ID: 990939696

View in Genome Browser
Species Human (GRCh38)
Location 5:61189090-61189112
Sequence TAAATGCTCCCATTCCAAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990939696_990939704 28 Left 990939696 5:61189090-61189112 CCCTTTTGGAATGGGAGCATTTA No data
Right 990939704 5:61189141-61189163 TAACTTGCTTTTGATTTTATAGG No data
990939696_990939698 -2 Left 990939696 5:61189090-61189112 CCCTTTTGGAATGGGAGCATTTA No data
Right 990939698 5:61189111-61189133 TACCCAATGCTTGTCTCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990939696 Original CRISPR TAAATGCTCCCATTCCAAAA GGG (reversed) Intergenic