ID: 990938455

View in Genome Browser
Species Human (GRCh38)
Location 5:61175580-61175602
Sequence TGTAGCTTGTAAAACCTGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990938455_990938457 14 Left 990938455 5:61175580-61175602 CCCATCAGGTTTTACAAGCTACA No data
Right 990938457 5:61175617-61175639 AATATTTAGAAAATGATTCAAGG No data
990938455_990938458 21 Left 990938455 5:61175580-61175602 CCCATCAGGTTTTACAAGCTACA No data
Right 990938458 5:61175624-61175646 AGAAAATGATTCAAGGAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990938455 Original CRISPR TGTAGCTTGTAAAACCTGAT GGG (reversed) Intergenic
No off target data available for this crispr