ID: 990939695

View in Genome Browser
Species Human (GRCh38)
Location 5:61189082-61189104
Sequence CAATTTCTCCCTTTTGGAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990939691_990939695 -10 Left 990939691 5:61189069-61189091 CCTTTGTTTTGGCCAATTTCTCC No data
Right 990939695 5:61189082-61189104 CAATTTCTCCCTTTTGGAATGGG No data
990939682_990939695 27 Left 990939682 5:61189032-61189054 CCCTGCTGGATTTCAGACTTGCA No data
Right 990939695 5:61189082-61189104 CAATTTCTCCCTTTTGGAATGGG No data
990939683_990939695 26 Left 990939683 5:61189033-61189055 CCTGCTGGATTTCAGACTTGCAT No data
Right 990939695 5:61189082-61189104 CAATTTCTCCCTTTTGGAATGGG No data
990939689_990939695 -8 Left 990939689 5:61189067-61189089 CCCCTTTGTTTTGGCCAATTTCT No data
Right 990939695 5:61189082-61189104 CAATTTCTCCCTTTTGGAATGGG No data
990939688_990939695 -1 Left 990939688 5:61189060-61189082 CCTGTAGCCCCTTTGTTTTGGCC No data
Right 990939695 5:61189082-61189104 CAATTTCTCCCTTTTGGAATGGG No data
990939690_990939695 -9 Left 990939690 5:61189068-61189090 CCCTTTGTTTTGGCCAATTTCTC No data
Right 990939695 5:61189082-61189104 CAATTTCTCCCTTTTGGAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990939695 Original CRISPR CAATTTCTCCCTTTTGGAAT GGG Intergenic