ID: 990922889

View in Genome Browser
Species Human (GRCh38)
Location 5:60987205-60987227
Sequence CATTCTCCCAAGACTGAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 11096
Summary {0: 2, 1: 13, 2: 205, 3: 4199, 4: 6677}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990922886_990922889 9 Left 990922886 5:60987173-60987195 CCAGAAGAAATGGCTAAATTCCT 0: 2
1: 143
2: 160
3: 232
4: 553
Right 990922889 5:60987205-60987227 CATTCTCCCAAGACTGAGCCAGG 0: 2
1: 13
2: 205
3: 4199
4: 6677

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990922889 Original CRISPR CATTCTCCCAAGACTGAGCC AGG Intronic
Too many off-targets to display for this crispr