902 GTGCCCACCCAGATTGAGGGTGG - Intergenic
917916828 1:179710487-179710509 AGGCCCACCTGGAATGAAAGGGG - Intergenic
917942214 1:179933605-179933627 GTGCCCACCTACATTGAGGGTGG + Intergenic
918236302 1:182583596-182583618 GTGCCCACCGTGACTGAATGTGG - Intronic
918253299 1:182724106-182724128 GTGCCCACCCAGATTGAGGGTGG - Intergenic
918613486 1:186517909-186517931 GTGCCCACCCAGATTGAGGGTGG + Intergenic
918796559 1:188905585-188905607 GTGCCCACCCAGATTGAGGGTGG - Intergenic
918814652 1:189167570-189167592 CTACCCACCTGGATTGAGGGTGG - Intergenic
918815401 1:189174062-189174084 CTGCCCACCTAGACTGAGGGTGG - Intergenic
918847514 1:189637419-189637441 GTGCCCACCCGGATTGAGGGTGG - Intergenic
918887226 1:190210814-190210836 GTGCCCACCCAGATTGAGGGTGG - Intronic
918911827 1:190582763-190582785 ATGCCCACCTAGATTGAGGGTGG + Intergenic
918924031 1:190756726-190756748 GTGCCCACCCTGACTGAGAATGG - Intergenic
919134646 1:193492552-193492574 GTGCCCACCCAGACTAAGGGTGG - Intergenic
921132597 1:212232583-212232605 GTGCCAACCCAGACTGAGGGTGG + Intergenic
921157908 1:212452562-212452584 GTGCCCACCTTGGCAGGGAGAGG - Intergenic
922156925 1:223047816-223047838 GTGCCCACCCTCACTGAGGGTGG + Intergenic
922225814 1:223645284-223645306 GTGCCCACCCAGATTGAGGGTGG + Intronic
922494590 1:226046692-226046714 GTGCCCACCCACATTGAGAGTGG + Intergenic
922556165 1:226533982-226534004 GTGCCCTGCTGGACTTAGGGTGG - Intergenic
922592063 1:226784825-226784847 GGGCCCACATGGTCTGAGAGGGG + Intergenic
923800004 1:237199556-237199578 GTGCCCACCCGGATTGAGGATGG + Intronic
923839583 1:237653956-237653978 GTGCCCACCCAGATTGAGAATGG + Intronic
923907381 1:238400301-238400323 GTGCTCACCCGCACTGAGGGTGG + Intergenic
924135054 1:240957115-240957137 GTGCCCACCCAGATTGAGGGTGG - Intronic
924213149 1:241791317-241791339 GTGACCACATGGTCAGAGAGGGG - Intronic
924306920 1:242698899-242698921 GTGCCCACCCAGATTGAGGGTGG + Intergenic
924503033 1:244653815-244653837 GTGACCTTCTGGACTTAGAGGGG - Intronic
924934547 1:248756960-248756982 GTGCCCACCCAGACTGAGGGTGG + Intergenic
1063039755 10:2325169-2325191 GTGCCCACCCAGACTGAGGGTGG - Intergenic
1063149239 10:3321726-3321748 GTGCCCACCCAGACTGAGGGTGG - Intergenic
1063175307 10:3545247-3545269 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1063199675 10:3776021-3776043 CTGCCCTCCTTGACTGAGAGTGG + Exonic
1063242243 10:4182967-4182989 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1063262885 10:4410155-4410177 GTGCCCACCCAGACTGAGGGTGG - Intergenic
1063525358 10:6779545-6779567 GTGCCCACCCAGATTGAGGGTGG - Intergenic
1063827147 10:9910839-9910861 GTGCCCACCTAGATTGAGGGTGG + Intergenic
1064156821 10:12909461-12909483 GTGCCAACCCGGGCTGAGTGAGG + Intronic
1064177895 10:13091145-13091167 GTGCCCACCCAGATTGAGGGTGG + Intronic
1064854849 10:19754569-19754591 GTGCCCACCCAGACTGAGGGTGG - Intronic
1064911420 10:20405685-20405707 ATGCCCAACTAGACGGAGAGGGG + Intergenic
1065155845 10:22869430-22869452 GTACCCACCCAGACTGAGAGTGG - Intergenic
1065387412 10:25147381-25147403 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1065501037 10:26382592-26382614 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1065739115 10:28781000-28781022 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1065762913 10:28999668-28999690 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1065868007 10:29930350-29930372 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1066167494 10:32802913-32802935 GTGCCCACCCAGATTGAGAGTGG + Intronic
1066752131 10:38668790-38668812 GTGCCCACCCACACTGAGGGTGG + Intergenic
1067169423 10:43894313-43894335 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1067494055 10:46746534-46746556 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1067600607 10:47593870-47593892 GTGCCCACCCAGATTGAGGGTGG - Intergenic
1067844701 10:49710480-49710502 GGGACCACATAGACTGAGAGTGG - Intergenic
1068238043 10:54263868-54263890 GTGCCCACCCAGATTGAGAGTGG - Intronic
1068406434 10:56595566-56595588 GTGCCCACCCAGATTGAAAGTGG + Intergenic
1068425710 10:56860869-56860891 GTGCCCACCTGGATTAAGGGTGG + Intergenic
1069371942 10:67757470-67757492 GTGCCCACCCAGAGTGAGGGTGG - Intergenic
1069788228 10:71003435-71003457 GTGCCCACCCAGACTGGGGGTGG + Intergenic
1070538466 10:77397808-77397830 GTGTACACATGGACAGAGAGTGG - Intronic
1071033065 10:81207328-81207350 GTGCCCACCAAGATTGAGGGTGG - Intergenic
1071249379 10:83801422-83801444 GTGCTCACCTAGATTGAGGGTGG + Intergenic
1071262426 10:83932888-83932910 GTGCCCACCCAGACTGAGGGTGG - Intergenic
1071281302 10:84106493-84106515 GTGCCCACCCAGATTAAGAGTGG + Intergenic
1071308829 10:84324596-84324618 GTGCCCACCCGAATTGAGGGTGG - Intergenic
1071378698 10:85035871-85035893 GTGCCCACCCAGATTAAGAGTGG - Intergenic
1071652140 10:87401742-87401764 GTGCCCACCCAGATTGAGGGTGG - Intergenic
1072307450 10:94121268-94121290 CTGCCCTCCTGGGCTGAGACTGG - Intronic
1072360042 10:94650634-94650656 GTGCCCACCCGGATTAAGGGTGG - Intergenic
1073753001 10:106550888-106550910 GTGCCCACCTAGGTTGAGGGTGG + Intergenic
1073806518 10:107104517-107104539 GTACACACGTGGACTGAGACTGG + Intronic
1074283560 10:112076716-112076738 GTGCCCACCTAGATTGAGGGTGG - Intergenic
1074531147 10:114299724-114299746 GTGCCCACCCAGACTGAGAGCGG - Intronic
1074872892 10:117591027-117591049 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1074987392 10:118670253-118670275 GTGCCCACCCAGATTGAGGGTGG - Intergenic
1074987596 10:118671436-118671458 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1075141842 10:119844699-119844721 CTGCCCACCCAGACTGAGGGTGG - Intronic
1075217147 10:120545858-120545880 GTGCCCACCCAGATTGAGGGTGG - Intronic
1075573989 10:123565267-123565289 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1075585951 10:123658389-123658411 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1076131605 10:128017638-128017660 GTGGCCACCGAGGCTGAGAGTGG - Intronic
1076576802 10:131474906-131474928 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1076664617 10:132079130-132079152 GTGGGCACCTGGCCTGGGAGCGG + Intergenic
1076725104 10:132409506-132409528 GGGCCCACCGAGCCTGAGAGGGG + Intronic
1078030922 11:7750158-7750180 GTGCCCACCCAGATTGAGGGTGG - Intergenic
1078421669 11:11217708-11217730 GTGCTCACCTAGATTGAGGGTGG + Intergenic
1078460040 11:11507789-11507811 GGGCCCACCCGGATTGAGGGTGG - Intronic
1078739810 11:14055893-14055915 GTGCCCACCTTGTGTGAGACAGG - Intronic
1078782332 11:14451155-14451177 GTGCCCACCCAGATTAAGAGTGG - Intronic
1079182790 11:18208675-18208697 GTGCCCACCCAGATTGAGGGTGG - Intronic
1079848022 11:25494825-25494847 GTGCCCACCCAGACTGAGGGTGG + Intergenic
1079948656 11:26774082-26774104 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1080063412 11:27981573-27981595 GTGCCCCACTGGGCTGAGGGAGG - Intergenic
1080408001 11:31997057-31997079 GTGCCCACCCGGACTGAGGGTGG + Intronic
1080790711 11:35520224-35520246 GGGCCCACGTGGGTTGAGAGTGG - Intronic
1080855718 11:36110002-36110024 AAGCCCAGCTGGGCTGAGAGAGG + Intronic
1081057659 11:38430819-38430841 GTGCCCACCCAGATTGAGGGTGG - Intergenic
1081106358 11:39074905-39074927 ATGCCCACCCACACTGAGAGTGG - Intergenic
1081221310 11:40466213-40466235 GTGTACACATGGACAGAGAGAGG + Intronic
1081647644 11:44800910-44800932 GGGCCCGCCTGGGCTGCGAGGGG + Intronic
1081776006 11:45676317-45676339 GTGCCCACCCAGATTGAGGGTGG - Intergenic
1081812565 11:45922159-45922181 CGGGCCACCTGGACTGAGAGTGG + Intronic
1082919691 11:58479691-58479713 ATGCCCACCCAGACTGAGGGTGG + Intergenic
1083529980 11:63411287-63411309 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1083553624 11:63609086-63609108 GTCTCCACCTGGTCCGAGAGCGG - Intronic
1084598067 11:70128962-70128984 GTGACCACCTGGACTGAGGATGG - Intronic
1085236343 11:75018398-75018420 GTGCCCACCCAGATTAAGAGTGG - Intronic
1085620874 11:78037230-78037252 GTGCCCACGAGGTCTGAGAGTGG - Intronic
1086246701 11:84761490-84761512 GTGCCCACCTAGAATGAGGGTGG - Intronic
1086851499 11:91814873-91814895 GTGCCCACCCACACTGAGGGTGG - Intergenic
1086858225 11:91892446-91892468 GTGCTGACCTGAAATGAGAGTGG - Intergenic
1087366923 11:97231873-97231895 GTGCCCACCCAGATTGAGGGTGG - Intergenic
1087417642 11:97878302-97878324 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1088156276 11:106807722-106807744 GTACCCACCTGGATTGAAGGTGG - Intronic
1088448897 11:109961665-109961687 GTGACCACCCAGATTGAGAGTGG - Intergenic
1088449654 11:109967802-109967824 GTGCCCACCTGGATTGAGAGTGG - Intergenic
1088454563 11:110020173-110020195 GAGCCCACCTGAACTGGTAGTGG - Intergenic
1089370629 11:117953509-117953531 CTGCCCAGCATGACTGAGAGAGG - Intergenic
1089371047 11:117957876-117957898 GTACCCACCCAGACTGAGGGTGG + Intergenic
1090409159 11:126495717-126495739 GTGCCCACATGGGCTCAGAGAGG - Intronic
1090423837 11:126593505-126593527 TTGCCCACCTGTACCCAGAGGGG - Intronic
1090569983 11:128035354-128035376 GTGCCCACCAAGATTGACAGTGG - Intergenic
1090639273 11:128716685-128716707 CAGCCCTCCTGGACTGGGAGAGG - Intronic
1092575533 12:9778472-9778494 GTGCCCGCCCAGATTGAGAGTGG - Intergenic
1093222038 12:16433261-16433283 GTGCCCACCCAGACTGAGGGTGG + Intronic
1093225364 12:16476798-16476820 GCACCCACCTGTACTGACAGGGG + Intronic
1093292295 12:17342742-17342764 GTGCCCACCCAGACTGAGGGTGG + Intergenic
1093596607 12:20969749-20969771 GTGCCCACCCAGATTGAGGGTGG - Intergenic
1093776719 12:23084096-23084118 GTGCCCACCCAGACTGACAGTGG + Intergenic
1093964864 12:25313435-25313457 GTGCCCACCCAGATTGAGGGTGG - Intergenic
1093968553 12:25352864-25352886 CTGCCCACCCTGACTGAGGGTGG + Intergenic
1094679121 12:32651990-32652012 GTGCCCACCCAGATTGAGGGTGG - Intergenic
1095304920 12:40627584-40627606 GTTCCCATGTGGACAGAGAGTGG + Intergenic
1095500115 12:42828523-42828545 GTGCCCACCCGGATTGAGGGTGG + Intergenic
1095692922 12:45110925-45110947 GTGCCCACCCAGATTAAGAGTGG - Intergenic
1095785086 12:46101273-46101295 GTGCCCACCCACACTGAGGGTGG + Intergenic
1096050577 12:48604113-48604135 GTGCCCACCCAGATTGAGGGTGG - Intergenic
1096717863 12:53501781-53501803 GTGCCCACCTTAACTGAGGCAGG + Intronic
1097366688 12:58722523-58722545 GTGCCCACCCAGACTGAAGGTGG + Intronic
1097403170 12:59154646-59154668 GTGCCCACCCAGACTAAGGGTGG + Intergenic
1097554888 12:61124092-61124114 GTACCCACCCAGATTGAGAGTGG - Intergenic
1097581576 12:61463861-61463883 GTGCCCATCTGGATTGAGGGTGG + Intergenic
1098039685 12:66341368-66341390 GTGCCCACCCACACTGAGGGTGG + Exonic
1098995499 12:77114722-77114744 GTGCCCACCCAGATTAAGAGTGG + Intergenic
1099509192 12:83512442-83512464 GTGCCCACCTAGATTGAGGGTGG - Intergenic
1099632431 12:85167637-85167659 GTGCCCACCCAGATTGAGGGTGG + Intronic
1099697780 12:86043550-86043572 GTGCCCACCCAGATTGAGAATGG + Intronic
1099700582 12:86077050-86077072 GTGCCCACCTAGATTAAGGGTGG + Intronic
1100074617 12:90765026-90765048 GTGCCCACCTAGATTGAGGGTGG - Intergenic
1100148173 12:91702617-91702639 GTGCCCACCTAGACTGAGGATGG + Intergenic
1100206576 12:92356455-92356477 GTACCCACTTGGACCAAGAGCGG + Intergenic
1100890811 12:99123820-99123842 GTGCCCACCCAGATTGAGGGTGG + Intronic
1101192662 12:102351202-102351224 GTGCCCACCCAGATTGAGAGTGG + Intergenic
1101213704 12:102560344-102560366 GTGCCTACCTGGACTGAGGGTGG - Intergenic
1101258744 12:103007185-103007207 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1101713829 12:107293157-107293179 GTGCCCACCCAGATTGAGGGTGG - Intergenic
1102395855 12:112585209-112585231 GTGCTCACCCAGACTGAGGGTGG + Intronic
1102669895 12:114609245-114609267 GTGCCCACCTAGACTGAGGTTGG - Intergenic
1102763470 12:115410147-115410169 GTGCCCACCCAGATTGAGGGTGG - Intergenic
1102790182 12:115638225-115638247 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1103148604 12:118617369-118617391 GTGCCCACCCAGACTGAGGGTGG - Intergenic
1104115350 12:125744487-125744509 GTGCTCCCATGGAATGAGAGTGG - Intergenic
1104185096 12:126422909-126422931 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1104241349 12:126993202-126993224 GTGCCCACCCAGATTGAGGGTGG - Intergenic
1104241578 12:126994799-126994821 GTGCCCACCCAGACTGAGGGTGG + Intergenic
1104311182 12:127655466-127655488 GTGCCCACCCAGATTGAGGGTGG - Intergenic
1104370215 12:128217730-128217752 GTGCCCACCCAGAATGAGGGTGG + Intergenic
1104548072 12:129730685-129730707 GTGCCCACCGAGAATGAGGGTGG - Intronic
1104604845 12:130180331-130180353 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1104681021 12:130751992-130752014 GTGACCAGCTGAACTGAGGGTGG - Intergenic
1105289799 13:19045523-19045545 GTGCCCGCCCAGACTGAGGGTGG + Intergenic
1105515333 13:21084593-21084615 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1105670240 13:22605557-22605579 GTGCCCACCCAGACTGAGGGTGG + Intergenic
1105882141 13:24614528-24614550 CTGACCTCCTGGACAGAGAGAGG + Intergenic
1106331062 13:28740096-28740118 GTGCCCACCCAGACTGAGGGTGG + Intergenic
1106820814 13:33462793-33462815 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1106945303 13:34820866-34820888 GTGCCCACCCAGATTGAGAGTGG + Intergenic
1107400748 13:40066598-40066620 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1107559607 13:41547470-41547492 GTGCCTAGCTGGGCTGGGAGCGG - Intergenic
1107664938 13:42679093-42679115 GGGCCCACCTGAAGGGAGAGGGG + Intergenic
1107783290 13:43927814-43927836 GTGCCCACCCAGATTGAGGGTGG - Intergenic
1108098022 13:46924942-46924964 GTGCCCACCCAGATTGAGGGAGG - Intergenic
1108117616 13:47146715-47146737 ATGCCCACCCAGACTGAGGGTGG + Intergenic
1108199136 13:48025492-48025514 GTGCCCACCTGCACTGAGGGTGG - Intergenic
1108287930 13:48927278-48927300 GTGCCCACCCACACTGAGGGTGG - Intergenic
1108323766 13:49310172-49310194 CTGCTCACCTGGACTGCGGGAGG + Exonic
1108446173 13:50511034-50511056 GTGCCCACCAAGACTGATGGTGG - Intronic
1108933371 13:55859808-55859830 GTGCCCACCCCGACTGAGGGTGG + Intergenic
1108954897 13:56140819-56140841 GTGCCCACCCAGACTGAGGGTGG + Intergenic
1108979903 13:56497684-56497706 GTGCCCACCCAGACTGAGGGCGG - Intergenic
1109045628 13:57407451-57407473 GTGCCCACCCAGACTGCGGGTGG - Intergenic
1109171055 13:59097462-59097484 GTGCCCACCTAGACTGAGGGTGG - Intergenic
1109379641 13:61542942-61542964 GTGCCCACCCAGACTGAGGGTGG - Intergenic
1109415752 13:62037249-62037271 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1109462879 13:62686911-62686933 GTGCCCGCCCAGACTGAGGGTGG - Intergenic
1109799931 13:67363242-67363264 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1110083138 13:71343659-71343681 GTGCCCACCCAGATTAAGAGTGG + Intergenic
1110161083 13:72379515-72379537 GTGCCCACCCAGATTGAGGGTGG - Intergenic
1110409726 13:75191105-75191127 GTGCCCACCCAGATTGAGGGTGG - Intergenic
1110442122 13:75537737-75537759 GTTCCAACCTGGAAGGAGAGTGG - Intronic
1110455836 13:75689566-75689588 GTGCCCACCCAGATTGAGGGTGG - Intronic
1110502531 13:76245176-76245198 GTGCCCACCCAGATTGAGGGTGG - Intergenic
1110738237 13:78963558-78963580 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1110948109 13:81450054-81450076 GTGCCCACCCAGATTGAGAGTGG - Intergenic
1111044524 13:82797087-82797109 GTACCCACCTAGATTGAGGGTGG - Intergenic
1111086506 13:83381529-83381551 GTGCCCACCTAGGCTGAGGGTGG + Intergenic
1111543969 13:89705771-89705793 GTGCCCACCCAGATTGAGTGTGG + Intergenic
1111679572 13:91426764-91426786 GTGCCCACCAAGATTGAGGGTGG + Intronic
1111741418 13:92210054-92210076 GTGCCCACCCAGATTGAGGGTGG + Intronic
1111786236 13:92790125-92790147 GTGCCCACCCAGACTGAGGGTGG + Intronic
1111957957 13:94778979-94779001 GTGCCCACCCAGATTGAGGGTGG - Intergenic
1111977530 13:94982617-94982639 GTGCCCACCCAGACTGAGGGTGG - Intergenic
1112206122 13:97324943-97324965 GTGCCCACCCAGATTGAGGGTGG + Intronic
1112228213 13:97561953-97561975 GTGCCCACCCAGATTGAGGGTGG - Intergenic
1112322895 13:98423164-98423186 GTGCCCACCCAGATTGAGGGTGG + Intronic
1112346245 13:98592484-98592506 GTGGACACCTGGATTAAGAGAGG + Intergenic
1112686746 13:101837881-101837903 GTGCCCACCCAGATTGAGGGTGG - Intronic
1112761397 13:102697210-102697232 GTGCCCATCCTGACAGAGAGAGG - Intergenic
1112953149 13:105027773-105027795 GTGCCCACCTACATTGAGGGTGG - Intergenic
1113024920 13:105929771-105929793 GTGCCCACCCGGATTGAGGGTGG - Intergenic
1113096236 13:106666922-106666944 GTGCCCACCCAGATTGAGAGTGG + Intergenic
1113140739 13:107146484-107146506 GTGCCCACCCAGATTGAGAGTGG - Intergenic
1113512576 13:110867840-110867862 GTGCCCTCATGGAGTGAGTGCGG - Intergenic
1113519152 13:110926394-110926416 GTGCCCACCCAGACTGAGGGTGG - Intergenic
1114038505 14:18653152-18653174 GTGACCACCCAGACTGAGAGTGG + Intergenic
1114120115 14:19661891-19661913 GTGACCACCCAGACTGAGGGTGG - Intergenic
1115040238 14:28915536-28915558 GTGCCCACCAAGATTGAGGGTGG + Intergenic
1115161407 14:30399692-30399714 GTGCCCACCCAGACTGAGGGCGG + Intergenic
1115347995 14:32363701-32363723 GTGCCCACCCAAACTGAGGGTGG + Intronic
1115656379 14:35447522-35447544 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1115787636 14:36844098-36844120 ATGCCCACCTAAACTGAGACAGG - Intronic
1116269518 14:42743048-42743070 GTGCCCACCCAGACTGAGGTTGG + Intergenic
1116661947 14:47721529-47721551 GTGCCCACTCAGACTGAGAGTGG + Intergenic
1117808601 14:59521154-59521176 GTTCCCACCCAGATTGAGAGTGG - Intronic
1118440264 14:65805723-65805745 GTGCCCACCCAGATTGAGAGTGG + Intergenic
1118449697 14:65888850-65888872 GTGCCCACCCAGATTGAGAGTGG + Intergenic
1118675798 14:68183435-68183457 GTGCCCACCAAGATTGAGGGTGG + Intronic
1118769447 14:68932183-68932205 GTGCCCACCCAGATTGAGGGTGG - Intronic
1118865842 14:69702937-69702959 GTGCACTCTTGGCCTGAGAGGGG - Intronic
1119052775 14:71386388-71386410 GTGCCCACCCAGATTGAGGGTGG + Intronic
1119132302 14:72185217-72185239 GTGCCCACCCAGATTGAGAGTGG + Intronic
1119147341 14:72329378-72329400 TTGCCCACCTGGAGTGTGAGGGG - Intronic
1119532801 14:75374683-75374705 GTGCCCACCCAGATTGAGGGTGG - Intergenic
1119676737 14:76561396-76561418 GTGCCCACCTAGACTGAGTGTGG - Intergenic
1120298371 14:82674511-82674533 GTGCCCACCCAGATTGAGGGTGG - Intergenic
1120676844 14:87430632-87430654 GTGCCCACCCAGACTGAGGGTGG - Intergenic
1120865648 14:89293377-89293399 CTGCCCTCCAGGACTGTGAGAGG - Intronic
1121082511 14:91119752-91119774 GTGCCCACCCAGACTGAGGGCGG - Intronic
1121245945 14:92460884-92460906 GTGCCCACCTGGCCTGATGGTGG + Intronic
1121422921 14:93828239-93828261 GTGCCCACCCAGACTAAGGGTGG + Intergenic
1122378391 14:101284765-101284787 GGGCCCACCCAGACTGAGGGTGG - Intergenic
1123128435 14:105966691-105966713 GTGCCCACCTAGATTAAGGGTGG - Intergenic
1124136172 15:27038107-27038129 GTGGCCAACCGGACTGAGATGGG - Intronic
1124194184 15:27606237-27606259 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1125482097 15:40088186-40088208 CTGGCCACCTGCACAGAGAGAGG + Exonic
1126283912 15:46988711-46988733 GTGCCCACCCAGATTGAGGGTGG - Intergenic
1126452211 15:48820657-48820679 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1126874469 15:53025105-53025127 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1127326164 15:57897091-57897113 GTGCCCACCCAGACTGAGGGTGG + Intergenic
1127380056 15:58423199-58423221 GTGCCCACCCAGATTGAGGGTGG - Intronic
1127574187 15:60273874-60273896 GTACCCACCCAGATTGAGAGTGG + Intergenic
1127923595 15:63515850-63515872 GTGGACAGCAGGACTGAGAGTGG - Intronic
1128207609 15:65867198-65867220 GTGCCCACCCGGATTAAGGGTGG + Intronic
1129170292 15:73803517-73803539 CTGCCCTCCTGGAGTGAGGGCGG - Intergenic
1130066372 15:80608316-80608338 GTGCCCACCGGGATTGAGGGTGG - Intergenic
1130768562 15:86899910-86899932 GTGCCCACCCAGATTGAGGGTGG - Intronic
1130772542 15:86939220-86939242 GTGCCCATCCAGATTGAGAGTGG - Intronic
1131035393 15:89218686-89218708 GTGCCCACCTGGGCAGAGAAAGG + Exonic
1131600147 15:93838887-93838909 GTACCCACCCAGATTGAGAGTGG + Intergenic
1132102016 15:99030455-99030477 GTGCACAGCTGGACTCGGAGAGG + Intergenic
1132616003 16:841465-841487 GTGTCCCCCTGGCCTGAGAGGGG + Intergenic
1132750375 16:1454835-1454857 GAGCCCACCTGCCCCGAGAGCGG + Intronic
1133387766 16:5384243-5384265 CTCCCTACCTGGACTGAAAGTGG + Intergenic
1133392170 16:5419457-5419479 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1134027392 16:10964639-10964661 GTGCCTAGCTGGACTTTGAGAGG - Intronic
1134128439 16:11632304-11632326 CTCCCCACATGGACTGAGAAAGG + Intronic
1134570250 16:15284555-15284577 GTGCCCACCCAGATTGAGGGTGG - Intergenic
1134732125 16:16471498-16471520 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1134814876 16:17197577-17197599 ATGCCCACCCAGACTGAGAGTGG - Intronic
1134935312 16:18240465-18240487 GTGCCCACCCAGATTGAGGGTGG - Intergenic
1135518968 16:23158856-23158878 GTGCCCACCCAGATTGAGGGTGG - Intergenic
1137926395 16:52546272-52546294 CAGCCCCCCTGGACTGAGTGGGG - Intronic
1137935574 16:52632004-52632026 GTGCCAACCTTGACTGACTGGGG + Intergenic
1137997741 16:53237284-53237306 GTGGGCACCTGGTCTAAGAGAGG - Intronic
1138033882 16:53583020-53583042 GTGCCCACCCAGACTGAGGGTGG - Intergenic
1138268879 16:55680580-55680602 GTGCCCACCCAGACTGAGGGTGG + Intronic
1138493500 16:57392493-57392515 GTGCCCACCCAGATTGAGGGTGG - Intergenic
1138578163 16:57922084-57922106 GTGGGCAACTGGACTGAGGGTGG + Intronic
1138626400 16:58255365-58255387 GTGCCCACCCACACTGAGGGTGG + Intronic
1138629378 16:58281337-58281359 GTTCCCACCTTGGCTCAGAGAGG - Exonic
1139116728 16:63963333-63963355 GTGCCCAACCAGACTGAGAGTGG - Intergenic
1139216968 16:65135515-65135537 GTGCCCACCCAGATTGAGGGTGG - Intergenic
1139702352 16:68715813-68715835 GTGCCCACCAGCAAGGAGAGGGG - Intronic
1140337494 16:74122012-74122034 GTGCCCACCCAGATTAAGAGTGG + Intergenic
1141024400 16:80531166-80531188 GTGCCCACCCAGATTGAGGGTGG - Intergenic
1141275743 16:82586533-82586555 GTGCCCACCCAGACTGAGAGTGG - Intergenic
1141324267 16:83040622-83040644 ATGCCCACCCAGACTGAGGGTGG + Intronic
1141547608 16:84781741-84781763 GTGCCCACCCAGATTGAGGGTGG - Intergenic
1141814407 16:86399970-86399992 GTGTCAAGGTGGACTGAGAGAGG + Intergenic
1142221987 16:88859958-88859980 GGGCCCACCTGGACTGGATGCGG - Exonic
1142310194 16:89307722-89307744 GTCCCCACCTGGAATGAGATAGG + Intronic
1142413397 16:89927526-89927548 GTTCCCACTTGGATAGAGAGAGG - Intronic
1142489135 17:266577-266599 GTGCTCTCCTGGGCTGAGTGGGG - Intronic
1143485453 17:7251515-7251537 GGGCCCACATGGGCTGGGAGTGG + Exonic
1144089598 17:11842788-11842810 GTGCCCACCCAAACTGAGAGTGG + Intronic
1144154616 17:12487095-12487117 GTGCCCACCCTGATTGAGGGTGG + Intergenic
1144412351 17:15013410-15013432 GTGCTCACCCAGACTGAGGGTGG - Intergenic
1145263976 17:21370682-21370704 GTGCCCACCAGGGTAGAGAGGGG + Intergenic
1146694465 17:34898112-34898134 CTCCCCACCAGGACTGGGAGAGG + Intergenic
1147899195 17:43772871-43772893 CAGCACACCTGGACTGAGACAGG + Intronic
1148812801 17:50305063-50305085 GTGCCCAACTAGGCTGAGAGAGG + Intergenic
1148820738 17:50358192-50358214 GTGCCAACCTGTAGAGAGAGAGG - Exonic
1148820907 17:50359166-50359188 CTGCCCACCTGGCCAGACAGTGG - Intronic
1148952443 17:51325481-51325503 GTGCCCATCTAGATTGAGGGTGG - Intergenic
1149207852 17:54268945-54268967 GTGCCCACCCAGATTGAGAGTGG + Intergenic
1149219798 17:54403619-54403641 GTGTCCACCCAGACTGAGGGTGG + Intergenic
1149397701 17:56261764-56261786 GTGCCCACCCGGACTGAGAGTGG + Intronic
1149770708 17:59318684-59318706 GTACCCACCCAGACTGAGGGTGG - Intergenic
1150627632 17:66852021-66852043 GTGCCCATCCACACTGAGAGTGG - Intronic
1151034558 17:70783282-70783304 GTGCCCACCCAGATTAAGAGTGG + Intergenic
1151184935 17:72356903-72356925 GTGCCCACCCAGATTGAGTGTGG - Intergenic
1151368537 17:73632273-73632295 GTGCCCACCCAGACTGAGGGTGG - Intronic
1151504268 17:74516233-74516255 GTGCCCACCCGGATTGAGGGTGG + Intergenic
1151550437 17:74819612-74819634 GGGCACACCTGGACTGGCAGAGG - Intronic
1152068569 17:78124397-78124419 GTGGCCACCTGGAGTCACAGCGG + Intronic
1152716037 17:81901308-81901330 GTGCCCACCTGGATTGAGGGTGG + Intronic
1152764469 17:82128521-82128543 CTGCCCACCTGTGCTGAGCGGGG + Exonic
1153713576 18:7823546-7823568 GTGCCCACCCAGACTGAGGGTGG - Intronic
1153950439 18:10053846-10053868 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1154071499 18:11156299-11156321 GTGCCCACCCAGATTGAGGGCGG + Intergenic
1155741641 18:29296876-29296898 GTGCCCACCCACACTGAGGGTGG + Intergenic
1156973904 18:43193166-43193188 GTGCCCACCTAGACTGAGGATGG + Intergenic
1157180799 18:45496406-45496428 GTGCCCACCCACACTGACAGTGG - Intronic
1157377220 18:47177668-47177690 GTGCCCACTTGGATTAAGAGTGG - Intergenic
1157394356 18:47329426-47329448 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1157654919 18:49375784-49375806 GTGCCCACCCAGATTGAGGGTGG - Intronic
1157707475 18:49819467-49819489 GTGCCCACCCACACTGAGGGTGG + Intronic
1157753854 18:50200787-50200809 GTGCTCACCCGGATTGAGGGTGG - Intergenic
1157798102 18:50594221-50594243 GTGCCCACCCACACTGAGGGTGG + Intronic
1157821312 18:50772365-50772387 GTGCCCACCCACATTGAGAGTGG + Intergenic
1157845457 18:51000087-51000109 GTGCCCACCCACACTGAGGGTGG - Intronic
1157918875 18:51696063-51696085 GTGTCCACCCAGACTGAGGGTGG - Intergenic
1158446479 18:57526562-57526584 GTGCCCACCCAGACTGAGGGTGG - Intergenic
1158488467 18:57889162-57889184 TGGCCCACCTGGGCTGAGTGTGG + Intergenic
1158946082 18:62448052-62448074 GTGCCCACCCAGATTGAGGGTGG - Intergenic
1159151607 18:64530201-64530223 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1159162485 18:64661017-64661039 GTGCTCACCCAGACTGAGGGTGG - Intergenic
1159208553 18:65285714-65285736 GTGCCCACCTAGATTGAGGGCGG - Intergenic
1159378118 18:67620658-67620680 GTGCCCACCCAGATTGGGAGTGG - Intergenic
1159481803 18:68998810-68998832 GTGCCTACCCAGACTGAGGGTGG + Intronic
1159642667 18:70881843-70881865 GTGCCCACCCAGACTGTGAGTGG - Intergenic
1160126666 18:76180089-76180111 GGGCCCACCCAGATTGAGAGTGG + Intergenic
1160767350 19:814347-814369 GTGCCCACAGGGCCTGAGTGGGG - Intronic
1161362544 19:3859085-3859107 GTGCCCACCCAGAGTGAGGGTGG - Intronic
1162707966 19:12569973-12569995 GTGCCCACCCAAACTGAGGGTGG - Intronic
1162929756 19:13952077-13952099 TTGCCCACCTGGACCGGGCGCGG + Intronic
1163060056 19:14754016-14754038 GTGCCCACCCAGATTAAGAGTGG - Intronic
1163060097 19:14754371-14754393 GTGCCCACCCAGATTAAGAGTGG - Intronic
1163068346 19:14816368-14816390 GTGCCCACACGGATTGAGGGTGG - Intronic
1163195003 19:15711992-15712014 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1163195548 19:15717219-15717241 GTGCCCACCTGGATTGAGGGTGG + Intergenic
1163219411 19:15904121-15904143 GTGCCCACCCAGATTGAGGGTGG - Intergenic
1164547960 19:29184739-29184761 GTGCCCACCTGGATTGAGGGTGG - Intergenic
1165238872 19:34447263-34447285 GTGCCCACCCAGATTAAGAGAGG + Intronic
1165305703 19:35001083-35001105 GCGCCCACCTGGACCGGAAGGGG - Intronic
1165329513 19:35133833-35133855 ATGCCCACCTAGGCTGAGGGTGG - Intronic
1167677347 19:50895484-50895506 GTGCCCACCCAGATTGAGGGTGG - Intergenic
1167882352 19:52470589-52470611 GTGCCCACCCACACTGAGGGTGG - Intronic
1168150471 19:54444790-54444812 GTGCCCACCCACACTGAGAGTGG - Intergenic
925245899 2:2382682-2382704 GTGCCCACCCAGACTGGGTGTGG - Intergenic
925263682 2:2549400-2549422 GTGCCCACCAAGACTGAGGGTGG + Intergenic
925329505 2:3047559-3047581 GTGCCTACCCAGACTGAGGGTGG - Intergenic
925471604 2:4168368-4168390 GTGCCCACCTGGATTGAGGGTGG - Intergenic
925480069 2:4260982-4261004 GTGCCCACCCAGATTGAGGGTGG + Intergenic
925497965 2:4473265-4473287 GTGCCTACCCAGACTGAGGGTGG + Intergenic
925504304 2:4543732-4543754 CTGCCCAAATGGACTGAGACAGG - Intergenic
925516800 2:4692014-4692036 GTGCCCACCCAGACTGAGCACGG - Intergenic
925704793 2:6674170-6674192 GTGCCCACCCAGACTGAGGGTGG + Intergenic
925720273 2:6820645-6820667 GTGCCCACCCAGATTGAGGGTGG + Intergenic
926283688 2:11470643-11470665 GTGCCCACCCAGATTGAGAGTGG + Intergenic
926388531 2:12363002-12363024 GTGCCCACCCTCACTGAGGGTGG - Intergenic
926390456 2:12385981-12386003 GTGCCCACCCAGATTGAGGGTGG - Intergenic
926577748 2:14601038-14601060 GTGCCCACCCACACTGAGGGTGG - Intergenic
926829639 2:16947588-16947610 GTGCCCACCAAGATTGAGGGTGG - Intergenic
926840041 2:17070213-17070235 GTGTCCACCCAGACTGAGGGTGG + Intergenic
926841864 2:17089782-17089804 GTGCCCACCCAGATTGAGGGTGG + Intergenic
927438395 2:23090152-23090174 GTGCCCAACCAGACTGAGGGTGG - Intergenic
927917905 2:26948345-26948367 GGGCCCACCTGGATGGACAGGGG - Exonic
928184903 2:29101559-29101581 GTGCCCACCTGGATTGAGGGTGG + Intronic
928490156 2:31775043-31775065 GTGCCCACCTAGAATGAGGTTGG - Intergenic
929374524 2:41269386-41269408 GTGCCCACCTACACTAAGGGTGG - Intergenic
929881574 2:45841549-45841571 GTGCCCACCCAGATTGAGAATGG + Intronic
929936753 2:46298777-46298799 GGGCCCGGCTGGACTGGGAGCGG - Intronic
930295585 2:49549097-49549119 GTGCCCACCCAGATTAAGAGTGG + Intergenic
931992740 2:67807554-67807576 GTGCCCACCCAGACTGAGGGTGG - Intergenic
932561498 2:72875216-72875238 GTGCCCACCCAGATTGAGGGTGG + Intergenic
932859086 2:75269891-75269913 GTGCCCACCCAGATTGAGGGTGG + Intergenic
933344648 2:81067270-81067292 GTGCCCACCCAGATTGACAGTGG + Intergenic
933588793 2:84208787-84208809 GTGCCCACCCAGATTGAGGGTGG - Intergenic
934151191 2:89149201-89149223 GTGCCCACCCAGATTGAGGGTGG - Intergenic
934216069 2:90032706-90032728 GTGCCCACCCAGATTGAGGGTGG + Intergenic
935444077 2:103137882-103137904 GTGCCCACCCAGACTGAGGGTGG - Intergenic
935719552 2:105967977-105967999 GTGGCCACCTGGACAGCCAGTGG + Intergenic
935882927 2:107584437-107584459 CTGCCCACCCAGACTGAGGGTGG + Intergenic
936078985 2:109419382-109419404 GTGCCTACCTGGACTGTCATGGG - Intronic
936429968 2:112454173-112454195 GTGCCCACCCACACTGAGGGTGG + Intergenic
936513839 2:113169249-113169271 GTGCCTACCTGGGATGGGAGGGG - Intronic
936873732 2:117163575-117163597 GTGCCCACCCAGACTGAGGGTGG + Intergenic
937313373 2:120915753-120915775 GTGCACACCAGGGCTGGGAGAGG - Intronic
937759674 2:125585927-125585949 GTGCCCACCCAGACTGAGGGTGG + Intergenic
937765940 2:125660586-125660608 GTGCCCACCCAGATTGAGGGTGG - Intergenic
938272459 2:129985949-129985971 GTGACCACCCAGACTGAGGGTGG - Intergenic
938443775 2:131360160-131360182 GTGACCACCCAGACTGAGGGTGG + Intergenic
938509102 2:131921386-131921408 GTGCCCACCCAGATTGAGGGTGG + Intergenic
938804851 2:134796639-134796661 GAAGCCACGTGGACTGAGAGAGG + Intergenic
939068636 2:137514269-137514291 GTGCCCACCCGGATTGAGGGTGG - Intronic
939336772 2:140839427-140839449 GTGCCCACCCAGATTGAGGGTGG - Intronic
939410333 2:141816303-141816325 GTGCCCACCTAGACTGAGGGTGG - Intronic
939774053 2:146362306-146362328 GTGCCCACCCAGACTGCCAGTGG - Intergenic
939805780 2:146774784-146774806 GTGCCCACCCAGAATGAGGGTGG - Intergenic
940319214 2:152357994-152358016 GTGCCCACCCAGATTGAGGGTGG - Intronic
940473647 2:154132069-154132091 GTGCCCACCCAGATTGAGGGTGG + Intronic
940646454 2:156397611-156397633 GTGCCCACCCACATTGAGAGTGG + Intergenic
940855477 2:158725676-158725698 GTCTCCATCAGGACTGAGAGTGG + Intergenic
941039133 2:160600627-160600649 GTGCCCACCCAGACTGAGGGTGG - Intergenic
941110680 2:161416728-161416750 GTGGCTGGCTGGACTGAGAGAGG - Exonic
941283120 2:163577678-163577700 GTGCCCACCCAGATTGAGAGTGG - Intergenic
943080251 2:183251297-183251319 GTGTCCACCCAGACTGAGGGTGG + Intergenic
943100902 2:183484972-183484994 GTGCCCACACAGACTGAGGGTGG - Intergenic
943170062 2:184386504-184386526 GTGCCCACCCAGATTGAGAGTGG - Intergenic
943301728 2:186211221-186211243 GTGCCCACCCAGATTGAGGGTGG + Intergenic
943385584 2:187200751-187200773 GTGCCCACCCAGATTGAGGGTGG + Intergenic
943386152 2:187205710-187205732 GTGCCCACCCTGATTGAGGGTGG + Intergenic
943451195 2:188044373-188044395 GTGCCCACCCAGACAGAGGGTGG - Intergenic
943636250 2:190309977-190309999 GTGCCCACTCAGACTGAGGGTGG - Intronic
943922675 2:193729492-193729514 GTGCCCACCCAGATTGAGGGTGG - Intergenic
944021528 2:195111089-195111111 GTGCCCACCTAGATTGAGGGTGG - Intergenic
944422309 2:199544459-199544481 GTGCCCACCCAGATTGAGGGTGG + Intergenic
944579376 2:201118488-201118510 GACCCCACCAGGACTGAGTGGGG - Intronic
944618003 2:201482525-201482547 GTGCCCACCTACATTGAGGGTGG - Intergenic
944745423 2:202650869-202650891 GTGCCCACCCTGATTGAGGGTGG + Intronic
945333054 2:208561549-208561571 GTGCCCACCCAGATTGAGGGTGG + Intronic
945344901 2:208701765-208701787 GTGCCCACCCAGATTGAGGGTGG + Intronic
945725167 2:213465966-213465988 GTGCCCACCCAGATTGAGGGTGG - Intronic
945732171 2:213552751-213552773 GTGCCCACCCAGATTGAGGGTGG - Intronic
946523919 2:220497324-220497346 GTGCCCACCCAGAATGAGGGTGG + Intergenic
946533042 2:220594144-220594166 GTGCCCACACAGACTGAGGGTGG - Intergenic
946847254 2:223870234-223870256 GTGCCCACCCAGACTGAGGGTGG - Intronic
946901502 2:224377322-224377344 GTGCCCACCCAGACTGGGGGTGG - Intergenic
947028090 2:225761796-225761818 GTGCCCACCCAGACTGAGGGTGG - Intergenic
947057454 2:226122710-226122732 GTGCCCACCCAGATTGAGGGTGG + Intergenic
947255961 2:228164021-228164043 GTGCCCACCCACACTGGGAGTGG - Intronic
947294862 2:228619126-228619148 GTGCCCACCCAGATTGAGGGTGG - Intergenic
947356333 2:229299851-229299873 GTGCCCACACAGACTGAGTGTGG - Intergenic
947921041 2:233874531-233874553 GTGCCCACCCAGACTGAGGGTGG - Intergenic
1171236244 20:23527518-23527540 GTGCCCACCCACACTGAGGGTGG - Intergenic
1171374576 20:24683633-24683655 GTGCCCTCCTGGTCTCAGAAAGG - Intergenic
1173380326 20:42533978-42534000 CTGTCCATCTGGACAGAGAGAGG - Intronic
1173710840 20:45154166-45154188 GTTCCCAACTGCAGTGAGAGTGG - Intergenic
1174094535 20:48077795-48077817 GTGCCCACCCAGACTGAGGGTGG + Intergenic
1174103521 20:48145607-48145629 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1174288386 20:49488808-49488830 GTGCCCACCCACACTGAGGGTGG - Intergenic
1174666184 20:52260159-52260181 GTGCCCACCCAAATTGAGAGTGG - Intergenic
1174699109 20:52589986-52590008 GTGCCCACCCAGATTGAGGGTGG - Intergenic
1174748712 20:53090241-53090263 GTGCCCACCCAGACTGAGGGTGG + Intronic
1175029338 20:55936881-55936903 GTGCCCACCCAGATTGAGGGTGG - Intergenic
1175494276 20:59403346-59403368 GTTCCCACCTGGACTAGGTGCGG - Intergenic
1175735490 20:61384127-61384149 GTGCCCACCCAGACTGAGGGTGG + Intronic
1176124916 20:63471102-63471124 GCGCCCACCTGGGCCGAGAGGGG - Intronic
1176253862 20:64140435-64140457 GCGCCCACCCGGCCTGAGAACGG - Intergenic
1176276783 20:64276956-64276978 GTGCCCACCCAGACTGAGGGTGG + Intronic
1176419980 21:6506313-6506335 GTGCCCACCCACACTGAGGGTGG - Intergenic
1176525290 21:7861740-7861762 GTGCCCACCCAGATTAAGAGTGG - Intergenic
1176784383 21:13237153-13237175 GTGCCCACCCAGATTGAGGGTGG - Intergenic
1176895841 21:14377652-14377674 GTGCCCACCCAGATTGAGGGTGG - Intronic
1177027565 21:15938441-15938463 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1177232448 21:18340172-18340194 GTGCCTACCCAGACTGAGAGTGG - Intronic
1177325845 21:19587689-19587711 GTGCCCACTCAGACTGAGGGTGG - Intergenic
1177389022 21:20442971-20442993 GTGCCCACCTGGGTTGAGGGCGG - Intergenic
1177478783 21:21659236-21659258 ATGCCCACCCAGATTGAGAGTGG + Intergenic
1177533030 21:22388159-22388181 GCGCCCACCTAGACTGAGGCTGG - Intergenic
1177538288 21:22458392-22458414 GTGCCCACCCAGATTGAGGGTGG - Intergenic
1177680960 21:24370233-24370255 GTGCCCACCCAGACTGAGCGTGG - Intergenic
1177737868 21:25115663-25115685 GTGCCCACCCAGATTGAGGGTGG - Intergenic
1177884446 21:26731926-26731948 GAGCCCACCTAGATTGAGGGTGG + Intergenic
1177943785 21:27442975-27442997 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1177971048 21:27790054-27790076 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1178260666 21:31097280-31097302 GTGCCCACCTAGATTGAGGGTGG + Intergenic
1178339848 21:31777039-31777061 GTGCCCACCCAGATTAAGAGTGG - Intergenic
1178513324 21:33225723-33225745 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1178659310 21:34491753-34491775 GTGCCCACCCAGATTAAGAGTGG - Intergenic
1179327709 21:40365217-40365239 GTGCCCACCCAGATTGAGGGTGG - Intronic
1179436383 21:41364900-41364922 GTGCCCACCTAGACTGAAGGTGG + Intronic
1179467959 21:41590355-41590377 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1179695471 21:43114633-43114655 GTGCCCACCCACACTGAGGGTGG - Intergenic
1180462631 22:15580194-15580216 GTGACCACCCAGACTGAGGGTGG + Intergenic
1180592293 22:16950912-16950934 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1182253481 22:29020683-29020705 GAGCCCACCTGGACTCTGGGAGG - Intronic
1182535049 22:30994794-30994816 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1182962683 22:34490321-34490343 GTGCCCACCCAGACTGAGGGTGG + Intergenic
1183860274 22:40664881-40664903 GTGCCCACCCACACTGAGGGCGG - Intergenic
1184167018 22:42735704-42735726 CAGCCCACGTGGACTGTGAGAGG + Intergenic
1184380364 22:44141522-44141544 GTGCCCACCTGGATTAAGGGTGG + Intronic
949306036 3:2642330-2642352 GTGCCCACCCAGATTGAGGGTGG + Intronic
949678249 3:6482716-6482738 GTGCCCACCTAGATTAAGGGTGG + Intergenic
949844507 3:8356275-8356297 GTGCCCACCTAGATTGAGGGTGG - Intergenic
950348969 3:12328307-12328329 GCCCCCACCAGGAATGAGAGGGG - Intronic
951112639 3:18822970-18822992 GTGCCCACCCAGATTGAGGGTGG + Intergenic
951112647 3:18823005-18823027 GTGCCCACCCAGATTGAGGGTGG + Intergenic
951840731 3:27031394-27031416 GAGCCCACCTGGACTCAGCCAGG + Intergenic
952313095 3:32208150-32208172 GTGCCCACCCAGACTGAGGGTGG + Intergenic
952642860 3:35619252-35619274 GTGCCCACCCAGATTGAGGGTGG - Intergenic
953410505 3:42688143-42688165 TTGACCATCTGGACTCAGAGTGG + Exonic
953566107 3:44033311-44033333 GTGACCACCTGGACTGGGCTAGG - Intergenic
954698552 3:52440188-52440210 GAGCCCTCCTGCAGTGAGAGAGG - Intronic
955032205 3:55232411-55232433 GTGCCCACCCACACTGAGGGTGG - Intergenic
955489952 3:59471971-59471993 GTGCCCACCCAGAATGAGGGTGG + Intergenic
955535212 3:59916112-59916134 GTGCCCACCAAGATTGAGGGTGG - Intronic
955978380 3:64499519-64499541 GTGCCCACTCAGACTGAGGGAGG + Intergenic
956210408 3:66795992-66796014 GTGCCCAAATGGTATGAGAGGGG - Intergenic
956216273 3:66852626-66852648 GTGCCCACACAGATTGAGAGTGG + Intergenic
956314142 3:67915238-67915260 GTGCCCACCCAGATTGAGGGTGG + Intergenic
956568700 3:70669907-70669929 GTGCCCGCTTAGACTGAGGGTGG + Intergenic
956898047 3:73683938-73683960 GTGCCCACCACCACTGAGGGTGG + Intergenic
957117900 3:76050144-76050166 GTGCCCACCCAGATTGAGGGTGG - Intronic
957242345 3:77675170-77675192 GCGCCCACCCAGACTGAGGGTGG - Intergenic
957452149 3:80393036-80393058 GTGCCCACCCAGATTGAGGGTGG + Intergenic
957453864 3:80415763-80415785 GTGCCCACCCAGACTGAGGGTGG + Intergenic
957656617 3:83086592-83086614 GTGCCCACCCAGACTGACGGTGG - Intergenic
957851933 3:85819264-85819286 GTGCCCACCCACATTGAGAGTGG + Intronic
958601960 3:96306089-96306111 GTGCCCACCCAGATTGAGGGTGG + Intergenic
958778138 3:98509979-98510001 GTGCCCACCCAGACTGAGGGTGG + Intronic
958845923 3:99263918-99263940 GTGCCCACCCAGATTAAGAGTGG + Intergenic
958877541 3:99633227-99633249 GTGCCCACCTGCACTGAGGGTGG - Intergenic
958879567 3:99654234-99654256 GTGCCCACCCAGATTGAGGGTGG + Intronic
959291457 3:104479745-104479767 GTGCCCACCCAGATAGAGAGTGG + Intergenic
959649996 3:108742260-108742282 GTGCCCACCCAGATTGAGGGTGG + Intergenic
959748870 3:109809789-109809811 GTGCCCACCAGGATTGAGGATGG + Intergenic
959775107 3:110150195-110150217 GTGCCCACCCAGACTGAGAGCGG - Intergenic
959868780 3:111302816-111302838 GTGCCCACACAGACTGAGAGTGG + Intronic
960115002 3:113885057-113885079 GGGCCCACATGGACTGGGAGTGG - Intronic
960478012 3:118154344-118154366 GTGCCCACCCAGATTGAGGGTGG + Intergenic
960531551 3:118771306-118771328 GTGCCCACCCAGATTGAGGGTGG + Intergenic
962031399 3:131604512-131604534 GTGCCCACCCAGACTAAGGGTGG - Intronic
962075782 3:132080501-132080523 GTGCCCACCCAGATTGAGGGTGG - Intronic
963067131 3:141272830-141272852 GTGCCCACCCAGATTGAGGGTGG + Intronic
963332448 3:143930339-143930361 GTACCCACCCAGATTGAGAGTGG + Intergenic
963369446 3:144379605-144379627 GTGCCCACCCAGATTGAGGGTGG + Intergenic
963460824 3:145612874-145612896 GTGCCCACCCAGATTGAGAATGG - Intergenic
963549264 3:146700101-146700123 GTGCCCACCCAGATTGAGGGTGG + Intergenic
963615997 3:147538979-147539001 GTGCCCACCCAGATTGAGGGTGG - Intergenic
964828449 3:160856160-160856182 GTGCCCACCGAGATTGAGAGTGG + Intronic
964977653 3:162639642-162639664 GTGCCCACCCCGACTAAGGGTGG + Intergenic
965034960 3:163426132-163426154 GTGCCCACCCGGATTAAGGGTGG + Intergenic
965266476 3:166550194-166550216 TTGCTCACCCAGACTGAGAGTGG - Intergenic
966107234 3:176350839-176350861 GTGCCCACCTGGATTGTGGGTGG + Intergenic
966272263 3:178121505-178121527 GTGCCCACCCAGATTGAGGGTGG + Intergenic
967612925 3:191529135-191529157 GTACCCACCCAGATTGAGAGTGG + Intergenic
967742496 3:193018710-193018732 GTGCCCACCCAGATTGAGGGTGG - Intergenic
967745209 3:193047441-193047463 GTGCCCACCCAGATTGAGGGTGG - Intergenic
967758398 3:193196432-193196454 GTGCCCACCCAGATTGAGGGTGG + Intergenic
967764007 3:193257743-193257765 GTGCCCACCCAGATTGAGGGTGG - Intronic
968430811 4:557313-557335 GTGCCCACCCAGATTGAGGGTGG - Intergenic
968800620 4:2741219-2741241 GTGCCCACCCCGATTGAGGGTGG - Intergenic
968910653 4:3475607-3475629 ATGGCCACCTGGATGGAGAGAGG + Intronic
969035908 4:4253593-4253615 GTGCCCACCCAGATTGAGGGTGG - Intergenic
969071813 4:4545732-4545754 GTACCCACCTAGATTGAGAGTGG + Intergenic
969076554 4:4583462-4583484 GTGCCCACCCAGAGTGAGGGTGG - Intergenic
969082772 4:4632692-4632714 GTGCCCACCCAGATTGAGGGTGG - Intergenic
969284283 4:6193016-6193038 GTGCCCACCCACACTGAGGGTGG - Intronic
969605602 4:8200830-8200852 GTGACCACCAGGGCGGAGAGTGG - Intronic
969672731 4:8598597-8598619 GAGCCCACCTGGCCAGAGAGGGG - Intronic
969983817 4:11186631-11186653 GTGCCCACCCAGATTGAGGGTGG - Intergenic
970213083 4:13731206-13731228 GGGCCCACCTAGATTGAGGGTGG - Intergenic
970329235 4:14962224-14962246 GTGCCCACACAGATTGAGAGTGG + Intergenic
970629066 4:17921772-17921794 GTGCCCACCCAGACTGAGGGTGG - Intronic
970629657 4:17926298-17926320 GTGCCCACCAAGATTGAGGGTGG - Intronic
970733893 4:19142756-19142778 GTGCCCACCCAGACTTAGGGTGG - Intergenic
970935803 4:21568507-21568529 GTGCCCACCCAGATTGAGGGTGG - Intronic
971043949 4:22784002-22784024 GCGCCCACCTAGACTGAGGCTGG - Intergenic
971051453 4:22867162-22867184 GTGCCCACCCACACTGAGGGTGG - Intergenic
971117842 4:23668600-23668622 GAACCCACCTGGATTGAGGGTGG + Intergenic
971189132 4:24410631-24410653 GTGCCCACCCAGATTGAGGGTGG - Intergenic
971565374 4:28132815-28132837 GTGCCTAACTGGATTGAGGGTGG - Intergenic
971790764 4:31167470-31167492 GTGCCCACCCAGACTGAGGGTGG + Intergenic
971857685 4:32063085-32063107 GTGCCCACCCAGATTGAGGGTGG - Intergenic
971935612 4:33143520-33143542 GTGCCCACCCCGATTGAGGGTGG + Intergenic
972013147 4:34209401-34209423 ATGCCCACCTAGATTGAGTGTGG - Intergenic
972039779 4:34578631-34578653 GTGCCCACCCAGACTGAGGGTGG - Intergenic
972073757 4:35057089-35057111 GTGCCCACCCAGACTGAGGATGG - Intergenic
972123929 4:35740372-35740394 GTGCCCACCCAGATTGAGGGTGG - Intergenic
972178163 4:36433123-36433145 GTGCCCACCCAGACTGAGAATGG + Intergenic
972786829 4:42334074-42334096 GTGCCCACCCAGATTGAGGGTGG + Intergenic
972882669 4:43445682-43445704 GTGCCCACCCAGACTGAGGGTGG + Intergenic
972940819 4:44192769-44192791 ATGCCCACCTGGATTGTGGGTGG - Intronic
973035742 4:45403886-45403908 GTGTCCACCCAGATTGAGAGTGG + Intergenic
974328898 4:60450928-60450950 GTGCCCACCCACATTGAGAGTGG - Intergenic
974478751 4:62418348-62418370 GTGCCCACTCAGACTGAGGGTGG + Intergenic
974479478 4:62424548-62424570 TTGCCCACCCAGATTGAGAGTGG + Intergenic
974765896 4:66345449-66345471 GTGCCCACACAGACTGAGGGTGG + Intergenic
974778647 4:66522206-66522228 GTGCCCACCCAGACTAAGGGTGG + Intergenic
975090049 4:70390724-70390746 GTGCCCACCCGGATTAAGGGTGG - Intergenic
975099913 4:70501081-70501103 GTGCCCACCCAGATTGAGGGTGG + Intergenic
975386424 4:73765032-73765054 GTGCCCACCCAGACTGAAGGTGG + Intergenic
975394310 4:73857115-73857137 GTGCCCACCAAGATTAAGAGTGG - Intergenic
975734159 4:77365653-77365675 GTGCCCACCCAGATTGAGGGTGG + Intronic
976788786 4:88853762-88853784 GTGTCGACCTAGACTGAGGGTGG - Intronic
976805415 4:89040849-89040871 GTGCCCACCCAGACTGAGGGTGG - Intronic
976889149 4:90023768-90023790 GTGCCCACCCAGATTGAGTGTGG + Intergenic
977235884 4:94506831-94506853 GTGCCCACCTACATTGAGGGTGG - Intronic
977449061 4:97171256-97171278 GTGCCCACCCTGATTGAGGGTGG + Intergenic
977465553 4:97379811-97379833 GTGCCCACCAAGATTGAGGGTGG - Intronic
977762539 4:100756695-100756717 GTGCCCACCCAGAATGAGAGTGG + Intronic
977899018 4:102397077-102397099 GTGCCCACCCAGATTGAGGGTGG - Intronic
978079393 4:104573628-104573650 GTGCCCACCCAGATTGAGGGTGG + Intergenic
978160800 4:105545717-105545739 GTGCCCACCCAGACTAAGTGTGG + Intergenic
979039322 4:115766805-115766827 GTGCCCACCCAGATTGAGGGTGG - Intergenic
979187672 4:117818786-117818808 GTGCCCACCCAGATTGAGGGTGG - Intergenic
979657548 4:123213519-123213541 GTACCCACCTGAACTCAGAAAGG - Intronic
979898987 4:126193717-126193739 ATGCCCACCAAGACTGAGGGTGG + Intergenic
980188601 4:129494624-129494646 GTGCCCACCCAGATTGAGGGTGG - Intergenic
980217209 4:129867908-129867930 GTGCCCACCCAGATTGAGGGTGG - Intergenic
980475142 4:133304614-133304636 GTGCCCACCCAGATTGAAAGTGG - Intergenic
980737357 4:136907761-136907783 CTGCCCACCAGGACAGAGATGGG - Intergenic
980935795 4:139224566-139224588 GTGCCCACCCAGATTGAGGGAGG + Intergenic
981619131 4:146673847-146673869 GTGCCCACCCAGATTGAGGGTGG - Intergenic
981676420 4:147348194-147348216 GTGCCCACCCAGATTGAGGGTGG + Intergenic
982370074 4:154624841-154624863 GTGCCCACCTACATTGAGGGTGG + Intergenic
982530948 4:156542884-156542906 GTGCCTACCCAGACTGAGAGTGG + Intergenic
982597471 4:157404574-157404596 GTGCCCACTCGCACTGAGGGTGG + Intergenic
982656130 4:158151928-158151950 GTGCCCACCCAGATTGAGGGTGG - Intronic
982894565 4:160902514-160902536 GTGCCCACCCAGACTGGGGGTGG - Intergenic
983020065 4:162665306-162665328 GTGCTCACCCAGACTGAGGGTGG - Intergenic
983284940 4:165727396-165727418 GTGCCCACCCAGACTGAGGGTGG + Intergenic
983459061 4:168004306-168004328 GTGCCCACCTGGATTGAGGGTGG + Intergenic
983459523 4:168010919-168010941 GTGCCCACCCAGATTGAGGGTGG - Intergenic
983844083 4:172494844-172494866 GTGCCCACCCGTATTGAGGGTGG + Intronic
984390897 4:179131014-179131036 GTGCCCACCCAGATTGAGGGTGG - Intergenic
984400701 4:179260511-179260533 GTGCCCAACCAGATTGAGAGTGG - Intergenic
984451994 4:179914194-179914216 GTGCCCACCTGGACTGAGGATGG - Intergenic
985076339 4:186219140-186219162 GTGCCCACCCAGATTGAGGGTGG + Intronic
985590523 5:762133-762155 GTGGCCATCTGGGCTGTGAGTGG - Intronic
985590541 5:762217-762239 GTGGCCATCTGGGCTGTGAGTGG - Intronic
985649590 5:1101196-1101218 CTGCCCACCTGCACTGGGACAGG + Intronic
985832643 5:2245822-2245844 GTGCCCACCCAGATTAAGAGTGG - Intergenic
986133785 5:4955487-4955509 GTGCCCACCCAGATTGAGGGTGG + Intergenic
986147326 5:5090777-5090799 GTGCCCACACAGACTGAGGGTGG + Intergenic
986149115 5:5110733-5110755 GTGCCCACGTGCATTGAGGGTGG - Intergenic
986225694 5:5810039-5810061 GTGCCCACCTAGATTAAGGGTGG - Intergenic
986524752 5:8662172-8662194 GTGCCCACCCACACTGAGGGTGG - Intergenic
986524838 5:8662910-8662932 GTGCCCACCCACACTGAGGGTGG - Intergenic
986614752 5:9604815-9604837 GTGCCCACATGCATTGAGGGTGG - Intergenic
986627729 5:9738317-9738339 GTGTGCTCCTGGACTGTGAGAGG + Intergenic
986763034 5:10897328-10897350 GTGCCCACCCAGATTGAGGGTGG + Intergenic
987158389 5:15114585-15114607 GTGCCCACCTAGACTGAGGGTGG + Intergenic
987189335 5:15458234-15458256 GTGCCCACCCAGATTGAGGGTGG - Intergenic
987395040 5:17415296-17415318 GTCCCCAATTGCACTGAGAGGGG + Intergenic
987560865 5:19518490-19518512 GTGCCCACCCAGATTGAGGGTGG - Intronic
987648194 5:20703889-20703911 GTGCCCACCTGCATTGAGGGTGG + Intergenic
987682895 5:21160751-21160773 ATGCCAACCAGGACAGAGAGGGG + Intergenic
987796785 5:22638521-22638543 GTGCCCACCCAGATTGAGGGTGG + Intronic
987907401 5:24094488-24094510 GTGCCCACCTGGATTGAGGGCGG + Intronic
987920317 5:24271882-24271904 GTGCCCACCCAGACTGAGGGTGG + Intergenic
988233691 5:28510656-28510678 GTGCCCACCCAGATTAAGAGTGG + Intergenic
988405179 5:30815106-30815128 GTGCCTACCTGGATTAAGGGTGG + Intergenic
988748135 5:34164997-34165019 GTGCCCACCCGCATTGAGGGTGG - Intergenic
989043240 5:37249758-37249780 GTGCCCACGTGAACTGAGGAGGG - Intergenic
989331628 5:40266712-40266734 GTGCCCACCCAGATTGAGGGTGG - Intergenic
989605917 5:43244351-43244373 GTTCCCACCTTCACTGAGATGGG + Intronic
990031171 5:51261411-51261433 GTGCCCACCCAGACTGAGGGTGG - Intergenic
990078813 5:51886403-51886425 GTGCCCACCCAGACTAAGGGTGG + Intergenic
990099664 5:52166139-52166161 GTGCCCACCCAGATTGAGGGTGG + Intergenic
990181224 5:53162870-53162892 GTGCCCACCCAGGCTGAGGGTGG + Intergenic
990594625 5:57300463-57300485 GTGGCCACCCAGACTGAGAGTGG - Intergenic
990783357 5:59392222-59392244 GTGCCCACCCAGATTAAGAGTGG - Intronic
990921592 5:60974121-60974143 GTGCCCACCTGGACTGAGAGTGG - Intronic
991034017 5:62109607-62109629 GTGCCCACCCAGATTGAGGGTGG - Intergenic
991259381 5:64650559-64650581 GTGCCCACCCAGATTGAGGGTGG + Intergenic
992056530 5:72996670-72996692 GGGCCCACATGGGCTGGGAGTGG - Intronic
992243274 5:74792330-74792352 GTGCCCACCTGGATTGAGGGTGG - Intronic
992641883 5:78774805-78774827 GTGCCCACCCAGATTGAGTGTGG - Intergenic
992780439 5:80122413-80122435 GTGCCCACCCAGATTAAGAGTGG + Intronic
992948065 5:81829167-81829189 GTGCCCACCTACATTGAGTGTGG - Intergenic
993229358 5:85211940-85211962 GTGCCCACCCAGACTGAGGGTGG - Intergenic
993780966 5:92064871-92064893 GTGCCCACCCCGATTGAGAGTGG - Intergenic
993808821 5:92448203-92448225 TAGCCCAACTGGAATGAGAGGGG + Intergenic
994291057 5:98029480-98029502 GTGCCCACTCAGACTAAGAGTGG + Intergenic
995187161 5:109283555-109283577 GTGCCCACCCAGATTGAGGGTGG + Intergenic
995291576 5:110462402-110462424 GTGCCCACCCAGATTGAGGGGGG - Intronic
995316596 5:110781813-110781835 GTACCCACCTACATTGAGAGTGG - Intergenic
995710205 5:115027481-115027503 GTTCCCACCTGGATTAAGAGTGG + Intergenic
996018873 5:118570355-118570377 GTGCCCACCCAGACTGAGGGTGG - Intergenic
996036057 5:118759952-118759974 GTGCCCACCCAGATTGAGGGTGG + Intergenic
996110949 5:119565827-119565849 GTGCCCACCCAGACTGAGGGTGG + Intronic
996164627 5:120209922-120209944 GTGCCCACCTAGACTGAGGGTGG + Intergenic
996165434 5:120216417-120216439 GTGCCCACCCAGATTGAGGGTGG + Intergenic
996210620 5:120804764-120804786 GTGCTCATCTGGACAGGGAGAGG + Intergenic
996223234 5:120958904-120958926 GTGCCCACACACACTGAGAGTGG - Intergenic
996313101 5:122129094-122129116 GTGCCCACCCAGATTGAGGGTGG + Intergenic
996555948 5:124778979-124779001 GTGCTCACCTACACTGAGGGTGG - Intergenic
996556613 5:124785186-124785208 GTGCCCACCCAGATTAAGAGTGG - Intergenic
996943396 5:129037237-129037259 TTGCGGAGCTGGACTGAGAGGGG + Intergenic
997037723 5:130213184-130213206 GTGCCCACCCAGATTGAGGGTGG + Intergenic
997209007 5:132066792-132066814 CTGCCCTCCTGGACTGAGAAGGG + Intergenic
998258495 5:140609204-140609226 GTGCAGACCTGGCCTGAAAGGGG + Intergenic
998701331 5:144703266-144703288 GTGCCCACCCAGATTGAGGGTGG - Intergenic
998746624 5:145267267-145267289 GTGCCCACCCAGATTAAGAGTGG + Intergenic
998977404 5:147663307-147663329 GTGCCCACCTAGACTGATGGTGG - Intronic
999204022 5:149835603-149835625 CTGCCCACCTGGGCTGGGTGCGG - Intronic
999659992 5:153851053-153851075 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1000111420 5:158111669-158111691 CTGCCCACATGGACTGAGAAGGG - Intergenic
1000416542 5:160990348-160990370 GTGCCCACCCAGACTAAGACTGG - Intergenic
1000448172 5:161350681-161350703 GTGCCCACCCAGATTGAGGGTGG - Intronic
1000679781 5:164168879-164168901 GTGCCCACCCACACTGAGGGTGG + Intergenic
1001699411 5:173695969-173695991 GTGCTCAGCTGGACTGAGAAGGG + Intergenic
1002313851 5:178330807-178330829 GAGCCCACCTGCCCTGAAAGAGG - Intronic
1002476682 5:179470344-179470366 GTGCCCCCCTGCTCTGTGAGTGG + Intergenic
1002645988 5:180655143-180655165 GTGCTCACCCAGACTGAGGGTGG - Intergenic
1003232099 6:4263506-4263528 GTGCCCACCTACATTGAGGGTGG + Intergenic
1003691797 6:8362129-8362151 GTGCCCACCCAGATTGAGAGTGG + Intergenic
1003732685 6:8843598-8843620 GTGCCCACCTAGATTGAGGGTGG - Intergenic
1004021592 6:11780756-11780778 GTGCCTACCCAGACTGAGGGTGG - Intronic
1004518969 6:16344420-16344442 GTGCCCACCCAGATTGAGGGTGG - Intronic
1005047152 6:21653342-21653364 GTGCCCACCCACACTGAGGGTGG - Intergenic
1005265702 6:24109974-24109996 GTGCCCACCTAGACTGGGGGTGG + Intergenic
1005545712 6:26868099-26868121 GTGCCCACCCGCATTGAGGGTGG - Intergenic
1006235969 6:32632793-32632815 GAGCCCACATGGATTGAGAGAGG + Intronic
1006242607 6:32698387-32698409 GTGCCCACCCAGATTGAGGGTGG - Intergenic
1006681060 6:35797106-35797128 GTCTCCACCTGGACTGGCAGGGG - Intronic
1006843334 6:37046074-37046096 CTGGCCAGCTGGACTGGGAGGGG - Intergenic
1007205125 6:40143511-40143533 GTGAGCACCTGACCTGAGAGGGG + Intergenic
1007321914 6:41033873-41033895 GTGCCTACCTGAAGTGGGAGAGG + Exonic
1007972273 6:46064420-46064442 ATGCCCACCTAGAATGAGATGGG - Intronic
1008325727 6:50178926-50178948 GTGCCCACCCAGACTGAGGGTGG + Intergenic
1008340180 6:50354947-50354969 GTGCCCACCCAGATTGAGGGTGG - Intergenic
1008390665 6:50947725-50947747 GTGCCCACCCAGACTGAAGGTGG + Intergenic
1009016424 6:57908875-57908897 GTGCCCACCCGCATTGAGGGTGG - Intergenic
1009570904 6:65382825-65382847 GTGCCCACCTAGATTAAGGGTGG + Intronic
1009622026 6:66089735-66089757 GTGCCCACCTACATTGAGGGTGG + Intergenic
1009660776 6:66607583-66607605 CTGCCCACCCAGATTGAGAGTGG + Intergenic
1009851571 6:69206313-69206335 GTGCCCACCCAGATTAAGAGTGG + Intronic
1010379370 6:75207603-75207625 CTGCCCAGCTGGACTTCGAGTGG - Intergenic
1010448944 6:75980491-75980513 GTGCCCACCCAGATTGAGTGTGG - Intronic
1010580503 6:77591772-77591794 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1010617659 6:78032008-78032030 GTGCCCACCCAGACTGAGGGTGG + Intergenic
1010831777 6:80540202-80540224 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1011103878 6:83757806-83757828 GTCCCCCACTGCACTGAGAGGGG + Intergenic
1011186569 6:84683361-84683383 GTGCCCACACAGATTGAGAGTGG - Intergenic
1011327999 6:86172313-86172335 GTGCCCACCCAGATTGAGGGTGG - Intergenic
1011536257 6:88379577-88379599 TTGCAGACATGGACTGAGAGTGG - Intergenic
1011646002 6:89458689-89458711 GTGCCCACCCAGATTGAGGGTGG + Intronic
1011715632 6:90102496-90102518 GTGCCCTCCTGGGCTGGGCGTGG + Intronic
1011830167 6:91362788-91362810 GTGCCCACCCAGATTGAGGGTGG - Intergenic
1011830354 6:91364400-91364422 GTGCCCACCCAGATTGAGGGTGG - Intergenic
1012420148 6:99056067-99056089 GTGCCCACCCAGATTGAGGGTGG - Intergenic
1012750790 6:103160988-103161010 GTGCCCACCTAGACTGAGAGTGG - Intergenic
1013421812 6:109973923-109973945 CTGCCCACCTGGCATGAGGGAGG + Intergenic
1014042839 6:116849832-116849854 GTGCCCACCCACACTGAGAGTGG - Intergenic
1014160101 6:118157784-118157806 GTGCCCACCCAGATTGAGGGTGG + Intronic
1014328928 6:120035516-120035538 GTGCCCACCCAGATTGAGAGTGG - Intergenic
1014415009 6:121173109-121173131 GTGCCCACCCAGACTGAGGGTGG - Intronic
1014559275 6:122871419-122871441 GTATCCACCTGGATTGAGGGTGG + Intergenic
1014581016 6:123137411-123137433 GTGCCCACCCAGATTGAGGGTGG - Intergenic
1014851418 6:126343791-126343813 GTGCCCACCCAGATTGAGGGTGG + Intronic
1015218132 6:130773606-130773628 GTGCCCACCCAGATTGAGGGTGG - Intergenic
1015375642 6:132507101-132507123 GTGTACACATGGACAGAGAGTGG + Intronic
1015516273 6:134085676-134085698 GTGCCCACCCAGATTGAGGGTGG - Intergenic
1015657825 6:135539895-135539917 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1016165433 6:140936377-140936399 GTGCCCACCCACACTGAGGGTGG - Intergenic
1016435761 6:144035513-144035535 GTGCCCAACCAGACTGAGGGTGG + Intronic
1016439715 6:144070437-144070459 GTGCCCACCCAGATTGAGGGTGG - Intergenic
1016512563 6:144859989-144860011 GTGCCCACCTAGGATGAGGGTGG - Intergenic
1016597454 6:145817267-145817289 GTGCCCACCTAGATTAAGGGTGG + Intergenic
1016769075 6:147828467-147828489 GTGCCCACCCAGATTGAGGGTGG - Intergenic
1016777448 6:147920179-147920201 GTGCCCACCCAGACTGAAGGTGG - Intergenic
1016859908 6:148707202-148707224 GTGCCCATCCAGACTGAGGGTGG + Intergenic
1016938013 6:149462648-149462670 GTGCCCACCCAGATTGAGGGAGG - Intronic
1016998262 6:149976416-149976438 GTGCCCACCCACACTGATAGGGG - Intergenic
1017221705 6:151973031-151973053 GTGCCCACCCAGATTGAGGGCGG + Intronic
1017528653 6:155266038-155266060 GTGCCCACCCAGATTGAGGGCGG + Intronic
1017584138 6:155901634-155901656 GTGCCCACCCAGATTGAGGGTGG - Intergenic
1017618835 6:156273969-156273991 GTGCCCACCCAGACTAAGGGTGG - Intergenic
1017857125 6:158359621-158359643 GTGCCCACCCGGATTGAGGGTGG + Intronic
1017862977 6:158416186-158416208 GTGCCCACCCAGATTGAGGGGGG + Intronic
1017952570 6:159148648-159148670 GTGCCCACCCAGACTGAGGGTGG - Intergenic
1018190772 6:161307516-161307538 GTGCCCATTTGGATTGAGGGTGG + Intergenic
1018254769 6:161906962-161906984 GTGCCCACCCAGATTGAGGGTGG + Intronic
1018382486 6:163271251-163271273 GTGCCCACCCAGATTGAGGGTGG + Intronic
1018530219 6:164755114-164755136 GTGCCCACCCAAATTGAGAGTGG - Intergenic
1018564049 6:165132814-165132836 GTGCCAACCCAGATTGAGAGTGG + Intergenic
1018654447 6:166020539-166020561 GTGCCCACCCACACTGAGGGTGG - Intergenic
1018666739 6:166145571-166145593 GTGCCCACCCAGACTGAGGATGG - Intergenic
1018723946 6:166596373-166596395 GTGCCCACCCAGATTGAGGGTGG - Intronic
1018780760 6:167063223-167063245 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1018830379 6:167438056-167438078 GTGCCCACCCACACTGAGGGTGG - Intergenic
1019029607 6:168999093-168999115 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1019040326 6:169098729-169098751 GTGCCCACCCAGAGTGAGGGTGG - Intergenic
1019135945 6:169907811-169907833 GGGGCCTCCTTGACTGAGAGTGG + Intergenic
1019442241 7:1053240-1053262 GTGCCTGCCTGGACGCAGAGGGG - Intronic
1019462017 7:1164889-1164911 GTGCCCACCCCCACTGAGGGTGG + Intergenic
1019676337 7:2314621-2314643 GTGTCCACGTGGACGGGGAGGGG - Intronic
1019806415 7:3129544-3129566 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1019954554 7:4402985-4403007 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1019974613 7:4570749-4570771 GTGCCCACCCAGATTGAGGGTGG - Intergenic
1020614212 7:10438279-10438301 GAGGCCACCTGCACAGAGAGAGG + Intergenic
1020886273 7:13822537-13822559 GTGCCCACCCGGATTGAGGGTGG - Intergenic
1020890216 7:13869070-13869092 GTGTCCACCCAGACTGAGGGTGG + Intergenic
1021147400 7:17106165-17106187 GTGGCCACCCACACTGAGAGTGG + Intergenic
1021527707 7:21607327-21607349 GTGCCCACCCAGATTGAGGGTGG + Intronic
1022884229 7:34625231-34625253 GTGCCCACCCAGATTGAGGGTGG - Intergenic
1023198943 7:37672692-37672714 GTGCCCACCCAGACTGAGGGTGG - Intergenic
1024602981 7:51001498-51001520 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1024615175 7:51105779-51105801 GTTCCCTCCTAGGCTGAGAGAGG + Intronic
1024747267 7:52422456-52422478 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1026104636 7:67411126-67411148 GTGCCCACCCAGATTGAGGGTGG - Intergenic
1026242628 7:68590195-68590217 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1026261691 7:68761038-68761060 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1026431031 7:70347519-70347541 CTGCTCACCTGGAATGAGAGCGG + Intronic
1026613417 7:71880985-71881007 GTGCCCACCCAGATTGAGGGTGG - Intronic
1027406744 7:77870560-77870582 GTGCCCACCTAGATTAAGGGTGG + Intronic
1027580429 7:79987986-79988008 GTGCCCACCTGGATTGAGGGTGG - Intergenic
1027610398 7:80352708-80352730 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1027807853 7:82852354-82852376 GTACCCACCCAGACTGAGGGTGG - Intronic
1027929250 7:84510040-84510062 GTGCCCGCCCAGATTGAGAGTGG - Intergenic
1028204286 7:87998194-87998216 GTGCCCACCCAGATTGAGGGTGG + Intronic
1028559307 7:92155974-92155996 GTGCCCACCCAGATTGAGGGTGG + Intronic
1028688934 7:93627494-93627516 GTGCCCACCCAGATTGAGAGTGG - Intronic
1028793368 7:94878078-94878100 GTGCACACCTGGGCCAAGAGAGG - Intergenic
1029109848 7:98207456-98207478 GTGCCCACCTGGGCTATGTGGGG + Exonic
1029191223 7:98773669-98773691 GTGCCCACCCAGAATGAGGGCGG + Intergenic
1029334170 7:99886614-99886636 GTGCCCACCTAGATTAAGGGTGG - Intronic
1029574374 7:101393497-101393519 GTGCCCACCCAGATTGAGGGTGG + Intronic
1029590781 7:101505708-101505730 GTGCCCACCCAGATTGAGGGGGG + Intronic
1029607401 7:101607181-101607203 GTGCCCACCCAGATTGAGGGTGG - Intergenic
1029636943 7:101790859-101790881 CTCCCCACCTGGTCAGAGAGAGG + Intergenic
1030273677 7:107696792-107696814 GTGCCCTCCTGGGCCTAGAGGGG + Intronic
1030406019 7:109114561-109114583 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1030532689 7:110730232-110730254 GTGCCCACCCAGATTGAGGGTGG - Intronic
1030784905 7:113646935-113646957 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1030882798 7:114902050-114902072 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1031144145 7:117979191-117979213 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1031296260 7:120008781-120008803 GTGCCCACCCACACTGATAGTGG - Intergenic
1031474863 7:122208956-122208978 GTGCCCACCCAGATTAAGAGTGG + Intergenic
1031549184 7:123087220-123087242 GAGATCACCTGGACAGAGAGGGG + Intergenic
1031643442 7:124193666-124193688 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1032672340 7:134096808-134096830 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1032890610 7:136191167-136191189 GTGCCCACCCAGACTGAGGTTGG + Intergenic
1033903158 7:146168119-146168141 GTGCCCACCCAGATTGAGGGTGG + Intronic
1034076925 7:148240954-148240976 GTGCCCACCCAGATTGAGGGTGG + Intronic
1034083057 7:148298509-148298531 GTGCCCACCCAGATTGAGGGTGG + Intronic
1034169441 7:149051441-149051463 GTGCCCACCCAGATTGAGGGTGG - Intergenic
1034170336 7:149058002-149058024 GTGCCCACCCAGATTGAGAGTGG - Intergenic
1034469690 7:151248647-151248669 GAGCCCAGCAGGACTCAGAGGGG - Exonic
1034728403 7:153361957-153361979 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1035061106 7:156070325-156070347 GTGCCCACCTACACTGAGGGTGG + Intergenic
1035072664 7:156156793-156156815 GAGCCCACCTGGGAGGAGAGAGG - Intergenic
1035241046 7:157529378-157529400 GAGCCCACTTGGGCTGTGAGAGG + Intergenic
1035299070 7:157885407-157885429 ATGCCCACCTGGGCAGAGAAAGG + Intronic
1035360351 7:158309253-158309275 GTGCCCACCCAGACTGAGGGTGG - Intronic
1035369333 7:158368998-158369020 GTGCCCACCCAGACTGAGGGTGG - Intronic
1035451399 7:158979388-158979410 GTAAGCACCTGGACGGAGAGAGG - Intergenic
1035524344 8:300679-300701 GGTCCCACCTGACCTGAGAGTGG + Intergenic
1035673284 8:1436441-1436463 GTGCCCACCCAGACTGAGGGTGG + Intergenic
1035777162 8:2196842-2196864 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1035911571 8:3572210-3572232 AGCCCCACTTGGACTGAGAGGGG - Intronic
1036753658 8:11458345-11458367 GTGCACTGCTGCACTGAGAGTGG - Intronic
1037177765 8:15967046-15967068 GTGCCCACCCAGACTGAGTGTGG - Intergenic
1037391102 8:18392552-18392574 GTGCCCACCCGGATTGAGGGTGG + Intronic
1037485051 8:19339259-19339281 GTGCCCACCCAGATTGAGGGTGG + Intronic
1037669105 8:20999045-20999067 GTGCCCACCCAGATTGAGGGTGG - Intergenic
1039240208 8:35548084-35548106 GTACCCACCTGGATTGAGGGTGG + Intronic
1039414053 8:37378702-37378724 GTGCCCACCCACACTGAGAGTGG + Intergenic
1039419729 8:37426185-37426207 GTGCCCACCCAGATTGAGGGTGG - Intergenic
1039778218 8:40757844-40757866 GTGCCCACCCAGACTGAGGGTGG - Intronic
1040614521 8:49020877-49020899 GTGCCCACCCAGATTAAGAGGGG + Intergenic
1040780463 8:51101677-51101699 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1041401626 8:57451296-57451318 GTGCCCACCTGGCAGGAGACAGG - Intergenic
1042841059 8:73124319-73124341 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1043273380 8:78362313-78362335 GTACCCACCAAGATTGAGAGTGG + Intergenic
1043325204 8:79041925-79041947 ATGCCCACCTGCATTGAGGGTGG - Intergenic
1043690974 8:83151124-83151146 GTGCCCACCCAGATTAAGAGTGG - Intergenic
1043742263 8:83828746-83828768 GTGCCCACCCAGAATGAGGGTGG + Intergenic
1043992333 8:86770897-86770919 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1044286520 8:90416739-90416761 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1044344664 8:91091489-91091511 GTGCCCACCCAGATTGAGGGTGG - Intergenic
1044895762 8:96889855-96889877 GTGCCCACCCAGATTGAGGGTGG + Intronic
1045405185 8:101859077-101859099 GTGCCCACCCAGATTGAGGGTGG - Intronic
1045588398 8:103564740-103564762 GTGCCCACCCAGATTGAGGGTGG + Intronic
1045711809 8:104993428-104993450 GTGCCCACCCAGACTGAAGGTGG + Intronic
1045932760 8:107646446-107646468 GTGCCCACCCGGACTGAGGATGG + Intergenic
1046400274 8:113696453-113696475 CTGTCCACCTGGATTGAGGGTGG - Intergenic
1046518138 8:115289570-115289592 GTGCCCACCCAGATTGACAGTGG + Intergenic
1046675317 8:117101664-117101686 GTGCCCACCTAGATTGAGGGTGG - Intronic
1047159906 8:122366483-122366505 GTGCCCACCTTCATTGAGGGTGG - Intergenic
1047196432 8:122726096-122726118 GTGCCCACCCAGATTGAGGGTGG - Intergenic
1047325399 8:123830962-123830984 GTGCCCACCCAGATTGAGGGTGG - Intergenic
1047550937 8:125871582-125871604 GTGCCCACCCAGACTGAGATTGG + Intergenic
1048024511 8:130573277-130573299 GTGCCCACCTAGATTAAGGGTGG - Intergenic
1048193198 8:132309029-132309051 GTGCCCACCCAGATTGAGGGTGG - Intronic
1048217323 8:132508273-132508295 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1048521505 8:135159716-135159738 GTGCCCACCTGGATTGAGGGTGG - Intergenic
1048584794 8:135765031-135765053 GTGCCCACCCAGATTGAGGGTGG - Intergenic
1048634827 8:136284547-136284569 GTGCCCACTCAGACTGAGAGTGG + Intergenic
1048869233 8:138783545-138783567 GTGCCCACCTAGATTAAGGGTGG + Intronic
1048923175 8:139248694-139248716 GTGGCCAACAGGAATGAGAGGGG + Intergenic
1049576271 8:143391340-143391362 CTGCCCACCTGAGCTGAGATGGG + Intergenic
1050134744 9:2450060-2450082 GTGCCCACCGGGAGTAAGGGTGG - Intergenic
1050191402 9:3030221-3030243 GTGCCCACCCAGAATGAGGGTGG + Intergenic
1050636284 9:7616411-7616433 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1050895149 9:10877406-10877428 GTGCCCACCCAGACTGAGGGTGG + Intergenic
1051004436 9:12325751-12325773 GTGCCCACCCAGATTGAGGGCGG + Intergenic
1051008529 9:12380901-12380923 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1051036762 9:12756520-12756542 GTGCCCATCCAGACTGAGGGTGG - Intergenic
1051547461 9:18292542-18292564 GTGCCCACCCAGGCTGAGGGAGG - Intergenic
1051551671 9:18337116-18337138 GTGCCCACCCAGATTGAGGGTGG - Intergenic
1051841885 9:21407091-21407113 GTGCCCACAGTGACTGAGTGTGG + Intergenic
1052411627 9:28128899-28128921 GTGCCCACGCAGACTGAGGGTGG - Intronic
1053582811 9:39424762-39424784 GTGCCCACCCAGATTGAGGGTGG - Intergenic
1053846997 9:42249627-42249649 GTGCCCACCCAGATTGAGGGTGG - Intergenic
1054104390 9:60983505-60983527 GTGCCCACCCAGATTGAGGGTGG - Intergenic
1055461614 9:76524973-76524995 GTGCCCACCCAGACTGAGGGTGG + Intergenic
1055515407 9:77028423-77028445 GTGCCCACCCACACTGAGGGTGG + Intergenic
1055533944 9:77216965-77216987 GTGCCCACCCAGATTGAGGGTGG + Intronic
1056079164 9:83072770-83072792 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1057260784 9:93582069-93582091 GTTCCCACGTCGACTGCGAGGGG + Intronic
1057854475 9:98591996-98592018 GTGCCCCCCTTGCTTGAGAGAGG - Intronic
1058090823 9:100803644-100803666 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1058230011 9:102413855-102413877 GTGCCCACCTGGATTGAGGGTGG + Intergenic
1058386691 9:104444715-104444737 GTACCCACCCAGACTGAGGGTGG - Intergenic
1058893833 9:109383349-109383371 GTGACCACCTGGGATGACAGTGG + Intronic
1058926211 9:109666577-109666599 CAGCCCACCAGAACTGAGAGTGG - Intronic
1059014182 9:110496299-110496321 GTGCCCACCCAGACTGAGGGTGG - Intronic
1059040587 9:110811442-110811464 TTCTCCACCTGGACTGAGTGTGG + Intergenic
1059550874 9:115227660-115227682 GTGCCCACCCAGATTGAGGGTGG + Intronic
1059868017 9:118538315-118538337 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1059880956 9:118688256-118688278 GTGCCCACCCAGAATGAGGGTGG - Intergenic
1059971004 9:119667968-119667990 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1060144321 9:121238280-121238302 GTGCCCACCCAGATTGAGGGTGG - Intronic
1060549146 9:124476984-124477006 GCGCCCCCCTGGGCAGAGAGAGG - Intronic
1061033922 9:128102999-128103021 CTGCACACCAGGACTCAGAGAGG - Intronic
1061918495 9:133769547-133769569 GTGCCCACCGTGACTGTGCGTGG - Intronic
1061982051 9:134111271-134111293 GTGCCCACCCAGATTGAGGGTGG - Intergenic
1062075231 9:134584970-134584992 GTGCCCACCTGGGCTGTATGGGG - Intergenic
1062082450 9:134631369-134631391 CTGTCCACCTGGATTGAGGGTGG - Intergenic
1062168769 9:135122609-135122631 GTGGCCACCCCGACTGGGAGAGG - Intergenic
1062172721 9:135144449-135144471 GTGCCCACATGGAGTGGAAGGGG - Intergenic
1062696734 9:137879529-137879551 GTGCCCTGCTGGGCTGAGATGGG + Intronic
1203768305 EBV:37917-37939 GTGCGAACATGGACTGGGAGTGG - Intergenic
1203785357 EBV:124562-124584 GATCCCACCTTCACTGAGAGGGG - Intergenic
1185652194 X:1656061-1656083 GTGCCCACCCAGATTGAGGGGGG - Intergenic
1185823950 X:3231049-3231071 GTGCCCACCCACACTGAGGGTGG + Intergenic
1185826612 X:3257232-3257254 GTGCCCACTTAGACTGAGGGTGG + Intergenic
1186006589 X:5078814-5078836 GTGCCCACGAAGACTGAGTGTGG + Intergenic
1186032458 X:5384643-5384665 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1186053182 X:5622087-5622109 GTGCCCACCCAGATTGAGGGTGG - Intergenic
1186151251 X:6676879-6676901 GTGCCCACCCAGATTGAGGGTGG - Intergenic
1186217523 X:7315826-7315848 GTGCCCACCCAGATTGAGGGTGG + Intronic
1186304605 X:8242091-8242113 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1186334784 X:8574498-8574520 GTGCCCACCCAGATTGAGGGAGG - Intronic
1187575746 X:20552806-20552828 GTGCCCACCTAGACTGAGGGTGG + Intergenic
1187927623 X:24264365-24264387 GTGCCCACCCAGATTGAGGGCGG + Intergenic
1188012596 X:25073630-25073652 GTGCCCACTCAGACTGAGGGTGG + Intergenic
1188406096 X:29811491-29811513 GTGCCCACCGGTATTAAGAGTGG + Intronic
1189596711 X:42574144-42574166 GTGCCCACCCACACTGAGGGTGG - Intergenic
1190155306 X:47986719-47986741 GTACCCACCCAGACTGAGGGTGG - Intronic
1190322391 X:49186655-49186677 GTGGCCAACTGGACTGAGAGGGG + Intergenic
1190524670 X:51316837-51316859 GTGCCCACCCAGATTGAGGGTGG - Intergenic
1190545600 X:51523176-51523198 GTGCCCACCCAGATTGAGAGTGG + Intergenic
1190625952 X:52338804-52338826 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1190637630 X:52451933-52451955 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1190648020 X:52541091-52541113 GTGCCCACCCAGATTGAGGGTGG - Intergenic
1190679011 X:52808527-52808549 GTGCCCACACAGACTGAGGGTGG - Intergenic
1190959411 X:55230615-55230637 GTGCCCACCCAGATTGAGGGTGG + Intronic
1190970063 X:55340039-55340061 GTGCCCACCCAGATTGAGGGTGG - Intergenic
1191226746 X:58052119-58052141 GTGCCCACCCAGATTGAGGGTGG - Intergenic
1191718936 X:64213240-64213262 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1191719713 X:64219365-64219387 GTGCCCACCCAGACTGTGTGAGG + Intergenic
1191780363 X:64857801-64857823 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1191878029 X:65816085-65816107 GTGCCCACCTAGATTGAGGGTGG + Intergenic
1192661279 X:73045304-73045326 GTGTCCACCCAGATTGAGAGTGG + Intergenic
1192995793 X:76511982-76512004 GTGCCCACCCAGATTGAGGGTGG - Intergenic
1193121060 X:77823436-77823458 GTGCCCACCCAGATTGAGGGTGG - Intergenic
1193276376 X:79593175-79593197 GTGTCCACCCGGATTGAGGGTGG - Intergenic
1193391564 X:80935373-80935395 GTGCCCACCTGGATTGAGGGTGG - Intergenic
1193398391 X:81013102-81013124 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1193461736 X:81798233-81798255 GTGCCCACCCAGATTGAGGGTGG - Intergenic
1193472916 X:81928433-81928455 GTGCCCACCTAGATTGAGGGTGG + Intergenic
1193792921 X:85838224-85838246 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1193905053 X:87232072-87232094 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1193914508 X:87349468-87349490 GTGCCCACCCAGATTAAGAGTGG + Intergenic
1193915321 X:87355913-87355935 GTGCCCACCCAGATTGAAAGTGG + Intergenic
1193940651 X:87677587-87677609 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1194096125 X:89641095-89641117 GTGCCCACCCAGATTGAGGGTGG - Intergenic
1194137496 X:90164460-90164482 GTGCCCACCAAGACTAAGGGTGG - Intergenic
1194180129 X:90700665-90700687 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1194198517 X:90926546-90926568 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1194233162 X:91348834-91348856 GTCCCCACCTAGATTGAGGGTGG - Intergenic
1194278942 X:91923337-91923359 GTGCCCACCCAGATTGAGGGTGG - Intronic
1194433412 X:93839306-93839328 GTGCCCACCTAGATTGAGGGTGG - Intergenic
1194676714 X:96803062-96803084 GTGCCCACCCAGATTGAGGGTGG + Intronic
1194885489 X:99310799-99310821 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1195198291 X:102520209-102520231 GTGCCCACCCAGATTGAGAGTGG + Intergenic
1195420537 X:104670412-104670434 GTGCCCACCCATACTGAGGGTGG + Intronic
1196230754 X:113218124-113218146 GTGCCCACCCAGATTGAGAGTGG + Intergenic
1196512280 X:116525728-116525750 GTGCCCACCCAGATTGAGAGTGG + Intergenic
1196529706 X:116771348-116771370 GTGCCCACCTAAATTGAGGGTGG - Intergenic
1196585603 X:117423798-117423820 GTGCCCACCAAGATTAAGAGTGG - Intergenic
1196852472 X:119950711-119950733 GAGCCCACCCTGACTGAGGGTGG + Intergenic
1196933914 X:120710201-120710223 GTGCCCACCTGGATGGAGGGTGG - Intergenic
1197013767 X:121598993-121599015 GTGCCCACCTGGATTGAGGGTGG + Intergenic
1197044017 X:121974673-121974695 GTGCCCACCCAGATTGAGGGTGG - Intergenic
1197044704 X:121980784-121980806 GTTCCCACCCAGACTGAGAGTGG - Intergenic
1197113696 X:122806215-122806237 GTGCCCACCCAGACTGAGGGTGG - Intergenic
1197388401 X:125828611-125828633 GTGCCCACCCAGATTGAGGGTGG - Intergenic
1197457006 X:126689377-126689399 GTGCCCACCCAGACTGAGGGTGG + Intergenic
1197481687 X:126994657-126994679 GTGCCCACCCAGACTGAGTGTGG - Intergenic
1197495297 X:127172399-127172421 GTGCCCATCCAGATTGAGAGTGG - Intergenic
1197554777 X:127939565-127939587 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1197607187 X:128597888-128597910 CTGGCCACCTTGACTGGGAGTGG + Intergenic
1198012457 X:132572251-132572273 GTGCCCACCCGGATTGAGGGTGG + Intergenic
1198546143 X:137694844-137694866 GTGCCCACCCAGATTGAGGGTGG - Intergenic
1199081114 X:143577753-143577775 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1199114131 X:143970079-143970101 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1199144153 X:144346472-144346494 GTGCCCACCTAGATTAAGGGTGG + Intergenic
1199275593 X:145938716-145938738 GTGCCCACCTGGATTCAGAGTGG - Intergenic
1199379690 X:147155659-147155681 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1199414194 X:147560681-147560703 GTGCCCACCCAGACTTAGGGTGG + Intergenic
1200449131 Y:3302476-3302498 GTGCCCACCCAGATTGAGGGTGG - Intergenic
1200483226 Y:3734396-3734418 GTGCCCACCAAGACTAAGGGTGG - Intergenic
1200526786 Y:4282833-4282855 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1200543223 Y:4486282-4486304 GTGCCCACCCAGATTGAGGGTGG - Intergenic
1200596420 Y:5146838-5146860 GTGCCCACCCAGATTGAGGGTGG - Intronic
1201252353 Y:12072183-12072205 GTGCCCACCTAGATTGAGGTTGG - Intergenic
1201301011 Y:12504823-12504845 GTGCCCACCCAGATTGAGGGTGG - Intergenic
1201416157 Y:13751424-13751446 GCTCACACCTGGACGGAGAGGGG + Intergenic
1201428714 Y:13883747-13883769 GTGCCCACCCAGATTGAGGGAGG + Intergenic
1201900855 Y:19045215-19045237 GTGCACACCTTGATGGAGAGGGG - Intergenic