ID: 990928480

View in Genome Browser
Species Human (GRCh38)
Location 5:61057486-61057508
Sequence ATGTATTCACAGATGGACTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 195
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 176}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990928475_990928480 17 Left 990928475 5:61057446-61057468 CCCATTGGCAAGATCTTGATTTT 0: 1
1: 0
2: 0
3: 18
4: 245
Right 990928480 5:61057486-61057508 ATGTATTCACAGATGGACTGGGG 0: 1
1: 0
2: 2
3: 16
4: 176
990928476_990928480 16 Left 990928476 5:61057447-61057469 CCATTGGCAAGATCTTGATTTTG 0: 1
1: 0
2: 2
3: 27
4: 277
Right 990928480 5:61057486-61057508 ATGTATTCACAGATGGACTGGGG 0: 1
1: 0
2: 2
3: 16
4: 176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990928480 Original CRISPR ATGTATTCACAGATGGACTG GGG Intronic
903199048 1:21718170-21718192 ATGTACACACAGATGCAGTGAGG - Intronic
903341681 1:22658819-22658841 ATGGATGGACAGATGGACAGAGG + Intronic
903680291 1:25091978-25092000 ATGTGTTGACACCTGGACTGGGG - Intergenic
908157820 1:61374260-61374282 ACGCATTCACAGAAGGACTGAGG - Intronic
911522318 1:98943573-98943595 ATTTATGCACTCATGGACTGAGG - Intronic
912969732 1:114269594-114269616 TTACATTCCCAGATGGACTGGGG + Intergenic
913061001 1:115207760-115207782 ATGTATGCACAAATACACTGTGG + Intergenic
916243270 1:162660826-162660848 ATGTATTTACATATTGTCTGTGG + Intronic
916262043 1:162851724-162851746 ATTCATTCAGAGATGTACTGGGG - Intronic
919022789 1:192129779-192129801 ATGAATTCAGAGGTGGACTTAGG - Intergenic
919119482 1:193321381-193321403 AGGCATTCATAGCTGGACTGTGG + Intergenic
920515895 1:206584468-206584490 ATGGCATCATAGATGGACTGGGG - Exonic
920854428 1:209651620-209651642 ATGTCTTCAATGATGGGCTGGGG + Intronic
921562674 1:216677192-216677214 ATGTATTCACACTTGGTCTGGGG + Exonic
1064485060 10:15778404-15778426 ATTTATTCACAGATGTATAGGGG - Exonic
1065735189 10:28745133-28745155 ATGTATTCACAGGTGGAATAGGG + Intergenic
1068498732 10:57817471-57817493 ATGTAACCACAGATGGTCTATGG + Intergenic
1071404643 10:85318333-85318355 ATGTATTCACAGGCTGAATGGGG + Intergenic
1071966196 10:90855651-90855673 ATGTATTTACAGTCTGACTGTGG - Intronic
1072557993 10:96539711-96539733 GTGTTTTTACAGATGTACTGAGG - Intronic
1075081295 10:119385620-119385642 GTGTATTCTCTGATGGATTGGGG + Intronic
1076073690 10:127514542-127514564 ATGTGAACACAGATGGACTCTGG + Intergenic
1079083523 11:17429879-17429901 ATGGGTTCAAAGATGGAATGGGG - Intronic
1080188234 11:29518084-29518106 ATGTATACACACATCTACTGTGG - Intergenic
1080579709 11:33632233-33632255 CTGTATCCACAGGTGGACTCTGG + Intronic
1082965204 11:58959831-58959853 AAGGATACAAAGATGGACTGGGG + Intronic
1085877373 11:80425086-80425108 ATGAATTGAAAGATGGCCTGAGG - Intergenic
1086062715 11:82717025-82717047 ATGTTTTCACAGCTGCACAGTGG + Intergenic
1086895396 11:92306296-92306318 ATATATTCACAAATCTACTGTGG + Intergenic
1087106449 11:94413385-94413407 ATCAATTCCCAGCTGGACTGTGG + Intergenic
1090992947 11:131837385-131837407 GGGTATTCACTGATAGACTGTGG + Intronic
1092044283 12:5417911-5417933 ATTAATTGACAGATGGACAGAGG - Intergenic
1093013842 12:14136367-14136389 ATTTATTCAGAGTTGGAGTGTGG + Intergenic
1101334751 12:103786462-103786484 ATGTCTTCAGAGGTGGGCTGGGG + Intronic
1103855606 12:123967895-123967917 ATGCATTTAGAAATGGACTGGGG + Intronic
1104893823 12:132152434-132152456 ATTTATTCACAGGTGGGCTGGGG - Exonic
1106149076 13:27080438-27080460 AGATACTCAGAGATGGACTGTGG + Intronic
1107063650 13:36188433-36188455 AAGTATTTACAAAGGGACTGAGG - Intronic
1107502252 13:40992289-40992311 GTGTGTTCACAGATGCACTTAGG - Intronic
1108293939 13:48993141-48993163 ATGTATTCACATCTGGGATGAGG + Intronic
1109378187 13:61524733-61524755 ATGTGAGGACAGATGGACTGCGG - Intergenic
1111129790 13:83960679-83960701 ATGGATTCACAGAATGACTTTGG - Intergenic
1111854251 13:93616757-93616779 ATGTGTTCACAGATTGGTTGTGG - Intronic
1112718662 13:102216368-102216390 ATTTATTCACAGCAGGATTGAGG + Intronic
1112779191 13:102879479-102879501 ATGTATACACAGATGAATCGAGG - Intergenic
1114327909 14:21608026-21608048 GTGTATTCTCAGGTGGAATGTGG + Intergenic
1118616676 14:67578835-67578857 ATGTATCCACGGATGTACTGTGG + Intronic
1118824564 14:69368543-69368565 ATGAAGTTACAGAAGGACTGTGG - Intergenic
1119133958 14:72199890-72199912 ATTTATATACAGATGGTCTGTGG + Intronic
1119856109 14:77902233-77902255 GTGTATTGACACATTGACTGTGG + Intronic
1127387778 15:58481000-58481022 AAGCATCCACAGATTGACTGGGG + Intronic
1128355730 15:66925173-66925195 ATGAATTCACAGATGGAGCCTGG + Intergenic
1137000669 16:35227517-35227539 ATGGATTCACAGATGGATTCTGG + Intergenic
1137534615 16:49309611-49309633 ATATTTGCACAGATGCACTGGGG - Intergenic
1138552729 16:57756317-57756339 ATGAAGTCACAGATGGACCAAGG - Intronic
1139151996 16:64393488-64393510 ATTTATTCATATATGGACTTTGG - Intergenic
1141832781 16:86519008-86519030 ATGAAATGACAGATGGACAGAGG + Intergenic
1142435079 16:90051506-90051528 ATTTTTCCACAGATGGGCTGAGG - Intergenic
1149601647 17:57897204-57897226 ATGTATTCATTGCTGTACTGTGG - Intronic
1150054450 17:62000596-62000618 ATGTATGCACATATGTACTTTGG + Intronic
1152548745 17:81018579-81018601 ATTTGTTCACAGATGCTCTGTGG - Intergenic
1153633782 18:7096678-7096700 ATATATACACATATGGAATGGGG - Intronic
1154245850 18:12697162-12697184 ATATATTTACAAATGAACTGTGG + Intronic
1155106529 18:22671828-22671850 ATGAATTCTCAGATGAACTTTGG - Intergenic
1156632810 18:38990624-38990646 GTGGAATCAAAGATGGACTGAGG + Intergenic
1158940902 18:62405298-62405320 ATTTTTCCACAGATGGGCTGGGG + Intergenic
1160181656 18:76641999-76642021 TTTTATTCATAGATGGACTCAGG + Intergenic
1160563707 18:79774131-79774153 ATGCATTCACAGCAGGTCTGTGG + Intergenic
1160693009 19:468727-468749 ATGTGTGCACAGACGGTCTGTGG - Intronic
1164811175 19:31157392-31157414 ATTTATTCACATATTGTCTGTGG + Intergenic
1165279288 19:34782919-34782941 ATGTATGGGAAGATGGACTGAGG - Intergenic
1165833833 19:38743065-38743087 ATGTCTTCACAGATGAACTTCGG + Exonic
1166253593 19:41587111-41587133 ATGCATTCACAGAGGGACCCAGG - Intronic
1166257775 19:41618728-41618750 ATGCATTCACAGAGGGACCCAGG + Intronic
927361733 2:22243266-22243288 TCCTATTGACAGATGGACTGGGG + Intergenic
928345564 2:30491195-30491217 ATATATTTACAGATGTACTTGGG - Intronic
931134349 2:59379306-59379328 GTGTCTTTACAGATGAACTGAGG - Intergenic
931785672 2:65617379-65617401 ATCTATTCACAGATAGGCAGAGG - Intergenic
933483831 2:82893319-82893341 GTGTATTCAGAGCTGTACTGGGG - Intergenic
934681310 2:96285922-96285944 ATGTACTCAGCCATGGACTGAGG + Intronic
935064467 2:99636011-99636033 ATGGAATTACAGAAGGACTGTGG - Intronic
937659465 2:124413955-124413977 AAGTATTGAGAGATGGAGTGAGG + Intronic
938152312 2:128897956-128897978 ACATATCCACAGCTGGACTGAGG + Intergenic
943514963 2:188873899-188873921 ATGTATACATAGATGAAGTGGGG - Intergenic
1168877785 20:1183100-1183122 TTGTATACACTGATGGCCTGAGG + Intronic
1174048345 20:47749662-47749684 TTGTGTTCACAGATGGAAAGTGG + Intronic
1174405757 20:50302298-50302320 CTGTGTTCCCTGATGGACTGCGG - Intergenic
1174565824 20:51463843-51463865 ATGTACCCACAGATGCACTGAGG - Intronic
1175146087 20:56897511-56897533 ATGAAATCCCAGATGGACGGCGG + Intergenic
1177647761 21:23921505-23921527 ATGAGTTTACAGATTGACTGGGG - Intergenic
1178082945 21:29084107-29084129 ATGAATTCACAGATGGTTTGGGG + Intronic
1178796033 21:35745232-35745254 TTGTATTCACAGGTGTAGTGGGG - Intronic
1182919504 22:34066410-34066432 ATGTATTTACATATTGTCTGTGG - Intergenic
1185175428 22:49323859-49323881 ATGCACTCACAGCTGCACTGGGG - Intergenic
1185202511 22:49516891-49516913 TTGGATTCAGAAATGGACTGGGG - Intronic
949332401 3:2936904-2936926 ATTCATTCACAAATGGCCTGTGG + Intronic
950067297 3:10123259-10123281 CTGTTTTCACAGATGGAATGTGG + Intronic
952732093 3:36649373-36649395 CTGTAATAACAGATGGAATGAGG - Intergenic
954933506 3:54305379-54305401 ATGATTTCTCAAATGGACTGAGG - Intronic
956598469 3:70994078-70994100 GTGTACTCACAGAGGGACTGTGG + Intronic
958132570 3:89447541-89447563 ATTTAATCACAGATGCACTTGGG - Intronic
958451709 3:94281159-94281181 ATGTATTCACAAGTGGGCTGTGG + Intergenic
959607278 3:108255578-108255600 ATTTATTCACACTTTGACTGGGG - Intergenic
959956535 3:112244767-112244789 CTGTATCCACAGATGGAATTAGG + Intronic
962410100 3:135133413-135133435 ATGGATGGACAGATGGACAGAGG + Intronic
964728023 3:159835277-159835299 CTGTATGCTCAGATGGCCTGAGG - Intronic
964857851 3:161166275-161166297 ATCTATTCCCAGATGGGCCGTGG - Intronic
966918909 3:184599786-184599808 ATGGAATCACAGATGGCGTGTGG + Intronic
967550061 3:190782282-190782304 TTAAATTCACAGATGGAATGTGG - Intergenic
970662553 4:18302406-18302428 ATGTGTTCATGGATAGACTGAGG - Intergenic
970984323 4:22138357-22138379 ATGTTTTCTCAGACCGACTGTGG - Intergenic
972094027 4:35325841-35325863 ATGTATAAACAGATAGACTATGG + Intergenic
972094126 4:35327174-35327196 ATGTATAAACAGATAGACTATGG - Intergenic
973614562 4:52665619-52665641 AGGAATTCATTGATGGACTGGGG - Intergenic
974225669 4:59039620-59039642 ATGTGTTCACAGATGGAAAAAGG - Intergenic
974918885 4:68212118-68212140 ATGAATGCACAGATAGACTTTGG - Intergenic
975438256 4:74379470-74379492 ATGGAATCACAGTTGTACTGAGG - Exonic
976417901 4:84800683-84800705 ATTTTTTCACAGATGGATTGTGG + Intronic
976982220 4:91245064-91245086 ATGTATTTCCAAATGGCCTGTGG - Intronic
977435651 4:96990819-96990841 ATGACTTCAAAGGTGGACTGAGG + Intergenic
980602874 4:135047599-135047621 ATTTATTCACAGATGATGTGGGG - Intergenic
980784380 4:137533058-137533080 AAGTATTTACAGAGGGAGTGGGG - Intergenic
981628470 4:146789027-146789049 ATAAATTCACAGATGGAATATGG - Intronic
983061216 4:163163025-163163047 ATGCATTTACAGAAGTACTGTGG + Intronic
983255384 4:165394334-165394356 ATCTATTCACAGAAGCACTGTGG - Intronic
984652504 4:182285807-182285829 ATGTTTTCAGAGATGGACCAAGG + Intronic
987967881 5:24899640-24899662 AGGTATCCACAGATTCACTGGGG + Intergenic
988916630 5:35900892-35900914 ATGTATTCACAGATGGTGTGTGG - Intergenic
989149481 5:38284424-38284446 ATTTATTCACATATAGCCTGTGG - Intronic
989213193 5:38878145-38878167 ATGTGTCCACCGATGGCCTGGGG - Intronic
990928480 5:61057486-61057508 ATGTATTCACAGATGGACTGGGG + Intronic
991442253 5:66663202-66663224 ATGTATACACACATGCACTGAGG - Intronic
995066520 5:107869059-107869081 ATGCCTTCACAGATATACTGTGG - Intronic
996596687 5:125211206-125211228 ATGTATTCACATATGTGTTGGGG + Intergenic
1000976899 5:167774879-167774901 CTGTCTTAACAGATGCACTGGGG - Intronic
1000978855 5:167794892-167794914 TTCTTTTCACAGATGTACTGTGG + Intronic
1006874422 6:37282870-37282892 TTCTATTTACAGATGAACTGAGG + Exonic
1011642065 6:89425008-89425030 CTGTATTCACAACTAGACTGTGG + Intergenic
1011849350 6:91606241-91606263 ATGTATCCACAAATAGATTGGGG + Intergenic
1012008238 6:93744235-93744257 GTGTATTCAGAGAAGGGCTGGGG + Intergenic
1014445535 6:121523028-121523050 TCGTATCCACATATGGACTGAGG - Intergenic
1018058102 6:160069651-160069673 GTTTTGTCACAGATGGACTGGGG - Intronic
1018990874 6:168672772-168672794 ATGTGTTTTCAGATGGAGTGAGG + Intronic
1019612183 7:1942154-1942176 CTGTATTCACAGCTGTGCTGAGG - Intronic
1022429480 7:30302197-30302219 ATATATTCACATATAGAATGAGG - Intronic
1024007393 7:45236735-45236757 ATGTATGCAGAGATGGACTTTGG + Intergenic
1024167334 7:46747909-46747931 ATGTGTTCACACTTGGCCTGTGG + Intronic
1025224898 7:57149676-57149698 AGGCATTCACAGCTGGAGTGTGG - Intergenic
1025927241 7:65969994-65970016 CTGTTTTCACAGATGGTCTTTGG - Intronic
1026475313 7:70729892-70729914 ATGTATTTAGAGACGGACTCTGG + Intronic
1027943261 7:84712069-84712091 CTTTATTCACAGATGAAGTGTGG - Intergenic
1028981979 7:96977363-96977385 ATTTATTCACATATGGAAGGTGG + Intergenic
1034037383 7:147838659-147838681 AGGTAGTCTCAGATGGAATGAGG - Intronic
1034682484 7:152939740-152939762 ATGTAGTTAGAGATGGACCGGGG + Intergenic
1035538817 8:415602-415624 ATGTCTGCACAGCTGGACAGAGG + Intronic
1035615331 8:995870-995892 ATGGCTTCACAGGTGGGCTGGGG + Intergenic
1035834925 8:2739920-2739942 ATATATTCACAGATGTGTTGAGG - Intergenic
1038136989 8:24796969-24796991 ATGTTTGCAGAGATGGAGTGTGG - Intergenic
1038627506 8:29208443-29208465 ATGGATTCACAGACCCACTGAGG - Intronic
1039170273 8:34737488-34737510 ATGTTTGCAAAGATGGATTGAGG - Intergenic
1040905154 8:52461438-52461460 ATGTTTTCTCTGATGGACTCCGG - Intergenic
1041810983 8:61910162-61910184 ATGTATTCAGAGAAGGACACAGG + Intergenic
1043830728 8:84985578-84985600 ATGTAATCACAAATGTAATGAGG + Intergenic
1046929604 8:119828926-119828948 ATTTATTTACATATTGACTGTGG - Intronic
1047942152 8:129836583-129836605 AAATATTCTCAGATTGACTGCGG + Intergenic
1048214655 8:132482804-132482826 ATCTATTCACGGATGTACAGGGG - Intergenic
1049211046 8:141386547-141386569 GTGTGTTCACAGCTTGACTGAGG - Intergenic
1049350705 8:142163038-142163060 ATGGATTGACAGATGGATGGAGG + Intergenic
1049350736 8:142163213-142163235 ATGGATTGACAGATGGATGGAGG + Intergenic
1049350840 8:142163774-142163796 ATGGATTGACAGATGGATGGAGG + Intergenic
1050301102 9:4259715-4259737 CTCTATTCACAGATGGGGTGGGG + Intronic
1051517592 9:17947992-17948014 ATGTGGTCACTGATGCACTGTGG + Intergenic
1052252947 9:26421449-26421471 ATATATTCCTAGATGGACAGGGG - Intergenic
1052570592 9:30216401-30216423 ATGGAATCACAGAGGGAGTGGGG + Intergenic
1052835436 9:33246610-33246632 ATGTGTTCACAGATGGGCTGTGG - Exonic
1055064612 9:72105935-72105957 CTGAAATCAGAGATGGACTGAGG + Intergenic
1055906939 9:81305912-81305934 ATTTATTTACAGATAGTCTGTGG + Intergenic
1057524769 9:95788758-95788780 ATGTATTTCCAGCTGAACTGTGG - Intergenic
1058107654 9:100990995-100991017 ATGTATTTACATATTGTCTGTGG + Intergenic
1058875905 9:109244647-109244669 CTGTACTCACAAACGGACTGAGG + Intronic
1060601767 9:124882803-124882825 ATGTCAACACAGAGGGACTGTGG - Intronic
1061946479 9:133911140-133911162 ATGTATTCACGCGTGCACTGGGG + Intronic
1062450212 9:136612120-136612142 ATGGAATCACACACGGACTGTGG - Intergenic
1185583359 X:1227358-1227380 ATGGATGGACGGATGGACTGAGG + Intergenic
1185985402 X:4827119-4827141 ATGTATTCTCAGCTGGGTTGTGG + Intergenic
1190219072 X:48499355-48499377 ATGGATGGACAGATGGACAGTGG + Intergenic
1190394214 X:49963423-49963445 ATGTACACACATATGGATTGGGG - Intronic
1193324410 X:80162594-80162616 ATTTCTCCACAGATGGAGTGGGG - Intergenic
1194382720 X:93215500-93215522 GTGAATACACAGATGCACTGTGG + Intergenic
1195091615 X:101464876-101464898 TTGGAATCACAGATGGAGTGCGG + Intronic
1198591285 X:138185571-138185593 ATTTATTGTCAGATGGGCTGTGG - Intergenic
1199426442 X:147706711-147706733 ATTTATTGGCAGATAGACTGTGG - Intergenic
1199491419 X:148404454-148404476 ATGTATTTATGGATGGAATGAGG + Intergenic
1201767480 Y:17585844-17585866 ATGTGAACACAGATGGGCTGGGG - Intergenic
1201834073 Y:18320141-18320163 ATGTGAACACAGATGGGCTGGGG + Intergenic