ID: 990938181

View in Genome Browser
Species Human (GRCh38)
Location 5:61172994-61173016
Sequence TGGGATCCTGAACATGGGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990938173_990938181 22 Left 990938173 5:61172949-61172971 CCATTTAATATTTAGAATAGGCA No data
Right 990938181 5:61172994-61173016 TGGGATCCTGAACATGGGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990938181 Original CRISPR TGGGATCCTGAACATGGGAT GGG Intergenic
No off target data available for this crispr