ID: 990939698

View in Genome Browser
Species Human (GRCh38)
Location 5:61189111-61189133
Sequence TACCCAATGCTTGTCTCCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990939693_990939698 7 Left 990939693 5:61189081-61189103 CCAATTTCTCCCTTTTGGAATGG No data
Right 990939698 5:61189111-61189133 TACCCAATGCTTGTCTCCCCAGG No data
990939688_990939698 28 Left 990939688 5:61189060-61189082 CCTGTAGCCCCTTTGTTTTGGCC No data
Right 990939698 5:61189111-61189133 TACCCAATGCTTGTCTCCCCAGG No data
990939697_990939698 -3 Left 990939697 5:61189091-61189113 CCTTTTGGAATGGGAGCATTTAC No data
Right 990939698 5:61189111-61189133 TACCCAATGCTTGTCTCCCCAGG No data
990939690_990939698 20 Left 990939690 5:61189068-61189090 CCCTTTGTTTTGGCCAATTTCTC No data
Right 990939698 5:61189111-61189133 TACCCAATGCTTGTCTCCCCAGG No data
990939696_990939698 -2 Left 990939696 5:61189090-61189112 CCCTTTTGGAATGGGAGCATTTA No data
Right 990939698 5:61189111-61189133 TACCCAATGCTTGTCTCCCCAGG No data
990939691_990939698 19 Left 990939691 5:61189069-61189091 CCTTTGTTTTGGCCAATTTCTCC No data
Right 990939698 5:61189111-61189133 TACCCAATGCTTGTCTCCCCAGG No data
990939689_990939698 21 Left 990939689 5:61189067-61189089 CCCCTTTGTTTTGGCCAATTTCT No data
Right 990939698 5:61189111-61189133 TACCCAATGCTTGTCTCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990939698 Original CRISPR TACCCAATGCTTGTCTCCCC AGG Intergenic