ID: 990939690

View in Genome Browser
Species Human (GRCh38)
Location 5:61189068-61189090
Sequence GAGAAATTGGCCAAAACAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990939690_990939698 20 Left 990939690 5:61189068-61189090 CCCTTTGTTTTGGCCAATTTCTC No data
Right 990939698 5:61189111-61189133 TACCCAATGCTTGTCTCCCCAGG No data
990939690_990939694 -10 Left 990939690 5:61189068-61189090 CCCTTTGTTTTGGCCAATTTCTC No data
Right 990939694 5:61189081-61189103 CCAATTTCTCCCTTTTGGAATGG No data
990939690_990939695 -9 Left 990939690 5:61189068-61189090 CCCTTTGTTTTGGCCAATTTCTC No data
Right 990939695 5:61189082-61189104 CAATTTCTCCCTTTTGGAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990939690 Original CRISPR GAGAAATTGGCCAAAACAAA GGG (reversed) Intergenic