ID: 990939698

View in Genome Browser
Species Human (GRCh38)
Location 5:61189111-61189133
Sequence TACCCAATGCTTGTCTCCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990939688_990939698 28 Left 990939688 5:61189060-61189082 CCTGTAGCCCCTTTGTTTTGGCC 0: 754
1: 1560
2: 1620
3: 1220
4: 879
Right 990939698 5:61189111-61189133 TACCCAATGCTTGTCTCCCCAGG No data
990939693_990939698 7 Left 990939693 5:61189081-61189103 CCAATTTCTCCCTTTTGGAATGG 0: 178
1: 1419
2: 1915
3: 1677
4: 1457
Right 990939698 5:61189111-61189133 TACCCAATGCTTGTCTCCCCAGG No data
990939691_990939698 19 Left 990939691 5:61189069-61189091 CCTTTGTTTTGGCCAATTTCTCC 0: 1353
1: 1777
2: 1511
3: 1080
4: 925
Right 990939698 5:61189111-61189133 TACCCAATGCTTGTCTCCCCAGG No data
990939697_990939698 -3 Left 990939697 5:61189091-61189113 CCTTTTGGAATGGGAGCATTTAC 0: 93
1: 302
2: 748
3: 1808
4: 1849
Right 990939698 5:61189111-61189133 TACCCAATGCTTGTCTCCCCAGG No data
990939689_990939698 21 Left 990939689 5:61189067-61189089 CCCCTTTGTTTTGGCCAATTTCT 0: 1356
1: 1731
2: 1382
3: 958
4: 903
Right 990939698 5:61189111-61189133 TACCCAATGCTTGTCTCCCCAGG No data
990939696_990939698 -2 Left 990939696 5:61189090-61189112 CCCTTTTGGAATGGGAGCATTTA 0: 50
1: 216
2: 428
3: 987
4: 2212
Right 990939698 5:61189111-61189133 TACCCAATGCTTGTCTCCCCAGG No data
990939690_990939698 20 Left 990939690 5:61189068-61189090 CCCTTTGTTTTGGCCAATTTCTC 0: 1403
1: 1777
2: 1443
3: 1064
4: 1003
Right 990939698 5:61189111-61189133 TACCCAATGCTTGTCTCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990939698 Original CRISPR TACCCAATGCTTGTCTCCCC AGG Intergenic
No off target data available for this crispr