ID: 990939692

View in Genome Browser
Species Human (GRCh38)
Location 5:61189076-61189098
Sequence TTTGGCCAATTTCTCCCTTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990939682_990939692 21 Left 990939682 5:61189032-61189054 CCCTGCTGGATTTCAGACTTGCA No data
Right 990939692 5:61189076-61189098 TTTGGCCAATTTCTCCCTTTTGG No data
990939683_990939692 20 Left 990939683 5:61189033-61189055 CCTGCTGGATTTCAGACTTGCAT No data
Right 990939692 5:61189076-61189098 TTTGGCCAATTTCTCCCTTTTGG No data
990939688_990939692 -7 Left 990939688 5:61189060-61189082 CCTGTAGCCCCTTTGTTTTGGCC No data
Right 990939692 5:61189076-61189098 TTTGGCCAATTTCTCCCTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990939692 Original CRISPR TTTGGCCAATTTCTCCCTTT TGG Intergenic