ID: 990929324

View in Genome Browser
Species Human (GRCh38)
Location 5:61070110-61070132
Sequence ATTTAATCCAATATATGTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 262
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 240}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990929324 Original CRISPR ATTTAATCCAATATATGTGT AGG (reversed) Intronic
901949950 1:12735972-12735994 CTTTAATCCAATATATGGATTGG - Intergenic
902691665 1:18113619-18113641 ATGTCATGCAATTTATGTGTTGG - Intronic
907662976 1:56410548-56410570 ATTTAAATATATATATGTGTGGG + Intergenic
909151897 1:72017025-72017047 ATTTGATAAAATATATGTATTGG + Intronic
909500131 1:76325267-76325289 ATTTAATACAATAAATATTTTGG + Intronic
910476866 1:87616726-87616748 ATTAAATCTAATATTTTTGTGGG + Intergenic
911488250 1:98529083-98529105 ATTTAATTCTATTTATATGTTGG - Intergenic
911777720 1:101836015-101836037 ATTCAATGCCATAAATGTGTGGG + Intronic
917625581 1:176842731-176842753 ATTTAATAGAATATAAGTGAGGG - Exonic
917887570 1:179401592-179401614 ATTTAAGACAATATTTGGGTGGG - Intronic
918719268 1:187831667-187831689 ATTTAGTACAAAATATGTGCTGG - Intergenic
919545716 1:198915608-198915630 ACTTATTACCATATATGTGTAGG + Intergenic
920590549 1:207214670-207214692 ATATATTCCAATAAATGTATTGG + Intergenic
920762064 1:208793964-208793986 AATTAATGCAAAATATGTGAAGG - Intergenic
1064515299 10:16141264-16141286 TTTTCATTCATTATATGTGTAGG - Intergenic
1068504609 10:57884202-57884224 AATTAATGCACTAGATGTGTTGG - Intergenic
1071303234 10:84273597-84273619 ATATAATCCAATTTATATTTTGG + Intergenic
1075285120 10:121177316-121177338 ATTTACTTCAAAATATGAGTAGG - Intergenic
1076009743 10:126978103-126978125 ATTTAAAAAAATATATGGGTAGG + Intronic
1078909417 11:15717242-15717264 CTTTACTCCAATATATGGATGGG + Intergenic
1080530400 11:33169714-33169736 ATTTGATGCCATCTATGTGTTGG + Intergenic
1080865130 11:36187399-36187421 ACATAACCCTATATATGTGTAGG - Intronic
1082111413 11:48279851-48279873 ATTTAATCCTCTTTATGGGTGGG + Intergenic
1086025649 11:82287458-82287480 ATGTAATGCAATATATTTGTAGG + Intergenic
1086809521 11:91290375-91290397 ATTCAATCCATCATTTGTGTTGG - Intergenic
1089408514 11:118219153-118219175 ATTTTTTTCCATATATGTGTTGG - Intronic
1090562396 11:127946569-127946591 AATTCAACCAATAAATGTGTTGG + Intergenic
1090723709 11:129501738-129501760 GTTAAATGTAATATATGTGTAGG + Intergenic
1092289745 12:7152621-7152643 ACTTATTTCAATATATGTGATGG + Intronic
1093251414 12:16808636-16808658 ATTTTCTCCAATTTATATGTAGG + Intergenic
1093307154 12:17535195-17535217 ATTTAATCCTACATATTTTTTGG + Intergenic
1093799856 12:23360399-23360421 TTTTAATACAATGTTTGTGTTGG + Intergenic
1095686200 12:45037268-45037290 GTTTAATACAATATAACTGTAGG + Intronic
1099075751 12:78105800-78105822 ATTTCATCAAATATATATTTTGG - Intronic
1099546737 12:83991686-83991708 ATTTAATCCTATAAATATATAGG - Intergenic
1103143413 12:118572214-118572236 ATTTAAGTCAATACATGTGTAGG - Intergenic
1107634148 13:42374985-42375007 AATTAATCCAATCTATGGGATGG - Intergenic
1107743616 13:43481353-43481375 ATTTGATCCCATATATATATGGG - Intronic
1108783099 13:53860737-53860759 ATTTCAGCCAATATATATTTTGG - Intergenic
1109092478 13:58066062-58066084 ATTAAATCCAATAAATTTGTGGG + Intergenic
1109523780 13:63547194-63547216 ATATACTCCAATGTATGTATAGG + Intergenic
1110448473 13:75615520-75615542 ATTTTGTCTAATATAAGTGTAGG + Intergenic
1110854396 13:80279942-80279964 TTTGAATCCAAGATATGTGCTGG - Intergenic
1111054730 13:82934098-82934120 ATTTTATCCTATAACTGTGTGGG - Intergenic
1113003183 13:105667277-105667299 AATTAAACAAATAGATGTGTTGG + Intergenic
1114847402 14:26339742-26339764 ATATAATCCATCATATTTGTAGG + Intergenic
1115610115 14:35040805-35040827 ATTTAATACAATATAATTTTTGG + Intergenic
1116042804 14:39706280-39706302 ATTTAATCCATTTTATATATGGG - Intergenic
1116300646 14:43177484-43177506 ATTTAATGGAATACATGTGTGGG + Intergenic
1116455309 14:45113991-45114013 ATTTAGTCCATTATAAGTATAGG + Intronic
1116737532 14:48711599-48711621 ATTTAATTCTACATATGAGTGGG - Intergenic
1118097653 14:62556555-62556577 ATTTATACTAATAAATGTGTTGG + Intergenic
1118106676 14:62667784-62667806 ATTTAATTCACTAAATGCGTTGG - Intergenic
1118233980 14:63983633-63983655 ATATATTCAAATATATGTTTAGG - Intronic
1118269155 14:64326089-64326111 ACATGATCCAATTTATGTGTTGG - Intronic
1119059040 14:71455605-71455627 ATTTAATTTAATTTATATGTGGG + Intronic
1121804143 14:96799988-96800010 GAATAATCCAATAAATGTGTAGG + Intronic
1124155642 15:27223139-27223161 TTTTAATCCAATATTAATGTGGG + Intronic
1126344530 15:47678717-47678739 ATTTAGTCCTTTCTATGTGTTGG + Intronic
1126822520 15:52518950-52518972 TTTTATTCCATTATAGGTGTGGG + Intronic
1127562582 15:60154284-60154306 ATTTATTCAAATATATCTGGAGG - Intergenic
1129574824 15:76732189-76732211 TTTAAATCTAAAATATGTGTGGG + Intronic
1129629199 15:77238924-77238946 CTATAATCTAAAATATGTGTAGG - Intronic
1129911528 15:79231608-79231630 ATTTAATACAATATAATTTTAGG + Intergenic
1129972724 15:79794210-79794232 ATATAGGCCAATATATTTGTAGG - Intergenic
1131695534 15:94873737-94873759 ATTTAATTGAATATAGATGTTGG - Intergenic
1134596649 16:15501079-15501101 ATTTAATCCAATAGATCTAAAGG - Intronic
1138264924 16:55653710-55653732 ATTAAATCACATTTATGTGTTGG + Intergenic
1139002085 16:62524322-62524344 ATTTAATCCATTAAATTTATTGG - Intergenic
1140293291 16:73684562-73684584 ATGTAACCCAACATATTTGTGGG - Intergenic
1140601603 16:76482575-76482597 ATTTCTGCCAAAATATGTGTTGG - Intronic
1144363492 17:14519472-14519494 ATTTAGTCCAACATATGTTTGGG - Intergenic
1145404422 17:22572677-22572699 AGTTCATGCAATAAATGTGTAGG + Intergenic
1146340526 17:32015615-32015637 AATTAATACAATAAATGTATGGG + Intronic
1150368331 17:64611814-64611836 ATTGAAGCCAATATAAGTTTGGG - Intronic
1151203456 17:72487214-72487236 ATTAAATGCTATATTTGTGTAGG - Intergenic
1155857752 18:30854913-30854935 ATTGCATTAAATATATGTGTAGG + Intergenic
1155865344 18:30957853-30957875 TTTTAATCCACTAAATCTGTGGG + Intergenic
1157072748 18:44428679-44428701 ATTTAAACCAATTTCTGTGAAGG + Intergenic
1157698108 18:49740200-49740222 TTTTACTACAGTATATGTGTGGG + Intergenic
1158219329 18:55134034-55134056 ATATAAGACAATATATTTGTAGG + Intergenic
1159401335 18:67939561-67939583 ATTTTCTCCAATATGTGTATAGG - Intergenic
1159425255 18:68276459-68276481 ATGTAATCCATTATATTTGCAGG + Intergenic
1159722798 18:71914052-71914074 ATTTGATCCAATATTTGAGTGGG + Intergenic
1159853149 18:73550871-73550893 ATTTAAGATAATATATGTGGAGG - Intergenic
1163165722 19:15496427-15496449 ATTTAGTCCAAAATATGAATTGG - Intronic
926475674 2:13319054-13319076 ATTTGATCCAAATTATGTATCGG - Intergenic
928172789 2:29014152-29014174 CTTTATTCCAAGATAGGTGTGGG - Intronic
928349641 2:30537692-30537714 TTTAAATCCAGTATATGTCTTGG - Intronic
928835579 2:35540773-35540795 ATTGAATCCAAGATAAATGTTGG + Intergenic
929370485 2:41218187-41218209 CTTTAAAACAATAAATGTGTTGG - Intergenic
930304422 2:49660114-49660136 ATTTGATCCAATAGATGTTTAGG - Intergenic
930468435 2:51782646-51782668 ATTCAAACCAATTTATGTGCAGG + Intergenic
932012371 2:67991432-67991454 GTTTAATACAGTAAATGTGTGGG - Intergenic
933046487 2:77544119-77544141 ATTTTTTCCAATAAATGGGTTGG - Intronic
933569491 2:83992794-83992816 ATTTAATCAACTATATTTGGAGG - Intergenic
935031932 2:99331208-99331230 ATTTAAGGTAATATATGTTTAGG - Intronic
936341487 2:111637393-111637415 ATTCAATCCAGTATCTATGTGGG + Intergenic
938601738 2:132849464-132849486 ATTTAATACAGTATATTTTTGGG + Intronic
938634232 2:133205424-133205446 ATATATTCCTATATATGTGTGGG + Intronic
940145404 2:150540623-150540645 ATTATATGGAATATATGTGTAGG - Intergenic
940421225 2:153481028-153481050 ATTTAATCAAATCTTTGGGTGGG + Intergenic
943038614 2:182776288-182776310 ATTGAAACCCATATTTGTGTTGG + Intronic
943216969 2:185049864-185049886 ATTTAATCATACATTTGTGTGGG - Intergenic
943238398 2:185352650-185352672 AAATAATCCAGTATATGTGTGGG - Intergenic
943874058 2:193039603-193039625 ATTTAATCTAATTAATATGTAGG + Intergenic
943895572 2:193354327-193354349 ATTTAAGCAAATATTTATGTAGG + Intergenic
945142910 2:206706080-206706102 ATTCACTCCAAAATATGTATTGG + Intronic
945800520 2:214423515-214423537 ATTGAATCCAACATATTTATTGG - Intronic
947163617 2:227239636-227239658 ATTTAATCTGTTATTTGTGTAGG - Intronic
1169243089 20:4001533-4001555 ATTTCATCCAATATGTGTTTTGG - Intronic
1170223913 20:13969962-13969984 ATAAAATTCAATATATGAGTGGG - Intronic
1174894941 20:54438436-54438458 CTTTAATCCAATATAAATGGTGG - Intergenic
1176049987 20:63113866-63113888 ATTTAATGCAATCAATGAGTTGG + Intergenic
1176975396 21:15315109-15315131 ATTTCTTCCAATAAATTTGTTGG - Intergenic
1177230431 21:18313460-18313482 ATTTAATTCTATATATTTATGGG - Intronic
1177627698 21:23685071-23685093 ATTAAATTCAATATATGCGATGG - Intergenic
1178051240 21:28750158-28750180 ATTTAACCTAATATATGCCTGGG - Intergenic
1178349735 21:31864183-31864205 ATGTAATCCAGTCTATGGGTAGG - Intergenic
1182181178 22:28350127-28350149 ATTTTATGTAAAATATGTGTAGG - Intronic
950051241 3:9991452-9991474 ATATAAACATATATATGTGTAGG - Intronic
954505301 3:51065435-51065457 AGTAAATCCATTATATGTGGAGG + Intronic
954716752 3:52530788-52530810 ATTTAATCCTGCATATGTGCAGG - Intronic
956794817 3:72708294-72708316 ATTTAATCCAACACATTTATTGG + Intergenic
957471519 3:80664379-80664401 ATATAATATAATATATATGTAGG + Intergenic
957771497 3:84698181-84698203 CTTTAATCCAAAATGTGTTTGGG + Intergenic
957828038 3:85475408-85475430 TTTTAATTCAATATTTTTGTAGG - Intronic
957831245 3:85523054-85523076 ATTTAATCTAGCAAATGTGTGGG - Intronic
960399745 3:117181661-117181683 TTTTCATCCAATCTATGTATTGG - Intergenic
961665391 3:128490819-128490841 ATTTACTCCAATTTATGGGCTGG + Intronic
962662117 3:137612914-137612936 ATTTACTTCATTATATGTGTTGG + Intergenic
964391769 3:156205313-156205335 ATTTAAGCCAAAATATTTTTTGG + Intronic
964687242 3:159410006-159410028 ATTTTCTCCAACATATGTTTTGG - Intronic
965730325 3:171764608-171764630 ATTTAATCCAATAAAACAGTTGG + Intronic
965885389 3:173439323-173439345 ATTTAATCCAATGGATGAATGGG + Intronic
966236616 3:177708682-177708704 GTTTAATCCAATCTGTGTTTCGG - Intergenic
967001921 3:185343990-185344012 ATTTGTTCCAATAAATGTGATGG + Intronic
967460172 3:189736981-189737003 ATTTATTCCTATATATTTGGAGG - Intronic
971653868 4:29316493-29316515 ATATAATACAATGTATTTGTGGG - Intergenic
971809704 4:31408832-31408854 ATTTAATCCTATCTATTTCTAGG - Intergenic
972050538 4:34727005-34727027 ATATAATCCAATAAATTGGTAGG - Intergenic
973098933 4:46237653-46237675 ATGTAATCTATTATGTGTGTAGG - Intergenic
977410823 4:96660244-96660266 ACTTAATCTAATAAATGTGCAGG + Intergenic
977824603 4:101516068-101516090 ATTTGAGCAAATACATGTGTAGG + Intronic
979116269 4:116828519-116828541 CTTTTGTCCAAAATATGTGTTGG - Intergenic
982980698 4:162131308-162131330 ATTTAATATAAAATATGTTTAGG - Intronic
983293451 4:165835676-165835698 ATTTATTTCAATATTTGTCTGGG + Intergenic
983466766 4:168103049-168103071 GTTTAATCCAGAATATGTATAGG - Intronic
983566766 4:169161414-169161436 ATTTAATCAAAAATATTTATAGG - Intronic
984412342 4:179409806-179409828 ATTTAATTCAATATATCCTTTGG - Intergenic
986160523 5:5224250-5224272 ATTTAATCCATAATATGTAATGG + Intronic
987194860 5:15516508-15516530 CTTTAATTCAATATATTTGTAGG + Intronic
987443674 5:17988664-17988686 ATTAAATTTAATATAGGTGTAGG + Intergenic
988424093 5:31042482-31042504 ATTTAAAAAAATATAGGTGTTGG + Intergenic
989786903 5:45343658-45343680 ATATAATCTACTACATGTGTGGG + Intronic
989959842 5:50399495-50399517 ATTTATTCCCATATATTTGGGGG - Intronic
990788086 5:59445420-59445442 ATTTAATACCATATAAATGTTGG - Intronic
990929324 5:61070110-61070132 ATTTAATCCAATATATGTGTAGG - Intronic
992763670 5:79974440-79974462 ATTTAATCCAATCTCCGTTTTGG - Intergenic
992778527 5:80108185-80108207 ATTTAGTCCATTGTATGTGTGGG - Intergenic
992909399 5:81380595-81380617 ATTTTTTCCAGTATATTTGTGGG - Intronic
993282656 5:85946477-85946499 ATGTAATCAAATAAAAGTGTAGG - Intergenic
994914326 5:105953924-105953946 ATTTTACCCAATAAATGTTTTGG - Intergenic
994981431 5:106879407-106879429 CTCTAAATCAATATATGTGTAGG - Intergenic
995090260 5:108166888-108166910 TATTAATCCATTAGATGTGTAGG + Intronic
995789583 5:115870995-115871017 ATTTAATCCACTGTGTGTGCAGG - Intronic
996206714 5:120746912-120746934 ATTTTATCCAATAACTATGTTGG - Intergenic
996366483 5:122706831-122706853 ATTTATTTCAGTATATGTGAGGG - Intergenic
997034193 5:130167918-130167940 ATTTAATCCAATATCAGACTGGG + Intronic
998490478 5:142542061-142542083 ATTTAATCCACTAAATTTGGGGG - Intergenic
999932732 5:156451172-156451194 GTTTAATGCCATAGATGTGTGGG + Intronic
1000080199 5:157838092-157838114 ATTTAATCCAATTTAAGTCAAGG + Intronic
1000552239 5:162681403-162681425 AATAAATCCAAAATATATGTTGG + Intergenic
1000832681 5:166123182-166123204 ATTAATTACAATAAATGTGTTGG - Intergenic
1000894169 5:166835120-166835142 CTTCAATGCAATAAATGTGTAGG - Intergenic
1001657037 5:173359048-173359070 ATTTAAGGCAATAGATGTGGTGG - Intergenic
1002952971 6:1833648-1833670 AGGTCATCCAAAATATGTGTGGG - Intronic
1004002310 6:11606608-11606630 AATTAAGCCATTATATCTGTTGG + Intergenic
1004064688 6:12232298-12232320 ATCTAATCAGATATATGTATTGG - Intergenic
1004081327 6:12396404-12396426 TTCTTATCCACTATATGTGTGGG + Intergenic
1004135289 6:12960400-12960422 ATTAATTCCAAAATATTTGTAGG - Intronic
1004950232 6:20661880-20661902 ACATAATTAAATATATGTGTTGG + Intronic
1006262986 6:32892746-32892768 ATTTTATCCTATGCATGTGTGGG - Intergenic
1007754609 6:44090824-44090846 CTTTAATGAAATATAAGTGTTGG + Intergenic
1008348059 6:50453980-50454002 ATTTTATCCAATAAATATGAGGG - Intergenic
1009559909 6:65225917-65225939 ATTGAATATAATATATTTGTGGG - Intronic
1010079523 6:71843711-71843733 TTCTATTCTAATATATGTGTTGG + Intergenic
1010737868 6:79462985-79463007 ATATTATTCATTATATGTGTTGG - Intergenic
1012367391 6:98458964-98458986 GTTTAATTTGATATATGTGTGGG + Intergenic
1012863556 6:104591314-104591336 ATGTACTCAAACATATGTGTGGG - Intergenic
1012905841 6:105064541-105064563 AATGAATGCAATATATGTGCGGG - Intronic
1013747417 6:113362321-113362343 TTTTAAGCCACTATATGTATAGG - Intergenic
1014161159 6:118170264-118170286 TTTGAATCAAATATATTTGTTGG + Intronic
1014291246 6:119561235-119561257 ATTTAACCCAAGATATGGTTAGG + Intergenic
1014318167 6:119892852-119892874 AGTTAAATAAATATATGTGTGGG + Intergenic
1015074429 6:129138150-129138172 ATTCACTCAAATATATGTATTGG - Intronic
1015565039 6:134561035-134561057 CTTTAATCCAATAAAAGTATTGG + Intergenic
1016197006 6:141356411-141356433 ATTCAATCATATATATGTGGTGG + Intergenic
1016197008 6:141356449-141356471 ATTCAATCATATATATGTGGTGG + Intergenic
1016670810 6:146705055-146705077 ATTTATTCCTAAATATGTTTTGG + Intronic
1017567008 6:155698205-155698227 AGTTGCTCCAATAAATGTGTGGG - Intergenic
1018337942 6:162815926-162815948 CATTAATACAATTTATGTGTAGG - Intronic
1018406633 6:163491175-163491197 ATTCAATCCATTATATCTTTTGG + Intronic
1021442753 7:20697186-20697208 AAGTAATCCAATATAAATGTGGG + Intronic
1021610320 7:22451510-22451532 ATTTAATATAATATAGCTGTTGG + Intronic
1022278812 7:28884084-28884106 ATTTAAGCCACTATATTTGGTGG - Intergenic
1023751259 7:43374908-43374930 ATATAATAAAATATATATGTAGG + Intronic
1027904673 7:84164314-84164336 ATTTATTCCAAAATTTGTATTGG - Intronic
1028102746 7:86841520-86841542 ATCTAGTCCCATATATCTGTAGG + Intronic
1028762658 7:94511673-94511695 ATTTAATTCAATTTATGTAATGG + Intronic
1030338715 7:108353005-108353027 ATTTAAAAAAATACATGTGTGGG - Intronic
1030920312 7:115376419-115376441 ATTTAATCTAATATATTTGCAGG + Intergenic
1032823948 7:135551189-135551211 ATTTAATCCAATCTGGGGGTAGG + Intergenic
1032979465 7:137265137-137265159 ATTTAATTCAATATTTTAGTAGG - Intronic
1033574751 7:142670040-142670062 ATATAATCCAATACATGCTTTGG - Intergenic
1035145953 7:156816885-156816907 GTATAATGAAATATATGTGTTGG - Intronic
1035849483 8:2901111-2901133 ATGTCATCCAATATACGTGCTGG - Intergenic
1037087794 8:14874506-14874528 ATTTAAGCCAATATTTATGTGGG - Intronic
1037221993 8:16535000-16535022 ATTTGCCCCCATATATGTGTAGG + Intronic
1040533376 8:48283786-48283808 ATTTACTACAATATAAGTTTAGG + Intergenic
1040701412 8:50070757-50070779 ATTTTATCCAATCAATGTGTGGG + Intronic
1043345183 8:79289664-79289686 TATTAATTCAATATATGTTTTGG - Intergenic
1043601966 8:81951110-81951132 ATGTAATCCAATTTATTTTTAGG + Intergenic
1044000190 8:86870102-86870124 ATTTATTCCAACATATGAGTTGG + Intronic
1044063632 8:87670963-87670985 ATTTCTTCAAATATATTTGTGGG - Intergenic
1044308040 8:90659980-90660002 ATTTAGGCCACTATATGTTTAGG + Intronic
1045194138 8:99912857-99912879 ATTCAATACAATAGATATGTTGG - Intergenic
1045493702 8:102690227-102690249 ATTTAAACCACTATATTTTTAGG - Intergenic
1045852650 8:106721404-106721426 ATTTAATCAAGTAAATGTGTGGG - Intronic
1046970013 8:120212464-120212486 ACTCAATTCAATATCTGTGTGGG - Exonic
1047570452 8:126093400-126093422 CTTTAATCCAAGATTTGTCTTGG - Intergenic
1047588544 8:126301771-126301793 ATTTATTTTAATATATATGTGGG + Intergenic
1047939557 8:129816076-129816098 ATTCAACCCAATAAATGGGTAGG + Intergenic
1050045365 9:1538289-1538311 ATATAGTCCTTTATATGTGTTGG - Intergenic
1050778911 9:9305528-9305550 ATTGAATCCAATATATGGCATGG - Intronic
1052459031 9:28739176-28739198 ATTTGTTCCAATATATTTTTTGG - Intergenic
1052580822 9:30351377-30351399 AATAAATTCAATAAATGTGTAGG - Intergenic
1053179788 9:35958798-35958820 ATTTATTGCAATATATGGGGAGG + Intergenic
1054881924 9:70152899-70152921 ATTTAATAAATGATATGTGTGGG - Intronic
1057018290 9:91674735-91674757 ATGTAATCCACTATATTTATAGG - Intronic
1058647153 9:107141323-107141345 ATTCACTCCAATCTATGTGCTGG - Intergenic
1059004824 9:110390749-110390771 AATTAATTCAATATTTCTGTGGG - Intronic
1059636088 9:116172056-116172078 ATTTAATGCATAATATGTGTCGG + Intronic
1060063257 9:120480631-120480653 AATGCATACAATATATGTGTAGG - Intronic
1060332182 9:122683122-122683144 ATATTGTCCTATATATGTGTAGG - Intergenic
1060760483 9:126243655-126243677 ATTTAATTCAATATATTAATAGG - Intergenic
1061455307 9:130693170-130693192 ATTTACTCCAATATTTCTTTTGG - Intergenic
1061764068 9:132870242-132870264 AATTAATCACATAAATGTGTGGG - Intronic
1186058507 X:5677967-5677989 ATTTAATAAAACATATCTGTTGG - Intergenic
1186698696 X:12066461-12066483 AATTAAACAAATATATTTGTTGG + Intergenic
1188689709 X:33114443-33114465 AATTACTCCAAGAAATGTGTAGG + Intronic
1188707654 X:33355894-33355916 ATTTTATCACATATATATGTTGG + Intergenic
1194108922 X:89806704-89806726 ATTTAATTCAATAGAGATGTAGG + Intergenic
1194877153 X:99202802-99202824 ATATAATCCAATATAAAAGTCGG - Intergenic
1194938311 X:99978794-99978816 GTTTAATCTAATAAAAGTGTAGG + Intergenic
1194952888 X:100147943-100147965 AATTAATACTATATATGTGTGGG - Intergenic
1196191833 X:112802895-112802917 ATTGAAAATAATATATGTGTTGG - Intronic
1196554628 X:117071707-117071729 ATAGAATTCAAAATATGTGTAGG + Intergenic
1196707937 X:118731928-118731950 ACTTAATCATATATATGTCTAGG + Intronic
1197167757 X:123396666-123396688 TTTCCATTCAATATATGTGTAGG - Intronic
1199701191 X:150377005-150377027 TTTTAATCACATAAATGTGTTGG + Intronic
1200461579 Y:3461439-3461461 ATTTAATTCAATAGAGATGTAGG + Intergenic