ID: 990939688

View in Genome Browser
Species Human (GRCh38)
Location 5:61189060-61189082
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990939688_990939692 -7 Left 990939688 5:61189060-61189082 CCTGTAGCCCCTTTGTTTTGGCC No data
Right 990939692 5:61189076-61189098 TTTGGCCAATTTCTCCCTTTTGG No data
990939688_990939695 -1 Left 990939688 5:61189060-61189082 CCTGTAGCCCCTTTGTTTTGGCC No data
Right 990939695 5:61189082-61189104 CAATTTCTCCCTTTTGGAATGGG No data
990939688_990939694 -2 Left 990939688 5:61189060-61189082 CCTGTAGCCCCTTTGTTTTGGCC No data
Right 990939694 5:61189081-61189103 CCAATTTCTCCCTTTTGGAATGG No data
990939688_990939698 28 Left 990939688 5:61189060-61189082 CCTGTAGCCCCTTTGTTTTGGCC No data
Right 990939698 5:61189111-61189133 TACCCAATGCTTGTCTCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990939688 Original CRISPR GGCCAAAACAAAGGGGCTAC AGG (reversed) Intergenic