ID: 990924838

View in Genome Browser
Species Human (GRCh38)
Location 5:61008830-61008852
Sequence AATATTGACTAGGGCCTTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 111}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990924835_990924838 12 Left 990924835 5:61008795-61008817 CCATAGAGGCAGATCATTTTAAG 0: 1
1: 0
2: 0
3: 14
4: 165
Right 990924838 5:61008830-61008852 AATATTGACTAGGGCCTTGAAGG 0: 1
1: 0
2: 0
3: 9
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990924838 Original CRISPR AATATTGACTAGGGCCTTGA AGG Intronic
905341814 1:37283380-37283402 CATATTGACCTGGGCCTTTAGGG + Intergenic
905985842 1:42281346-42281368 AACATGGACTAAAGCCTTGAGGG + Intronic
907660120 1:56384121-56384143 AATATTTAGTAGGGCCCTGCAGG - Intergenic
910678049 1:89834734-89834756 TACCTTGAATAGGGCCTTGAAGG + Intronic
915843841 1:159241018-159241040 AATATGCACAAGGGCCTAGAGGG - Intergenic
919833900 1:201560659-201560681 AACAGTGACTTGGGCATTGAAGG - Intergenic
924101089 1:240603429-240603451 GATATGGAGTTGGGCCTTGATGG - Intronic
1069027622 10:63560878-63560900 AATATTTTCTAGGGTTTTGAGGG - Intronic
1070973896 10:80589660-80589682 TATATAGACTAAGGGCTTGAAGG + Intronic
1081235539 11:40643330-40643352 ATTATTCATTAGGGCATTGATGG - Intronic
1083200978 11:61120907-61120929 TAGATTTACTAGGGCTTTGAAGG + Intronic
1085252850 11:75154986-75155008 AATAGCAACTAGGGCCTGGAGGG - Intronic
1085416860 11:76324311-76324333 AATATGGAAAAGGGCCTAGAGGG - Intergenic
1086772005 11:90777936-90777958 AATTTTGAATAGGGCCATTAGGG + Intergenic
1087990451 11:104741868-104741890 AATGTTGAGTAGTGACTTGATGG + Intergenic
1088976988 11:114824710-114824732 ACATTTGACTTGGGCCTTGAAGG + Intergenic
1089869577 11:121660298-121660320 AATTTTTCCTAGGGCTTTGATGG + Intergenic
1089885338 11:121816250-121816272 AAAATTGTCTAGGGCATTGCAGG - Intergenic
1090262184 11:125329728-125329750 AATATAGAATCGGGCATTGAGGG + Intronic
1093043618 12:14415163-14415185 GCTAGTGAGTAGGGCCTTGATGG + Intronic
1098714828 12:73816331-73816353 AATATTGACTAGTTCTTAGAGGG - Intergenic
1099422936 12:82485641-82485663 AATCTGGACTAGGGCTGTGAGGG - Intergenic
1105473473 13:20712085-20712107 AATATTGTCTAGGGGCTGGTGGG + Intronic
1112972269 13:105274398-105274420 AATATTTTCTAGTGCCATGATGG - Intergenic
1118556338 14:67026997-67027019 AATATTGAATCGGGTTTTGAAGG - Intronic
1118791567 14:69098078-69098100 GGTATTGTCTAGGGCCTTGCTGG - Intronic
1120103031 14:80466189-80466211 AATATTGGCTATGGCATTAAGGG + Intergenic
1125619673 15:41049077-41049099 AGAAGTGACTAGGGCCTTTAAGG + Intronic
1130342347 15:83010518-83010540 AAAATTGAGTAGAGCCTTGAAGG - Intronic
1134236302 16:12468785-12468807 AAAATTGAGGAGGGTCTTGAAGG + Intronic
1135899149 16:26440476-26440498 GATTTTCAATAGGGCCTTGAGGG - Intergenic
1136461082 16:30410530-30410552 ATTTTTGACTTGGGCCTTGAAGG + Intronic
1137604313 16:49776788-49776810 AAGAATGTCTAGGGCCCTGAGGG + Intronic
1141328248 16:83082810-83082832 AATATTGACTCTGTGCTTGAGGG - Intronic
1144026479 17:11280636-11280658 GATATTGACTATGACCTTTAAGG + Intronic
1146146509 17:30423061-30423083 AATATTGAACATGGCTTTGAGGG - Intronic
1153759344 18:8315565-8315587 AATATAAACTCGGGCCTTGGAGG - Intronic
1157637022 18:49168807-49168829 TATCTTGACTGTGGCCTTGAAGG + Intronic
1162696122 19:12477282-12477304 TAAATTGAACAGGGCCTTGAAGG - Intronic
1163831946 19:19551152-19551174 CATTTTGACTTGGGCTTTGAAGG + Intergenic
1165907867 19:39204567-39204589 AAAATTGACAAGGGGCTTGCTGG + Intergenic
1167755060 19:51407512-51407534 AATAGTGACTTGGGACTTGGAGG - Intergenic
925023417 2:589026-589048 AAGCTTGAGTGGGGCCTTGAAGG + Intergenic
925968085 2:9084723-9084745 AATATTCACCAGGGCCATGATGG + Intergenic
927115597 2:19898662-19898684 AAAATTGACTGGAGCCCTGAGGG - Intronic
928027725 2:27753532-27753554 ACTTTTGAGTAGGGTCTTGAAGG - Intergenic
928467748 2:31538609-31538631 CAGATTGTCTAGGGTCTTGAAGG - Intronic
929096076 2:38264326-38264348 AACAATGACAAAGGCCTTGAGGG - Intergenic
931090862 2:58884515-58884537 AATAATGACTGTGGCTTTGAGGG + Intergenic
931551242 2:63449522-63449544 AAGATTGACTGGGACCCTGAGGG + Intronic
931785780 2:65618275-65618297 AATAGTAACTATGGCCTTAAGGG - Intergenic
932055725 2:68441488-68441510 AATAATGACTTGGGCCTTTGTGG + Intergenic
933219688 2:79674261-79674283 GATATTGAGCTGGGCCTTGAGGG + Intronic
939027326 2:137029670-137029692 AATATTGACCAGCAACTTGAAGG - Intronic
940579815 2:155564270-155564292 CAAATTAAGTAGGGCCTTGAAGG + Intergenic
1170430331 20:16269884-16269906 AAAATTAACTAGGGGCTGGAAGG - Intergenic
1178811844 21:35891123-35891145 AATATTGCTTAGGGCTTTGAAGG + Intronic
1183429223 22:37755669-37755691 AAGCTGGACTGGGGCCTTGAGGG + Intronic
1184758626 22:46532306-46532328 AATATGGAATAGGCCCTTAAGGG - Intronic
953067055 3:39483043-39483065 AGTCTTGACTAGCACCTTGAAGG - Intronic
954899001 3:54003043-54003065 CCTATGGACTTGGGCCTTGAAGG + Intergenic
956776976 3:72573193-72573215 AATATTGACCAAAGGCTTGAAGG - Intergenic
958563982 3:95782982-95783004 AATATTGGCTGAGGCCTTTATGG - Intergenic
959444581 3:106422846-106422868 AATATTGAATTGTGCCTTAATGG - Intergenic
963408658 3:144902580-144902602 AATCTTAACTATGGCCTTAAAGG + Intergenic
963546901 3:146671477-146671499 AATGTTGACTAGGGTCTTTTTGG + Intergenic
963869823 3:150403512-150403534 ATTATTCACTAGGGGGTTGATGG + Intergenic
966708665 3:182947817-182947839 AAAAATGACCAGGGCCTTTAGGG + Intronic
967824550 3:193868048-193868070 AATTTTAAATGGGGCCTTGAAGG - Intergenic
968567589 4:1322373-1322395 AATATTCACTAGGTCCTTAGAGG - Exonic
972602913 4:40588380-40588402 AATAATGACAAGGACCTAGAAGG + Intronic
975645003 4:76537343-76537365 ATGATTGCCTAGGGCCTTGAAGG + Intronic
979625595 4:122841450-122841472 AATATTGTCTATGGCTTTTATGG + Intronic
981183727 4:141776545-141776567 GATATTGACAAGAGCCCTGAAGG - Intergenic
983349211 4:166566151-166566173 AATACTGACTAGGGTTTTAAAGG - Intergenic
983536520 4:168863047-168863069 AATAATGACTATCGCTTTGAAGG + Intronic
983684298 4:170389443-170389465 GAGATTGCCTAGGGCCTTGTGGG + Intergenic
989376479 5:40767908-40767930 ACTATTTACTATGGCCCTGATGG + Intronic
990028298 5:51223167-51223189 ATAATTGAGTTGGGCCTTGAAGG - Intergenic
990924838 5:61008830-61008852 AATATTGACTAGGGCCTTGAAGG + Intronic
995018078 5:107335278-107335300 GATATTACCTAGGGCCTTGAAGG - Intergenic
995123074 5:108555813-108555835 ATTCTTGACTATGGCCTTCAAGG - Intergenic
999188117 5:149727983-149728005 AACATTGGCTAGTGCCTTTAAGG + Intergenic
1004277022 6:14245811-14245833 AAAAATGACTATTGCCTTGAGGG + Intergenic
1006301625 6:33196465-33196487 AAGAGTGACCAGGGCGTTGAGGG - Exonic
1007930039 6:45682479-45682501 AATATTGAGTAGTTCCTTGAAGG + Intergenic
1008941413 6:57049810-57049832 GATTTTGACTAGGGCATTTATGG + Intronic
1010442582 6:75914618-75914640 AATATTGAAAGGGTCCTTGATGG + Intronic
1010806837 6:80246912-80246934 AACATTGTCTGGGCCCTTGAAGG - Intronic
1012972227 6:105743643-105743665 AATAATGACAAGGGGCTTGCTGG - Intergenic
1014229802 6:118890705-118890727 AATATAGACTAGAGATTTGATGG - Intronic
1015093201 6:129384357-129384379 AGCATTGACTAGGGCCTTTGGGG - Intronic
1016547576 6:145241547-145241569 AATATTAACTAAGTCGTTGATGG + Intergenic
1022625441 7:32031680-32031702 AAATTAGACTAGGGCCTTGATGG + Intronic
1023613680 7:41996755-41996777 AATATTGAAGAGAGCCTTTAAGG - Intronic
1024615907 7:51111614-51111636 AGTATTGAGATGGGCCTTGAAGG - Intronic
1026568760 7:71511390-71511412 AAAATTGCCTAGGGCCACGAGGG - Intronic
1028482529 7:91323287-91323309 AATATTTACTAGGGCCTACTGGG + Intergenic
1028703984 7:93816367-93816389 AGTATTGATTATGGCCGTGAAGG + Intronic
1030544288 7:110872968-110872990 AACATTGAATAGTGCTTTGAAGG - Intronic
1030912209 7:115264246-115264268 AATAATGGCTAGGGTTTTGAAGG - Intergenic
1033012841 7:137640645-137640667 AATACTGACTTGGGCCTTTCAGG - Intronic
1033200393 7:139363164-139363186 AATTTTGCCTAGGGCCCTGGTGG + Intronic
1033997524 7:147369559-147369581 AATATTTATTAGGCCCTTTATGG - Intronic
1034381779 7:150702193-150702215 AATATTCATTAGGCCCCTGAGGG + Intergenic
1038698949 8:29831549-29831571 AAAATGGAGTAGGACCTTGAGGG + Intergenic
1041159231 8:55020790-55020812 AATATTGATTAGTGTTTTGATGG - Intergenic
1041257180 8:55989368-55989390 TATATTACCTAGGGCCTTGGTGG + Intronic
1041395765 8:57389650-57389672 AATATTCACCAGGGCCATGATGG - Intergenic
1043289482 8:78579372-78579394 AACATTGACTAAGGCCATGTAGG - Intronic
1046360305 8:113144989-113145011 AATATTTAATAGAGCCCTGAGGG + Intronic
1048250037 8:132857751-132857773 AATATAAAATAGGGCTTTGAAGG + Intergenic
1052874841 9:33550068-33550090 CATGTTACCTAGGGCCTTGAAGG + Intronic
1053473934 9:38368099-38368121 CATTTTGAATAGGGTCTTGAAGG - Intergenic
1053501184 9:38594244-38594266 CATGTTACCTAGGGCCTTGAAGG - Intergenic
1056077469 9:83056115-83056137 CATATAGACTAAGGCCTTAAGGG + Intronic
1057680578 9:97178757-97178779 CATGTTACCTAGGGCCTTGAAGG - Intergenic
1060005569 9:119996737-119996759 ACTTTTGAGTTGGGCCTTGAGGG + Intergenic
1186565399 X:10656813-10656835 AATATTGACAAGGCTCTTGCAGG + Intronic
1198568552 X:137931517-137931539 ATTATTGACTATGGCCTCCAGGG + Intergenic
1199850391 X:151721741-151721763 AAGAGGGCCTAGGGCCTTGAGGG - Intronic